Alan andrade - Avaliação fenotípica de uma população de C. canephora Conilon cultivada em altitude elevada, visando um programa de Seleção Genômica Ampla (SGA) em cafeeiro.

Download Alan andrade - Avaliação fenotípica de uma população de C. canephora Conilon cultivada em altitude elevada, visando um programa de Seleção Genômica Ampla (SGA) em cafeeiro.

Post on 04-Jun-2015

508 views

Category:

Education

3 download

DESCRIPTION

Avaliao fenotpica de uma populao de C. canephora Conilon cultivada em altitude elevada, visando um programa de Seleo Genmica Ampla (SGA) em cafeeiro. VIII Simpsio de Pesquisa dos Cafs do Brasil 25 28 de Novembro, 2013, Salvador-BA.

TRANSCRIPT

  • 1. Avaliao fenotpica de uma populao de C. canephora Conilon cultivada em altitude elevada, visando um programa de Seleo Genmica Ampla (SGA) em cafeeiro. VIII Simpsio de Pesquisa dos Cafs do Brasil 25 28 de Novembro, 2013, Salvador-BA.Alan C. Andrade Laboratory of Molecular Genetics - LGM alan.andrade@embrapa.br

2. SGA FentipoDNA XX PAIMePAIMe 3. Seleo Genmica AmplaFenotipagemMapeamento (Genoma Referncia)Genotipagem DNA Chip/GBSInteresse InformaoNormais Anlises EstatsticasDesequilbrio de Ligao 4. Esquema de trabalho/ Programa SGA Material VegetalAvaliaes fenotpicasGenotipagemEstudos de AssociaoSeleo de indivduos(1300 ) Extrao de DNA Avaliaes fisiolgicas( am) Avaliaes de campo(Produo, Vigor, SP, etc...) Avaliaes de Laboratrio (Parmetros morfolgicos e bioqumicos dos frutos) Mapeamento de sequencias ( Grupos de diversidade, parentais) Minerao de SNPs GenotipagemAnlises Estatsticas 5. Seleo Genmica AmplaProduoCromossomoTolerncia secaCromossomo 6. Coffea canephoraEmbrapa Cerrados, Planaltina-DF (1.175m altitude) 7. Populao de Coffea canephora Populao de 3500 indivduos (Maro de 2008) Pool de sementes do campo experimental do INCAPER, contendo 48 parentais Introduo de hbridos do CIRAD (Clone 61/126 (Guinean x SG1+SG2) x A03 (SG1)) 8. Diversidade Fenotpica 9. PAR24PAR151PAR35PAR30PAR19PAR10PAR26PAR147PAR12PAR78PAR152PAR60PAR07PAR32PAR20PAR59PAR22 11 SSRs 48 parentais do Incaper 250 indivduosPAR11PAR74PAR08 2PAR25PAR29PAR06PAR09PAR70PAR160PAR130PAR121PAR05PAR18PAR17PAR148PAR08 1PAR15PAR04PAR23PAR28PAR16PAR14PAR31PAR13PAR03PAR02UW148 SG2C2014 SG2G7001 GG1003 GC5001 SG2C1006 BC3008 SG1C3001 SG11648-1 SG1UN012 SG2UE020 SG2C4021 CPAR222 INCAPERPAR1111 INCAPERPAR333 INCAPERPAR66 INCAPERPAR01 INCAPER1637-1 SG1C4003 CDiversidade gentica Var. 8111 Var. 8121 Var. 8131 Var. 8141-Robusto Var. 8142 C. Vitoria 10. Diversidade GenticaParentais INCAPER Populao EMBRAPA Grupo SG1 Grupo SG2 Grupo Guineano 11. MATERIAL VEGETAL 48 genitores INCAPER3500 indivduosAvaliaoGenotipagemFenotipagem SECA (Potencial hdrico de antemanh- am) Produo (2012/2013) Qualidade Fsica Classificao quanto aos defeitos e impurezas Peneira Peso de 100 gros Medida e forma dos frutosSeleo de 1300 indivduos 12. Avaliaes fenotpicas Produo (2011/12; 2012/13) Vigor, Seca de Ponteiros, Ferrugem Morfologia de frutos (Tamanho e formato dos frutos/gros; Peneira) Potencial hdrico de antemanh ( am) Bioqumica (NIRs) 13. Avaliaes fenotpicasProduo (Safras 2011/12; 2012/13). 600Total: 1292 ind.400300200100Produo Mdia (L)17,98-20,9615,01-17,9812,03-159,04-12,026,06-9,033,08-6,050 0,1-3,07Nmero de indivduos500 14. PlantaMedidas (cm) reaE1E2E3E4E5MdiaMenor eixo Maior eixo rea0,8476 0,8548 0,8979 0,6393 0,8476 0,8174 1,1996 1,1421 1,1206 1,0200 1,0846 1,1134 2,7595 3,0292 2,9748 2,2486 2,4950 2,7014Permetro 9,5112 9,8257 9,7624 8,5690 9,0959 9,3528 L1P49Menor eixo Maior eixo rea0,8045 0,9194 0,8907 0,7327 0,7470 0,8189 1,0918 1,0487 1,0631 0,9769 1,0631 1,0487 2,7543 2,7689 3,3083 2,4859 2,9070 2,8449Permetro 9,4084 9,4497 10,3036 8,9968 9,6568 9,5631 L1P65Menor eixo Maior eixo rea0,8476 0,8404 0,9338 0,7758 0,8763 0,8548 1,0344 1,0487 1,1277 1,0200 1,0559 1,0573 3,5965 3,7512 3,4234 3,1398 3,5732 3,4968Permetro 10,8373 11,0463 10,5376 10,0058 10,7474 10,6349 L2P8Menor eixo Maior eixo rea0,9266 0,9553 0,9194 0,9338 0,9482 0,9367 1,2355 1,2499 1,1852 1,0703 1,1996 1,1881 2,5131 2,3896 2,6324 2,6324 2,7232 2,5781Permetro 8,9727 8,7076 9,1905 9,1905 9,3274 9,0777 L4P51Menor eixo Maior eixoAvaliaes fenotpicas3,1942 3,0670 3,1608 2,0485 2,8882 2,8717Permetro 10,2846 10,0100 10,0965 8,3837 9,6723 9,6894 L1P15Foto0,8189 0,8404 0,8332 0,8332 0,8620 0,8375 0,9769 0,9051 1,0056 1,0056 1,0056 0,9798Morfologia de frutos Total: 1292 ind. 15. Avaliaes fenotpicasPeneira. Linha PlantaTotal: 1292 ind.Peneiras (gramas)Peso inicial19131812171116101591413812FinalPeso de 100 gros11598,9780,4275,1210,88813,45531,2557,123,1693,4452,9870,6920,2220,0930,0470018,96421098,9771,2082,9512,36822,94815,35214,38222,9836,6848,2710,80,9710,07700013,8556098,978,30423,66621,00414,62622,8282,184,1121,4060,3840,1010,196000019,6428421000,3713,4610,95712,41212,92911,32325,45310,94111,4466,5842,1011,5011,520,167017,045126899,6790,8283,2530,83611,36815,69813,82130,0979,44110,8971,6421,2760,2860,0690016,0421810097,610,18100,14810,3814,12510,35927,0887,62218,0363,0242,4820,9670,2220,1280,02714,301213698,8363,9635,5722,04117,92425,7575,95311,881,7692,6430,9620,3530,076000,11116,218 16. Avaliaes fenotpicas am. 250Total: 404 ind.Number of individuals200150100500 -3,5 a -3,0-3,0 a -2,5-2,5 a -2,0-2,0 a -1,5 am (MPa)-1,5 a -1,0-1,0 a -0,5-0,5 a 0 17. am (MPa) -2,00-2,50-3,00-3,50-4,00L5P47L8P68L13P63L6P36L8P42L12P8L7P63L5P60L7P52L6P75L4P13L12P97L18P18L12P36L15P14L12P100L12P57Produo (L)Avaliaes fenotpicas2018161412108 2012620134200,00-0,50-1,00-1,5020122013 18. Ferramentas Genmicas 19. Genmica Funcional https://alanine.cenargen.embrapa.br/http://www.lge.ibi.unicamp.br/cafe/ 20. Coffee Genomics (http://www.coffeegenome.org )International Coffee Genome Network Founding meeting Paris 4 & 5 April 2005 21. Coffee Genomics (C. Canephora) Patrick Wincker, Benoit Bertrand, Xavier Argout, Alexander de Kochko, Philippe Lashermes Ray Ming, Victor A. Albert, Steve Rounsley, Chifumi Nagai Alan C. Andrade Giorgio Graziosi, Giovanni Giuliano Robert Henry David Sankoff Jayarama Artigo submetido ! 22. Coffee Genomics Seq. Length 23. Paired endRe-sequenciamentoLibraries 500 pb < fragment < 900pb 700pb Kit TruSeq DNA Sample Prep da illumina Quantificada por PCR quantitativo em tempo real (qPCR) Adaptadores Read 1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG Read 2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCAT HiSeq2000 Sequencing Kit SBS version 3. Fastq generated with Casava 1.8.2. 24. Re-sequenciamento ConilonsBulk de indivduos Nome do pool PoolGrupo GrupoC1 C2 C3 C4 C5 C6 C7 C8 C9 C10 C11 C12 C13 C14Conilon Conilon Conilon Conilon Conilon Conilon Conilon Conilon Conilon Conilon Conilon Conilon Conilon ConilonNmero de indivduos N de ind. por pool 5 1 5 4 4 5 6 2 3 4 2 3 2 2 25. Re-sequenciamento DiversidadeNome do pool PoolGentipo Sub-GruposPopulao GruposD1 D2 D3 D4 D5 D6 D7 D8 D9 D10Luki Niaouli Nana Libengue INEAC Erect Nganda Wild Pelezi MouniandougouSG1 SG1 C B SG2 SG2 SG2 SG2 G GFonte: Cubry et al, 2013Nmero de N ind. indivduos por pool 10 9 10 9 4 2 2 3 1 1 26. Re-sequenciamento BulkSequencias geradasConilon704.388.334Grupos de Diversidade591.003.832SEQUNCIAS MAPEADAS POR CROMOSSOMOGRUPO C1 Chr 0 22.847.673 Chr 1 2.747.574 Chr 2 3.745.735 Chr 3 2.175.734 Chr 4 1.980.196 Chr 5 2.195.347 Chr 6 2.584.643 Chr 7 2.442.490 Chr 8 2.261.443 Chr 9 1.552.561 Chr 10 1.915.275 Chr 11 2.565.490 SEQUNCIAS 49.014.161 MAPEADAS SEQUNCIAS 2.921.469 NO MAPEADAS TOTAL DE 51.935.630 SEQUNCIASC2 23.266.498 2.606.043 3.461.916 2.027.575 1.878.082 2.047.966 2.522.983 2.976.066 2.186.163 1.495.944 1.851.555 2.386.719C3 26.251.519 2.860.528 3.694.033 2.213.335 2.023.810 2.268.753 2.728.238 3.546.638 2.402.402 1.609.198 1.990.848 2.607.106SEQUNCIAS MAPEADAS POR CROMOSSOMO NOS GRUPOS DE CONILON C4 C5 C6 C7 C8 C9 C10 22.920.224 26.500.581 27.815.681 17.130.483 19.537.273 22.522.141 17.383.775 2.566.752 3.011.794 3.260.396 1.981.073 2.222.365 2.661.276 1.932.017 3.362.678 3.978.005 4.306.896 2.622.638 2.981.014 3.600.217 2.572.280 2.030.661 2.354.675 2.526.614 1.575.480 1.815.314 2.133.057 1.570.070 1.828.973 2.166.485 2.310.580 1.423.346 1.602.356 1.945.111 1.406.433 2.019.978 2.363.754 2.557.089 1.560.357 1.759.123 2.096.641 1.523.240 2.452.092 2.891.910 3.097.469 1.897.330 2.146.752 2.586.767 1.870.663 2.995.165 3.333.671 3.463.330 2.325.487 2.758.670 2.726.545 2.370.544 2.162.838 2.522.483 2.802.880 1.675.104 1.884.538 2.228.929 1.610.152 1.461.082 1.723.491 1.798.908 1.113.532 1.280.404 1.533.941 1.132.404 1.831.830 2.122.887 2.305.051 1.396.694 1.604.950 1.915.852 1.384.972 2.376.587 2.763.460 3.008.855 1.834.382 2.060.489 2.461.882 1.800.893C11 17.976.528 2.027.509 2.672.530 1.608.337 1.448.269 1.593.879 1.949.751 2.208.992 1.682.928 1.164.787 1.441.490 1.833.626C12 24.389.429 2.932.716 3.958.483 2.306.835 2.111.932 2.304.424 2.813.507 3.008.706 2.536.347 1.640.864 2.117.205 2.751.43048.707.51054.196.40848.008.86055.733.19659.253.74936.535.90641.653.24848.412.35936.557.44337.608.62652.871.8784.144.0785.529.1464.119.9664.899.7344.275.9574.013.4445.915.8645.017.2234.249.8094.577.8745.810.45652.851.58859.725.55452.128.82660.632.93063.529.70640.549.35047.569.11253.429.58240.807.25242.186.50058.682.334 27. Re-sequenciamento BulkSequencias geradasConilon704.388.334Grupos de Diversidade591.003.832SEQUNCIAS MAPEADAS POR CROMOSSOMO NOS GRUPOS DE DIVERSIDADE D1 D2 D3 D4 D5 D6 D7 D8 27.695.876 27.101.635 16.271.875 23.141.784 23.074.050 28.571.894 26.753.857 29.538.728 3.431.114 3.232.529 2.017.466 2.950.498 2.763.441 3.547.441 3.299.137 3.766.199 4.603.996 4.309.656 2.676.556 4.054.325 3.743.728 4.791.640 4.540.919 5.078.303 2.674.003 2.527.164 1.623.370 2.377.438 2.176.914 2.774.354 2.607.283 2.966.314 2.481.739 2.322.979 1.493.817 2.170.156 2.023.848 2.539.815 2.432.384 2.746.025 2.671.215 2.526.554 1.596.948 2.342.968 2.176.214 2.803.213 2.639.585 3.018.461 3.258.288 3.078.079 1.901.349 2.804.512 2.569.606 3.271.167 3.106.704 3.502.127 3.746.639 3.312.451 1.836.496 2.518.417 2.547.593 3.260.074 2.888.482 3.354.396 2.838.105 2.760.295 1.608.770 2.471.645 2.267.623 2.922.573 2.775.392 3.076.853 1.949.437 1.807.508 1.170.531 1.713.601 1.600.820 1.999.471 1.924.634 2.169.494 2.437.177 2.313.103 1.390.730 2.084.703 1.906.496 2.426.099 2.304.655 2.616.276 3.081.853 2.980.733 1.865.377 2.667.971 2.523.213 3.233.074 3.090.200 3.405.446SEQUNCIAS MAPEADAS POR CROMOSSOMOGRUPO Chr 0 Chr 1 Chr 2 Chr 3 Chr 4 Chr 5 Chr 6 Chr 7 Chr 8 Chr 9 Chr 10 Chr 11 SEQUNCIAS 60.869.442 MAPEADAS SEQUNCIAS 3.988.502 NO MAPEADAS TOTAL DE 64.857.944 SEQUNCIASD9 18.418.614 2.173.713 2.970.096 1.716.333 1.598.272 1.735.114 2.088.515 1.874.394 1.835.139 1.294.014 1.543.520 2.011.636D10 18.892.558 2.341.398 3.265.888 1.836.306 1.717.224 1.848.829 2.262.538 2.171.182 1.968.567 1.368.028 1.688.319 2.137.96158.272.68635.453.28551.298.01849.373.54662.140.81558.363.23265.238.62239.259.36041.498.79811.152.9228.002.5974.918.53410.100.2905.181.1753.473.4985.587.17011.452.4805.378.86069.425.60843.455.88256.216.55259.473.83667.321.99061.836.73070.825.79250.711.84046.877.658 28. Bioinformtica SequenciamentoProduo de sequenciasMapeamentoMapeamento das sequencias no genoma de refernciaRefinamentoRealinhamento local; recalibrao de qualidade (estimativa de PHRED scores)Minerao de SNPsParmetros de cobertura (> 30%); qualidade; bias na fase de leitura.DePristo MA, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. Nielsen R, Paul JS, Albrechtsen A, Song YS. Genotype and SNP calling from next-generation sequencing data. Nat Rev Genet. 2011 Jun;12(6):443-51. 29. Realinhamento Local 30. Identificao de SNPs 31. Alinhamento 32. Estado da Arte Material VegetalFenotipagemGenotipagemEstudos de AssociaoSeleo dos indivduos (1300 ) Extrao de DNA Avaliaes fisiolgicas ( am) Avaliaes de Campo (Produo) Avaliaes de laboratrio (Parmetros morfolgicos e bioqumicos) Mapeamento das sequencias ( Grupos de diversidade, parentais) Minerao de SNPs GenotipagemAnlises Estatsticas xX 33. Re-sequenciamento Tolerncia Seca e Nematides Clone 14Clone 22ToleranteControle 34. Nematides A- 4 DPID 4 DPIB 16 DPIE UV 4 DPIC 45 DPIF 45 DPIclone 22, Meloidogyne paranaensis infection; D-E Incompatible reaction of M. paranaensis with clone 14 showing HR (D-E) e Cell-death (F) Lima et al.2012 Fig. A-C 35. Clones 22 e 14Re-sequenciamento6 runs 3 runs/library 36. Re-sequenciamento 37. Re-sequenciamento 100N75 50 25 0 14IRelative expression100014NI22I22NID750 500 250 0 14I14NI22I22NI 38. Coffee Genomics (C. arabica) Dominique Crouzilat (Nestl), Alexandre de Kochko and Romain Guyot (IRD), Pierre MarracciniLukas Mueller and Susan Strickler (BTI), Ray Ming (UIUC) Alan C. Andrade, Luis F. P. Pereira (Embrapa) and Douglas S. Domingues (IAPAR) http://bti.cornell.edu/decoding-the-genes-inyour-beans-working-towards-a-better-coffee/ 39. Resumo Existe potencial para cultivo de C. canephora em altitudes elevadas. Plantas perenes como o caf sero as mais beneficiadas com programas de seleo genmica (Custo de testes de campo/seleo precoce!) A plataforma de genotipagem beneficiar outros programas de C. canephora (DNA Chip). Os dados obtidos, j nos permite desenvolver mtodos moleculares eficientes e de baixo custo, para proteo de cultivares em C. canephora. 40. Colaboradores:A.F. GUERRA Embrapa-CafD. Grattapaglia Embrapa-CenargenG.F . BARTHOLO Embrapa-CafM. D. V. Resende Embrapa FlorestaO.C . ROcha Embrapa-CerradosG.C . RODRIGUES Embrapa-CNPTIAM. A. F. Carvalho Embrapa CafM.A.G. FERRO Embrapa-CafP. MARRACCINI HDR / AGAP-BurstC.BLOCH Jr. Embrapa-CenargenT . LEROY HDR / AGAP-EGVR.M.D.G.CARNEIRO Embrapa-CenargenD. THIS Montpellier Supagro 41. Equipe do LGM 42. Parceiros: 43. Obrigado!

Recommended

View more >