ORIGINAL ARTICLE

Theobroma cacao cystatins impair Moniliophthora perniciosamycelial growth and are involved in postponing cell deathsymptoms

Carlos Priminho Pirovani • Andre da Silva Santiago • Lıvia Santana dos Santos •

Fabienne Micheli • Rogerio Margis • Abelmon da Silva Gesteira • Fatima Cerqueira Alvim •

Goncalo Amarante Guimaraes Pereira • Julio Cezar de Mattos Cascardo

Received: 18 May 2010 / Accepted: 6 September 2010 / Published online: 22 September 2010

� Springer-Verlag 2010

Abstract Three cystatin open reading frames named

TcCys1, TcCys2 and TcCys3 were identified in cDNA

libraries from compatible interactions between Theobroma

cacao (cacao) and Moniliophthora perniciosa. In addition,

an ORF named TcCys4 was identified in the cDNA library

of the incompatible interaction. The cDNAs encoded

conceptual proteins with 209, 127, 124, and 205 amino acid

residues, with a deduced molecular weight of 24.3, 14.1,

14.3 and 22.8 kDa, respectively. His-tagged recombinant

proteins were purified from Escherichia coli expression,

and showed inhibitory activities against M. perniciosa. The

four recombinant cystatins exhibited Ki values against

papain in the range of 152–221 nM. Recombinant TcCYS3

and TcCYS4 immobilized in CNBr–Sepharose were effi-

cient to capture M. perniciosa proteases from culture

media. Polyclonal antibodies raised against the recombi-

nant TcCYS4 detected that the endogenous protein was

more abundant in young cacao tissues, when compared

with mature tissues. A *85 kDa cacao multicystatin

induced by M. perniciosa inoculation, MpNEP (necrosis

and ethylene-inducing protein) and M. perniciosa culture

supernatant infiltration were detected by anti-TcCYS4

antibodies in cacao young tissues. A direct role of the

cacao cystatins in the defense against this phytopathogen

was proposed, as well as its involvement in the develop-

ment of symptoms of programmed cell death.

Keywords Cystatin � Cysteine protease inhibitor �Moniliophthora � Programmed cell death � Theobroma �Witches’ broom

Abbreviations

BSA Bovine serum albumin

PLCPs Papain-like cysteine proteases

PCD Programmed cell death

NEP Necrosis and ethylene-inducing proteins

ORF Open reading frame

BApNA NL-alpha-benzoyl-DL-arginine-p-nitroanilide

hydrochloride

Introduction

Diseases are a major problem for cacao (Theobroma cacao

L.) production, causing annual crop losses of 30–40%

(Wood and Lass 1987). Cacao is susceptible to a number of

co-evolved pathogens, such as Moniliophthora (=Crinipel-

lis) perniciosa, the causal agent of witches’ broom disease

C. P. Pirovani � A. da Silva Santiago � L. S. dos Santos �F. Micheli � F. C. Alvim � J. C. de Mattos Cascardo (&)

UESC, DCB, Laboratorio de Proteomica,

Centro de Biotecnologia e Genetica, Rodovia Ilheus-Itabuna,

Km 16, Ilheus, BA 45650-000, Brazil

e-mail: cascardo@labbi.uesc.br

F. Micheli

CIRAD, UMR DAP, Avenue Agropolis TA96/03,

34398 Montpellier Cedex 5, France

R. Margis

UFRGS, Centro de Biotecnologia, Laboratorio de Genomas

e Populacoes de Plantas, Porto Alegre, Rio Grande do Sul, Brazil

A. da Silva Gesteira

EMBRAPA/CNPMF, Cruz das Almas, Bahia, Brazil

G. A. G. Pereira

Departamento de Genetica e Evolucao-UNICAMP,

Instituto de Biologia, Universidade Estadual de Campinas,

Campinas, Sao Paulo, Brazil

123

Planta (2010) 232:1485–1497

DOI 10.1007/s00425-010-1272-0

(Aime and Phillips-Mora 2005), which has spread

throughout Brazil, destroying plantations, leading to

important economical and social changes in affected areas

(Andebrhan et al. 1999). The M. perniciosa basidiospores

have the ability to infect any meristematic and young tissues

of cacao and are the only recognized infective propagules

(Evans 1980). The disease shows two distinct stages: a

biotrophic/parasitic and a necrotrophic/saprotrophic phase.

In the biotrophic phase, the fungus presents intercellular

monokaryotic mycelium, which causes hypertrophy and

hyperplasia of the tissues, loss of apical dominance, and

proliferation of axillary shoots, thus resulting in formation

of abnormal stems, called green brooms. In the second

stage, the fungus moves to the saprotrophic phase, with the

spread of intracellular dikaryotic mycelium, concomitant

with necrosis and death of infected tissues, distal to the

original infection site. This stage results in the formation of

the dry broom (Evans 1980; Ceita et al. 2007). Basidiomata

production and spore formation occur on infected necrotic

tissue (Silva et al. 2002).

In plant–pathogen interaction, proteases are thought to

be involved in a range of processes, including senescence

and defense responses (Van der Hoorn and Jones 2004), as

revealed by studies using protease inhibitors (Chichkova

et al. 2004). Proteolysis during plant–pathogen interaction

probably produces the selection of counteracting inhibitors,

non-cleavable substrates and other means to evade prote-

olysis. Therefore, the interaction of proteases with their

substrates and inhibitors can be seen as a molecular bat-

tlefield (Van der Hoorn and Jones 2004). Associations

between the induction of protease genes and defense have

also been found for genes that encode metallo-, aspartic-

and cysteine-proteases (Liu et al. 2001). Intriguingly, both

plants and their invaders use papain-like cysteine proteases

(PLCPs) or their inhibitors in these molecular confronta-

tions (Shindo and Hoorn 2008).

Phytocystatins are plant proteins that inhibit PLCPs.

Several members of this family have been characterized in

various plant species, and homology with animal cystatins

has been described (Margis et al. 1998). Most of phyto-

cystatins are small proteins, ranging in size from 12 to

16 kDa, with a distinct group having a higher molecular

weight (*23 kDa) due to a C-terminal extension (Shyu

et al. 2004; Margis-Pinheiro et al. 2008). Several multi-

cystatins with up to eight cystatin domains have been

reported, particularly in tomato (Wu and Haard 2004). In

plants, several roles have been attributed to cystatins,

ranging from regulation of various endogenous proteolytic

processes to the inhibition of exogenous cysteine proteases

secreted by predatory or pathogenic organisms during

herbivory or infection (Arai et al. 2002; Chan et al. 2010).

Empirical data suggested an active role for cystatins in

plant defense: (1) several cystatin-encoding genes are up

regulated by stress signals, such as mechanical wounding,

cold, insect predation, or metabolites involved in defense-

related pathways (Christova et al. 2006); (2) several plant

cystatins inhibit the digestive cysteine proteases of her-

bivorous insects and root parasitic nematodes (Arai et al.

2002); (3) some cystatins show detrimental effects against

plant pathogenic fungi (Soares-Costa et al. 2002; Martinez

et al. 2005); and (4) the expression of recombinant cysta-

tins in transgenic plants provides a protective effect against

several herbivorous predators and microbial pathogens

(Chan et al. 2010). Phytocystatins and cysteine proteases

were also required to regulate programmed cell death

(PCD) (Arai et al. 2002; Belenghi et al. 2003; Shindo and

Hoorn 2008).

Due to the environmental and economical importance of

the witches’ broom disease, recent studies have been

developed in order to understand the genomic program of

M. perniciosa, as well as the one of cacao during infection

by this pathogen (Gesteira et al. 2007; Ceita et al. 2007;

Garcia et al. 2007; Mondego et al. 2008). Theobroma

cacao–M. perniciosa interaction cDNA libraries contained

sequences of distinct classes of protease (cysteine, serine

and aspartic proteases) and protease inhibitors, such as

cystatins (Gesteira et al. 2007). The expression analysis by

RT-PCR of some of these protease genes indicated that

they were more expressed in cacao tissues infected by

M. perniciosa than in non-infected ones (Carvalho 2007).

Moreover, analysis of the M. perniciosa draft genome

led to the identification of three putative genes encoding

necrosis and ethylene-inducing proteins (MpNEPs). MpNEP1

and 2 have highly similar sequences and are able to induce

necrosis and ethylene emission in tobacco and cacao leaves

(Garcia et al. 2007). Recombinant MpNEP induced prote-

ase isoforms production and DNA degradation (laddering)

in tobacco suspension cells, thereby suggesting that

MpNEP may have a crucial role in PCD process (Cascardo,

unpublished results).

In this paper, we report the molecular and biochemical

characterization of four cystatins from cacao (TcCYS1,

TcCYS2, TcCYS3 and TcCYS4), identified from two

cDNA libraries, corresponding to incompatible and com-

patible interactions between T. cacao and M. perniciosa

(Gesteira et al. 2007). These ORFs were sub-cloned, and

His-Tag fused proteins were expressed in E. coli. Inhibitory

activity against M. perniciosa was demonstrated. TcCYS3-

and TcCYS4–Sepharose–CNBr immobilized recruited

distinct proteases isoforms from M. perniciosa supernatant

culture. The cysteine proteinase inhibitory activity of these

recombinant proteins against papain (EC 3.4.22.2) was

assessed using a colorimetric assay. Polyclonal antibodies

against the recombinant TcCYS4 were raised, hence

1486 Planta (2010) 232:1485–1497

123

allowing the immunodetection of the endogenous proteins

within different plant tissues.

Materials and methods

Plant material

Plant material (leaves, meristems, roots, seeds and stems)

was obtained from cacao (Theobroma cacao L.) infected or

not with Moniliophthora perniciosa, growing in the field of

the ‘Universidade Estadual de Santa Cruz’, UESC (Ilheus,

Bahia, Brazil). The development stages and symptoms of

the disease were evaluated as described by Ceita et al.

(2007) and Silva et al. (2002).

Screening for cystatin clones

The T. cacao–M. perniciosa interaction cDNA libraries

were screened using BLAST-X and tBLAST-X (Altschul

et al. 1997) in order to identify putative cystatin clones.

Clones containing ORFs were selected based on the fol-

lowing criteria: (1) presence of cystatin characteristic

motifs (a region containing a glycine residue at the

N-terminal region; a QxVxG motif; a region containing a

tryptophan residue near the C-terminal region); (2) pres-

ence of the consensus sequence LARFAVDEHN, a sig-

nature specific to phytocystatins (Margis et al. 1998).

Sequence analyses

Cystatin clones, named TcCys1, TcCys2, TcCys3 and

TcCys4, were fully sequenced using a MegaBace 1000

DNA sequencer (GE Healthcare, Chalfont, UK). Align-

ment of protein sequences using Clustal W at GenBank

(http://www.ncbi.nlm.nih.gov) in order to predict putative

signal, peptide was predicted using the Target P 1.1 Server

(http://www.cbs.dtu.dk/services/TargetP/) (Nielsen et al.

1997).

Phylogenetic tree reconstruction and gene organization

Analysis was performed using Molecular Evolutionary

Genetics Analysis (MEGA) software, version 2.0 (Kumar

et al. 2000) after a Clustal-X multialignment of the four

cacao cystatins with other 41 sequences from group II

phytocystatins. The evolutionary history was inferred using

the neighbor-joining method. All positions containing gaps

and missing data were eliminated from the dataset (com-

plete deletion option). There were a total of 76 positions of

amino acid residues in the final dataset. The percentage of

replicate trees in which the associated taxa clustered

together was estimated by bootstrap (2,000 replicates). The

tree was condensed with a cut off value of 50 grouping

sequences with low bootstraps. Cacao phytocystatin gene

organization was deduced after comparison of genomic and

cDNA sequences, associated with the deduced amino acid

sequences from their predicted coding sequences. The

alternative splicing model was inferred after comparison

and super imposition with the previous described mecha-

nisms occurring in Arabidopsis, and poplar (Margis-Pin-

heiro et al. 2008).

Expression and purification of recombinant cystatins

from Escherichia coli

The open reading frames encoding cysteine protease

inhibitor proteins were obtained by amplification using the

following primers: Cys33FNdeI: 50TTTGGGGGTTCATA

TGGAGGCGGAGG and Cys33RXhoI: 50TATACAAAG

TCTCGAGAAGCAGA for TcCYS1 and TcCYS3;

Cys46FNdeI: 50CTGCTCTGAACATATGGCCACCAC

and Cys46RXhoI: 50GGTTCAACCTCGAGCAATATAC

AGC for TcCYS2 and TcCYS4. Forward and reverse

primers contained restriction sites for NdeI and XhoI,

respectively, to clone into pET28a. Amplification products

were digested with NdeI and XhoI and inserted into

pET28a in frame with a His-Tag coding sequence

according to pET System Manual (Novagen, Darmstadt,

Germany). All clones identities and positions were con-

firmed by sequencing. E. coli Rosetta (DE3) containing the

recombinant plasmids were grown at 37�C to an OD600 of

0.7, and induced with 0.4 mM IPTG (isopropyl b-D-thio-

galactopyranoside) for 4 h, harvested and processed. The

lysate was centrifuged at 13,000g, 4�C for 15 min and

soluble and insoluble fractions were obtained. The fusion

proteins with a histidine tail were purified using a His-Trap

FF Crude column (GE Healthcare) following the manu-

facturer’s instructions. Insoluble recombinant cacao cyst-

atins were dissolved with buffer containing 6 M urea prior

to loading onto the column, and eluted with lyses buffer

containing 250 mM imidazole and 4 M urea. Protein

refolding was performed by gradual reduction of urea

concentration in dialysis buffer (10 mM Na2HPO4, pH 6.0;

5% glycerol; 1 mM dithiothreitol; 100 mM NaCl; and

0.01% Triton X-100). Bacterial extracts, soluble, insoluble

and purified proteins were analyzed using 15% SDS-

PAGE. Protein concentration was determined by the

Bradford’s method (Bradford 1976).

Growth inhibition assay of Moniliophthora perniciosa

In vitro growth inhibition assays were performed using

broken hyphae from M. perniciosa in 40 g/L PDA medium

(HiMedia, Bhaveshwar Plaza, Mumbai, India), as descri-

bed by Freitas-Filho et al. (2006). Recombinant cacao

Planta (2010) 232:1485–1497 1487

123

cystatins TcCYS1, TcCYS2, TcCYS3 and TcCYS4 (final

concentration of 5 lM) were mixed with broken hyphae in

0.3 mL volume, pre-incubated at 25�C for 30 min and

plated in PDA medium for 4 days at 25�C. Plates were

photographed and images were analyzed by Image Master

3D Platinum software (GE Healthcare). Inhibition of

pseudocolony regeneration (in %) compared to the control

was calculated based on the percentage of volume pro-

duced by the Image Master analysis. The Tukey–Kramer

multiple comparison tests were conducted based on three

experimental repetitions.

Protease trap

The recombinant cystatins were coupled to CNBr-activated

SepharoseTM 4 fast Flow (GE Healthcare) according to the

manufacturer instructions. The protease capture was per-

formed using resin incubation at 37�C for 30 min, under

agitation, with 10 volumes of 1 mg/mL of proteins from

M. perniciosa culture supernatant in the presence of cap-

ture buffer (100 mM phosphate, pH 6.0; 100 mM NaCl;

2 mM EDTA; 10 mM 2-mercaptoethanol; 0.01% Triton

X-100). After capture, the resin was washed 3 times with 5

volumes of capture buffer containing 0.5 M NaCl. The

bound proteases were eluted with 50 mM glycine pH 2.9,

for 5 min, and then equilibrated with equal volume of

10 mM Tris-base. Between each step, the resin was

recovered by centrifugation (8,000g, room temperature for

30 s). For qualitative analysis of captured proteases, 0.1%

gelatin/SDS polyacrylamide gel electrophoresis was used

(Michaud et al. 1996).

Quantitative analysis of the cysteine protease inhibitory

activity of recombinant cacao cystatins

For quantitative analysis of the cysteine protease inhibitory

activity by cystatins, the chromogenic substrate NL-alpha-

benzoyl-DL-arginine-p-nitroanilide hydrochloride (BAp-

NA; Fluka, Steinheim, Germany) was used. The papain

activity (Sigma, St. Louis, MO, USA) was assayed with

modifications, as described by Barrett (1976). The enzyme

was pre-incubated for 10 min in 50 lL of activation buffer

(0.1 M phosphate buffer, pH 6.0; containing 10 mM

2-mercaptoethanol and 2 mM EDTA) without cystatin or

with variable concentrations of the inhibitor. The reaction

was initiated by adding 200 lL of 1.2 mM solution of

BApNA prepared in activation buffer; the amount of

p-nitroanilide released at 37�C was monitored every

10 min up to 1 h using a microplate reader VERSAmax

(Tunable Molecular Devices, Silicon Valley, CA, USA) at

410 nm. The amount of enzymes used was previously

adjusted in order to obtain a final optical density between

0.5 and 0.7, in positive controls without inhibitors. The Ki

values were calculated from continuous rate assay experi-

ments as the slope of the plot of [I]/(1 - vi/vo) versus vo/vi

(Henderson 1972) and corrected for substrate (BApNA)

competition. The inhibitory activity of cacao cystatins were

recorded as an inhibition percentage (%), and the percentage

of papain inhibition (I%) by cacao cystatins was calculated

using the following equation: I% = [(T - T*)/T] 9 100%;

where T denotes the OD410 in the absence of cacao cyst-

atin, and T* in the presence of cacao cystatin.

Antibody production

Anti-TcCYS4 polyclonal antibody was raised in rabbits

against the purified recombinant His-tagged protein using

standard immunization protocols (Sambrook and Russell

1989). Briefly, TcCYS4 was mixed with an equal volume

of Freund’s complete adjuvant (GibcoBRL, Grand Island,

NY, USA) and injected subcutaneously into 3-month-old

rabbit. Injections of 500 lg of protein mixed with an equal

volume of Freund’s incomplete adjuvant were done every

20 days until 60 days. The antiserum was collected from

the animals 21 days after the last immunization. Specific

antibody was purified by affinity using the antigen (His-

tagged TcCYS4) immobilized in nitrocellulose support

according to Sambrook and Russell (1989).

Immunodetection of cystatin in cacao tissues

Approximately 200 mg of plant tissues were ground in

liquid nitrogen using mortar and pestle until reduction in

powder. Successive purification steps to obtain cacao pro-

teins under denaturing conditions were performed accord-

ing to Pirovani et al. (2008). Proteins were quantified using

the 2-D Quant Kit according to the manufacturer’s recom-

mendations (GE Healthcare). For Western blot analyses,

equal amounts (5 lg) of each protein samples were sepa-

rated by 15% SDS-PAGE and electroblotted onto hybond-C

extra NC support (Amersham Biosciences, Little Chalfont,

Buckinghamshire, UK). The protein blot was blocked with

5% casein in TBS-T buffer (20 mM Tris–HCl pH 7.6; 0.8%

NaCl; 0.1% Tween 20) and incubated with specific poly-

clonal anti-TcCYS4 antibody for 1 h at room temperature.

An alkaline phosphatase-labeled anti-rabbit antibody

(Sigma, dilution 1:5,000) was used as a secondary antibody.

The detection system was NBT/BCIP (Promega, Madison,

Wisconsin, USA).

Fungus inoculation and protein infiltration experiments

Spores of M. perniciosa were used to inoculate cacao

meristems as previously described by Ceita et al. (2007).

Recombinant His-tagged MpNEP1 (Garcia et al. 2007)

dissolved in 10 mM Tris–HCl pH 8; 100 mM NaCl buffer

1488 Planta (2010) 232:1485–1497

123

(TNB) was infiltrated into apical meristems of 30-day-old

seedlings of cacao, according to Garcia et al. (2007).

Protein (1 lM) was injected into cacao meristems using

1 ml plastic syringes. Similarly, proteins secreted by M.

perniciosa in culture medium were dialyzed against TNB

buffer and then injected into meristems. Apical infiltrated

and control meristems were harvested 3 days after treat-

ment, frozen in liquid nitrogen and stored at -80�C until

protein extraction.

Results

Phylogenetic characterization of cacao cystatins ORFs

Four distinct complete cDNA clones encoding putative

cystatins were identified in the two cDNA libraries from

the T. cacao–M. perniciosa interaction (susceptible and

resistant) sequenced by Gesteira et al. (2007). The clones

were completely sequenced and named TcCys1, TcCys2,

TcCys3 (present in susceptible interaction) and TcCys4

(present in resistant interaction). Their ORFs contained

627, 369, 372 and 615 bp, respectively, and the deduced

amino acid sequences matched the consensus criteria

(Fig. 1; boxes 1, 2, 3), described in the ‘‘Material and

methods’’. TcCys1 and TcCys3 clones contain a putative N-

terminal signal peptide, thereby suggesting that these two

clones encode secreted proteins similar to oryzacystatin-I

(Womack et al. 2000), while TcCys2 and TcCys4 clones

probably encode intracellular proteins.

Sequence alignment of the four cystatins showed

the presence of conserved cystatin motifs, as well as

phytocystatin-specific domain (Fig. 1). TcCYS1 and

TcCYS4 showed an extend carboxy terminal end, as pre-

viously described (Reis and Margis 2001; Shyu et al. 2004;

Martinez et al. 2007). TcCYS1 and TcCYS3 showed 96%

amino acid sequence identity (Fig. 1), forming a cluster in

the phylogenetic analysis with Arabidopsis thaliana

(At5g05110) and Populus trichocarpa (PtCys9) cystatins

(Fig. 2). TcCYS2 and TcCYS4 were 88% identical (Fig. 1),

and formed a group with Gossypium (Tc59933), Eucalyp-

tus grandis (19204304) and Quercus robur (DN950946)

cystatins (Fig. 2). TcCYS1 and TcCYS3 were less than

50% conserved in comparison with TcCYS2 and TcCYS4

(Fig. 1). TcCYS1 and TcCYS3 are basic proteins, with a

theoretical Ip of 9.52 and 9.75, respectively, while TcCYS2

and TcCYS4 are slightly acidic, with a theoretical Ip of

6.70 and 6.10, respectively. The theoretical molecular

weights of TcCYS1, TcCYS2, TcCYS3 and TcCYS4 were

21.5, 14.1, 11.5 and 22.8 kDa, respectively (Table 1). An

exon skipping splicing model was proposed for cacao

phytocystatins TcCYS1 and TcCYS3 in comparison to that

observed in poplar phytocystatin PtCys9 (Fig. 3). A third

exon shown in TcCYS1 could be skipped during mRNA

splicing, and then resulting in the shortened alternative

form, TcCYS3.

Heterologous expression and purification

of recombinant cacao cystatins

When analyzed by SDS-PAGE, protein extracts from IPTG

induced E. coli cultures containing the four cystatin genes

cloned in expression vectors have revealed the presence of

His-tagged proteins with their respective expected sizes

Fig. 1 Sequence alignment of

four cacao cystatins and their

respective amino acid sequence

identities. a Signal peptides are

underlined, and signal peptide

cleavage sites are shown in

gray. Box 1 shows a

phytocystatin conserved motif.

Boxes 2 and 3 show the

conserved amino acid residues

of the inhibitory site. The

legumain SNSL inhibitory site

is shown in Box 4. Gap

generated in alignment are

indicated by dashes; positions

with identical residues in the

four sequences are indicated by

asterisks. b Global amino acid

sequence identity is among the

distinct cacao cystatins

Planta (2010) 232:1485–1497 1489

123

(Fig. 4a). The four cystatins were expressed at high levels.

Analysis of soluble and insoluble fractions by SDS-PAGE

showed that most of the recombinant TcCYS1 and TcCYS2

proteins were in the insoluble form (Fig. 4b), and hence

both were purified from insoluble fractions with 6 M urea,

since it was not possible to recover using affinity chro-

matography from the soluble fraction (data not shown).

The recombinant proteins TcCYS3 and TcCYS4 were both

detected in soluble and insoluble forms (Fig. 4b), and

could be directly purified by affinity chromatography.

Soluble (TcCYS3 and TcCYS4) or dissolved urea (TcCYS1

and TcCYS2) fractions were loaded into purification col-

umns, and the His-tagged proteins were eluted in lyses

buffer containing 250 mM imidazole for TcCYS3 and

TcCYS4 (Fig. 4c; lanes 3, 4), or equal buffer containing

4 M urea for TcCYS1 and TcCYS2 (Fig. 4c; lanes 1, 2).

After purification, TcCYS1 and TcCYS2 were refolded by

progressive removing of urea in dialysis buffer. The His-

tagged recombinant proteins expressed in E. coli had an

observed molecular weight slightly superior to the theo-

retical ones (Table 1). The high amounts of pure concen-

trated recombinant proteins TcCYS3 and TcCYS4 (2 and

2.8 mg/mL, respectively) obtained after a single step of

purification, and those of soluble purified TcCYS1 and

TcCYS2 (0.45 and 0.54 mg/mL, respectively) obtained

after refolding were sufficient to perform the subsequent

activity tests.

Antifungal activity and protease interaction

Assays of inhibitory activity against M. perniciosa were in

vitro performed with 5 lM of recombinant cacao cystatin

(TcCYS1, TcCYS2, TcCYS3 and TcCYS4). Abundant

mycelia growth was observed in control culture without the

addition of recombinant cacao cystatins (Fig. 5a). When

recombinant His-tagged proteins TcCYS3 or TcCYS4 were

applied, the M. perniciosa mycelia growth was strongly

inhibited; it was also noted a strong shortening of hyphae

(data not shown), and a reduced number of mycelia units

(pseudo-colonies) were observed 4 days after treatment

(Fig. 5d, e), reaching around 94% of growth inhibition

(Fig. 5f). When recombinant His-tagged proteins TcCYS1

and TcCYS2 were used, fungus growth inhibition was

slightly inferior to the one observed for TcCYS3 and

TcCYS4 proteins (Fig. 5b, c); still, their inhibitory activi-

ties reached around 80.8 and 77.9%, respectively (Fig. 5f).

To further investigate the possible mechanism for cacao

cystatin inhibition of mycelium growth, an assay of pro-

tease capture using Sepharose–CNBr immobilized proteins

was performed (Fig. 5g). Immobilized bovine serum

albumin (BSA) sample analyzed in gel did not show any

band corresponding to protease activity (Fig. 5g, BSA).

Figure 5g (TcCYS3 and TcCYS4) showed that recombi-

nants TcCYS3 and TcCYS4 interacted with similar secre-

ted proteases from M. perniciosa culture medium. Two

bands of protease activity were observed after capture by

TcCYS3 and TcCYS4 immobilized on CNBr–Sepharose: a

major protease activity band with a smaller molecular

weight, and a slight protease activity band with a higher

molecular weight (Fig. 5g, arrows).

Fig. 2 Phylogenetic tree reconstruction of cacao cystatins and 41

other members of group II phytocystatins. The consensus tree was

produced using the neighbor-joining method, p-distance and complete

deletion analysis on a Clustal-X multialignment. The percentages of

replicate trees in which the associated taxa clustered together in the

bootstrap test (2,000 replicates) are shown next to the branches. Only

values higher than 75 were indicated. The four cacao cystatins are

indicated with a black circle

Table 1 Number of amino acid residues, theoretical molecular

weight (Mw) and isoelectric point (Ip) of the cacao cystatins

Size (aa) Mw (kDa) Ip

TcCYS1 185 21.55 9.52

TcCYS2 127 14.08 6.70

TcCYS3 100 11.56 9.75

TcCYS4 205 22.84 6.10

Predicted signal sequences were not included in the analysis

1490 Planta (2010) 232:1485–1497

123

Inhibitory activity of the recombinant

cacao cystatins against papain

The recombinant cacao cystatins were assayed against

papain. TcCYS1, TcCYS2, TcCYS3, TcCYS4 recombinant

proteins inhibited papain activity (Fig. 6). The estimated Ki

values of TcCYS1 and TcCYS3 for papain were 203.2 and

152.4 nM, respectively (Fig. 6a), whereas for TcCYS2 and

TcCYS4, Ki values for papain were 220.7 and 158.9

(Fig. 6b). The TcCYS1 and TcCYS2 purified under dena-

turing conditions (6 M urea) and obtained in soluble form

after refolding, showed smaller Ki values than those of

TcCYS3 and TcCYS4, which were obtained by direct

purification in native conditions.

Immunodetection of endogenous TcCYS4

Polyclonal antibodies were generated against the recom-

binant protein TcCYS4 to detect the expression of cystatins

in different healthy cacao tissues and organs, or infected by

M. perniciosa. By means of Western blot analysis, the anti-

TcCYS4 polyclonal antibody detected two bands with

higher intensity: one of about 23 kDa was observed in

protein extracts from meristem, young leaf (leaves up to

10 days), mature leaf (leaves with 30–40 days), stem,

young seed (fruits with 120–140 days after flower anthe-

sis), root and mature seed tissues (fruit with 6–7 months);

and one of 85 kDa observed in all the cacao tissues

(Fig. 7). The 23 kDa protein had an observed molecular

Fig. 3 TcCYS1 and TcCYS3 correspond to alternative spliced forms

of a single cacao group II phytocystatin gene. A splicing model,

corresponding to an exon skipping (E.S.) is proposed for cacao

phytocystatins TcCYS1 and TcCYS3 in comparison to that observed

to poplar phytocystatin PtCys9. Exon sequences are represented as

boxes linked by single or interrupted lines, corresponding to introns.

Black boxes represent the open reading frame (ORF) and white boxes

the 50 and 30 non-translated regions (NTR), respectively. Numbersplaced above exons and below introns indicate their nucleotide sizes.

Amino acids corresponding to codons flanking introns and intron

frames (0 or ?1) are indicated under boxes

Fig. 4 Analysis of the expression, solubility and purification of

recombinant cacao cystatins. a SDS-PAGE analysis of the expression

of recombinant cystatins in E. coli. Cell extracts before (lane 1) and

after (lanes 2–6) IPTG induction. b SDS-PAGE analysis of soluble

(lanes 1, 3, 5 and 7); and insoluble (lanes 2, 4, 6 and 8) fractions after

disruption of induced cells. c Purification of His-tagged T. cacao

cystatins recombinant TcCYS1 (lane 1), TcCYS2 (lane 2) from

insoluble fractions as well as, TcCYS3 (lane 3) and TcCYS4 (lane 4)

from soluble fractions by affinity chromatography in a nickel column.

M molecular weight marker. Arrows indicated the recombinant

proteins

Planta (2010) 232:1485–1497 1491

123

weight similar to that of recombinant TcCYS4 protein

(Fig. 4c, lane 4). The Western blot showed that endoge-

nous TcCYS4 or a similar protein was more expressed in

younger tissues such as young leaves, young seeds and

roots. The 23 kDa protein was present in healthy mature

leaf at a low level, and it was completely absent from

infected mature leaf. The 85 kDa protein detected in all

tissues presented a higher induction in the infected meri-

stem compared to the healthy one (Fig. 7a). A previous

control experiment showed no cross reaction between anti-

TcCYS4 and the TcCYS1 and TcCYS3 recombinant cacao

cystatins (data not shown), thus, based on other fully

sequenced plant genomes, the T. cacao should have 10–12

cystatin genes. This way, the band of 23 kDa may not have

been TcCYS4, but another similar cystatin.

Cacao meristems were submitted to the following

treatments: (1) infiltration with protein extract from

M. perniciosa culture medium; (2) infiltration with

recombinant MpNEP II; (3) infection by M. perniciosa

basidiospores. Three days after meristem treatments, the

total protein extracts were assayed by Western blot, using

TcCYS4 antibody (Fig. 7b). Quantitative results from three

independent immunoblots were shown in Fig. 7b. Inocu-

lation of cacao meristems by M. perniciosa basidiospores,

infiltration of the recombinant protein NEP, and the infil-

tration with protein extract from M. perniciosa culture

medium have induced the 85 kDa protein band (Fig. 7b).

Band intensity was about twice higher in all three treat-

ments, when compared to the untreated control (Fig. 7b, c).

Discussion

Four cDNA clones (TcCYS1, TcCYS2, TcCYS3 and

TcCYS4) encoding phytocystatins from cacao were iden-

tified in two cDNA libraries of cacao-M. perniciosa

Fig. 5 Growth inhibitory activities of the recombinant T. cacaocystatins. Growth of M. perniciosa colonies derived from broken

hyphae (saprotrophic mycelia) in presence of 10 mM phosphate

buffer (control, a), 5 lM of TcCYS1 (b), TcCYS2 (c), TcCYS3

(d) and TcCYS4 (e) recombinant proteins. f The fungus growth

inhibition was quantitatively analyzed using the Image Master 3D

Platinum software. Columns identified with different letters indicated

different means by Tukey–Kramer statistical test (P \ 0.01). g Pro-

teases from M. perniciosa supernatant culture was captured using

BSA–CNBr–Sepharose (control), recombinant TcCYS3–CNBr–

Sepharose and recombinant TcCYS4–CNBr–Sepharose. After cap-

ture, eluted sample was analyzed in semi-native gelatin/SDS-PAGE

Fig. 6 Papain inhibition by

recombinant cacao cystatins.

Purified recombinants TcCYS1,

2, 3 and 4 at different

concentrations (0–3.2 lM) were

incubated with papain (3 lM).

a Residual activity of BApNA

hydrolysis by TcCYS1 and

TcCYS3 and b by TcCYS2 and

TcCYS4. Variations in the

residual activity of papain are

shown as standard errors of the

means (n = 5)

1492 Planta (2010) 232:1485–1497

123

interaction. The open reading frames encoded predicted

polypeptides of 209, 127, 124 and 205 amino acids for

TcCYS1, TcCYS2, TcCYS3 and TcCYS4, respectively

(Fig. 1). TcCYS1 and TcCYS3 included a 26 amino acid

segment similar to a classical signal peptide, due to the

presence of charged amino acid residues very near the N-

terminal end, corresponding to signal sequence found in

oryzacystatin-I by Womack et al. (2000). This segment was

followed by a long stretch of hydrophobic amino acids,

with a small lateral chain at the C-terminal end for TcCYS1

and TcCYS3, followed by a C-terminal extended in

TcCYS1. Although the subcellular localization of cystatins

in cacao is still unknown, the presence of a putative signal

peptide suggested that TcCYS1 and TcCYS3 might be

synthesized as precursors which are exported to the apop-

last, as similarly described for the rice cystatin OC-I that

may be involved in the process of suspension-cultured rice

cells proliferation (Tian et al. 2009). The analysis of the

whole deduced cacao cystatin amino acid sequences

showed the presence of classical cystatin-like domains,

which contain the Q9V9V and the dipeptide PW motifs.

TcCYS1 and TcCYS4 differed from most common protein

or nucleotide plant cystatin sequences, which consist of a

single-domain cystatins, as found in sugarcane (Soares-

Costa et al. 2002; Gianotti et al. 2006) and sesame (Shyu

et al. 2004), or multicystatins, having 3 and 8 cystatin

domains, as reported in potato tubers (Waldron et al. 1993)

and tomato (Wu and Haard 2004). The extension sequence

found at the C-termini of TcCYS1 and TcCYS4 suggested

that these two proteins belong to group II phytocystatin,

previously identified by Margis-Pinheiro et al. (2008). A

specific role for this extended C-terminal sequence has

been determined by identifying a SNSL site known as

putative inhibitory site for legumin-like proteins (Martinez

et al. 2007). Both, TcCYS2 and TcCYS3 comprised cyst-

atins with low molecular weight (11–16 kDa). Indeed,

according to the phytocystatin classification proposed by

Margis-Pinheiro et al. (2008), TcCYS2 and TcCYS3 should

be placed in group II, as both corresponds to the shorter

spliced form of TcCYS1 (Fig. 3) and TcCYS4, respec-

tively. The internal clustering of TcCYS2 and TcCYS3

with other group II phytocystatin in the phylogenetic

reconstruction (Fig. 2) reinforces this proposition.

The purified His-tagged recombinant cystatins from

cacao was used (at 5 lM) in inhibition assays of M. per-

niciosa hyphae growth. This maximum concentration was

selected because TcCYS1 and TcCYS2 presented reduced

solubility after recombinant expression and purification

from E. coli. However, the cystatin concentrations used

were lower than those previously used in other inhibitory

assays [15 lM for canecystatin vs. Trichoderma reesei by

Soares-Costa et al. (2002); 8 lM for tarocystatin vs.

Fig. 7 a Immunodetection of

TcCYS4 in cacao protein

extracts. Approximately 10 lg

of proteins extracted from

healthy meristem, young leaf,

mature leaf, stem, young seed,

mature seed and root or infected

tissues by M. perniciosa were

analyzed by Western blot.

Molecular weights (MW) in kDa

are indicated on the left.b Immunodetection of 85 kDa

proteins of cacao.

Approximately 10 lg of

proteins extracted from cacao

meristem control (untreated),

infected by M. perniciosabasidiospores (?Mp), infiltrated

with NEP (?NEP), or infiltrated

with protein from M. perniciosaculture medium (?SNMp) were

analyzed by Western blot.

c Relative intensity of protein

band was normalized to control

band and quantified by the

Image Master 3D Platinum

software

Planta (2010) 232:1485–1497 1493

123

Alternaria brassicae by Yang and Yeh (2005)], but higher

than the probable physiological concentrations present in

cacao tissues. The four recombinant proteins strongly

inhibited M. perniciosa broken hyphae growth (Fig. 5b–e),

as similarly described for other plant cystatins used against

other phytopathogenic fungi (Soares-Costa et al. 2002;

Yang and Yeh 2005; Martinez et al. 2005; Christova et al.

2006).

It was investigated whether the growth inhibition

mechanism of TcCYS3 and TcCYS4 proteins against

M. perniciosa was due to protease interaction, by using

recombinant protein immobilized in CNBr-activated

Sepharose, followed by capturing proteases from M. per-

niciosa culture supernatant. Sample analysis in 0.1% gel-

atin/SDS-PAGE revealed two proteases bands (Fig. 5g),

suggesting that inhibition of protease activity by recombi-

nant cacao cystatin is a mechanism potentially affecting

mycelia growth. It shall predominantly derive from nutri-

tion depletion because lower protease activity in fungal cell

might cause less nutrition and/or digestion. Despite the fact

that we have tested the recombinant cystatins against

secreted fungus proteases, it is clear that cacao cystatins are

able to capture M. perniciosa proteases, thus providing

initial clues of the action mechanism. It remains unclear

whether cystatin penetrates the fungus cell wall and plas-

malemma, or not. The screening for cysteine proteases in

the genome data set from M. perniciosa (http://www.lge.

ibi.unicamp.br/vassoura) has not identified papain-like

cysteine proteases, as well as classical cysteine proteases

(Mondego et al. 2008), suggesting that the protease band

detected in the 0.1% gelatin/SDS/PAGE corresponded to a

novel cysteine protease from the fungus that interacted

with cacao cystatin.

TcCYS1, TcCYS2, TcCYS3 and TcCYS4 recombinant

proteins were tested for papain inhibition using BApNA as

the colorimetric substrate (Fig. 6). The Ki values of

TcCYS1 and TcCYS2 for papain activity inhibition were

203.2 and 220.7 nM, respectively; while the Ki values of

TcCYS2 and TcCYS4 were 220.7 and 158.9 nM, respec-

tively. This Ki values are very close to the Ki of tarocystatin

OC-I (252 nM) (Wang et al. 2008) and job’ tears cystatin

(190 nM) (Yoza et al. 2002). In addition to that, compar-

ison of inhibitory activity with other species showed that Ki

for cacaocystatins are lower than those for rice OC-II

(830 nM) (Kondo et al. 1990), wheat cystatin mTaMDC1

(580 nM) (Christova et al. 2006), soybean cystatin L1

(19 lM) (Zhao et al. 1996), but higher than those con-

cerning sesame (27 nM) (Shyu et al. 2004) and maize

CCI (23 nM) (Abe et al. 1994). The Ki values for TcCYS1

and TcCYS2 were slightly higher than the TcCYS3 and

TcCYS4 Ki values. That may be explained by structural

differences between TcCYS1 and TcCYS2, even if the

inhibitory domains were identical in the pairwise

combination TcCYS1/TcCYS3 and TcCYS2/TcCYS4. The

ability to inhibit papain enzymatic activity confirmed that

(1) the proteins purified in this study were PLCP inhibitors;

(2) they were in their active conformation and conse-

quently may be employed in further studies.

Polyclonal antibodies generated against the recombi-

nant protein TcCYS4 detected the presence of this cyst-

atin in cacao tissues. The anti-TcCYS4 polyclonal

antibodies reacted with a protein with molecular weight

of around 23 kDa in extracts from meristem, young leaf,

mature leaf, stem, young seed, root and mature seed tis-

sues (Fig. 7, lower arrow). Due to the observed size, this

protein band was likely the TcCYS4 protein with pre-

dicted mass of 22.8 kDa. When compared to the same

tissues in different developmental stages, Western blot

analysis detected that TcCYS4 or a similar protein

predominantly accumulated in young tissues. A higher

amount of 23 kDa cystatin was found in young seed than

in mature seed, which is consistent with the pattern of

cystatin accumulation in wheat (Kuroda et al. 2001), as

cystatin protein levels decreased during seed maturation.

A higher accumulation of this protein was also detected in

seedling roots (Fig. 7). Root accumulating cystatin may

play a role in the protection of root tissues against insects

and/or pathogens invading these organs (Valdes-Rodrıguez

et al. 2007).

Even at low level, 23 kDa cystatin was detected in

mature uninfected leaf, but it was completely absent in M.

perniciosa infected mature leaves. Major differences in

cystatin levels between uninfected and infected organs

have been observed during the transition from green

organ (e.g., green broom) to dry one (e.g., dry broom),

due to the establishment of a PCD program in susceptible

plants (Silva et al. 2002; Ceita et al. 2007). Our data

suggested that TcCYS4 or a similar protein could act

preventing the PCD in healthy leaves by inhibiting cys-

teine proteases engaged in this process, while in infected

leaves, in the absence of TcCYS4, cysteine proteases

may be active, participating in the cell death process.

According to this hypothesis, treatment of isolated

petal from iris flower with protease inhibitors prevented

the increase in endoprotease activity, and considerably

delayed or prevented the normal senescence symptoms

(Pak and van Doorn 2005). Cacao protease activity ana-

lyzed in gel revealed the presence of three protease iso-

forms in healthy tissues and the presence of an additional

protease isoform in infected but non-necrotic ones (Piro-

vani et al. 2008). Because proteases are well known to be

involved in PCD, in particular cysteine proteases or

caspases-like proteases (van der Hoorn and Jones 2004;

Shindo and Hoorn 2008), it has been hypothesized that

some specific protease isoforms may be involved in the

PCD process, helping the degradation of the cell content

1494 Planta (2010) 232:1485–1497

123

occurring in cacao organs, as described by Ceita et al.

(2007). Moreover, according to the acid buffer pH (4.0)

used by Pirovani et al. (2008), the detected protease

isoforms correspond to aspartic or cysteine proteases, but

not serine protease, which has a higher enzymatic activity

at alkaline pH (Barrett 1994). Yet, cystatin inhibits

hypersensitive response (HR) of viral infection in

Arabidopsis (Gholizadeh et al. 2005). The involvement of

cysteine proteases and protease inhibitor genes in the

regulation of programmed cell death in plants had been

previously demonstrated (Belenghi et al. 2003; Shindo

and Hoorn 2008). These authors suggested a crucial

counter-balancing role for endogenous protease inhibitors

in regulating protease activities.

The anti-TcCYS4 antibodies cross-reacted in all the

studied cacao tissues with an approximately 85 kDa pro-

tein, which may be correlated with multicystatin, as

observed in other species (potato, Weeda et al. 2009;

cowpea, Diop et al. 2004). This cross reaction was proba-

bly due to the detection of the multicystatin, which may

present conserved epitopes with TcCYS4. The Solanum

tuberosum multicystatin shows eight cystatin domains

similar to N-terminus domains present in 23 kDa cystatins

(Weeda et al. 2009). Because the cacao multicystatin was

induced in all tissues infected by M. perniciosa (Fig. 7a),

and also in protein extracts secreted by M. perniciosa and

in meristem infiltrated with NEP (Fig. 7b), the cacao

multicystatin may be considered as a pathogenesis related

protein. A multicystatin from cowpea leaves was shown to

be induced by drought stress (Diop et al. 2004), and an 88-

kDa multi-domain cystatin from tomato was induced by

methyl jasmonate (Wu and Haard 2004). Because MpNEP

is an ethylene-inducing protein that also induces cell death

in tobacco leaves and cacao meristems (Garcia et al. 2007),

several effects on cacao tissue might occur via MpNEP

action. MpNEP induced proteases isoforms in tobacco

suspension cells (Cascardo, unpublished results); hence,

cacao multicystatin induction by MpNEP may be a counter

response to the proteases activation, by down-regulating

their activity, therefore playing an important role in

defense.

Acknowledgments This research was supported by the ‘Financi-

adora de Estudos e Projetos’ (FINEP) and the ‘Fundacao de Amparo a

Pesquisa do Estado da Bahia’ (FAPESB) M. perniciosa proteomic

network. F C Alvim was the recipient of a PQI/CAPES graduate

fellowship, and C P Pirovani was the recipient of a FAPESB graduate

fellowship. We thank Robson Jose Costa Dias (Laboratorio de

Genomica, UESC) for technical assistance and Dra. Karina Perez

Gramacho (CEPEC, CEPLAC, Brasil) for the support in cacao

seedlings inoculations with M. perniciosa basidiospores. We are

thankful to Dr. Antonio Figueira (CENA/USP-SP, Brazil) for critical

reading of the manuscript. J.C.M. Cascardo is recipient of CNPq

research fellowship number 303987/2008-1. R. Margis is recipient of

CNPq research fellowship number 302684/2005-0.

References

Abe M, Abe K, Iwabuchi K, Domoto C, Arai (1994) Corn cystatin I

expressed in Escherichia coli: investigation of its inhibitory

profile and occurrence in corn kernels. J Biochem 116:488–492

Aime MC, Phillips-Mora W (2005) The causal agents of witches’

broom and frosty pod rot of cacao (chocolate, Theobroma cacao)

form a new lineage of Marasmiaceae. Mycologia 97:1012–1022

Altschul SF, Madden TL, Schaver AA, Zhang J, Zhang Z, Miller W,

Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs. Nucleic Acids

Res 25:3389–3402

Andebrhan T, Figueira A, Yamada MM, Cascardo J, Furtek DB

(1999) Molecular fingerprinting suggests two primary outbreaks

of witches’ broom disease (Crinipellis perniciosa) of Theobromacacao in Bahia, Brazil. Eur J Plant Pathol 105:167–175

Arai S, Matsumoto I, Emori Y, Abe K (2002) Plant seed cystatins and

their target enzymes of endogenous and exogenous origin.

J Agric Food Chem 50:6612–6617

Barrett AJ (1976) An improved color reagent for use in Barrett’s

assay of cathepsin B. Anal Biochem 76:374–376

Barrett AJ (1994) Classification of peptidases. Methods Enzymol

244:1–15

Belenghi B, Acconcia F, Trovato M, Perazzolli M, Bocedi A, Poticelli

F, Ascenzi P, Delledonne M (2003) AtCYS1, a cystatin from

Arabidopsis thaliana, suppresses hypersensitive cell death. Eur J

Biochem 270:2593–2604

Bradford MM (1976) A rapid and sensitive method for the

quantification of microgram quantities of protein utilizing the

principle of protein–dye binding. Anal Biochem 72:248–254

Carvalho HAS (2007) Biochemical and molecular analyses of

protease from the interaction Theobroma cacao–Moniliophthoraperniciosa. Masters dissertation, Universidade Estadual de Santa

Cruz, Brazil

Ceita GO, Macedo JNA, Santos TB, Alemanno L, Gesteira AS,

Micheli F, Mariano AC, Gramacho KP, Silva DC, Meinhardt L,

Mazzafera P, Pereira GAG, Cascardo JCM (2007) Involvement

of calcium oxalate degradation during programmed cell death in

Theobroma cacao tissues triggered by the hemibiotrophic fungus

Moniliophthora perniciosa. Plant Sci 173:106–117

Chan YL, Yang AH, Chen JT, Yeh KW, Chan MT (2010)

Heterologous expression of taro cystatin protects transgenic

tomato against Meloidogyne incognita infection by means of

interfering sex determination and suppressing gall formation.

Plant Cell Rep 29:231–238

Chichkova NV, Kim SH, Titova ES, Kalkum M, Morozov VS,

Rubtsov YP, Kalinina NO, Taliansky ME, Vartapetian AB

(2004) A plant caspase-like protease activated during the

hypersensitive response. Plant Cell 16:157–171

Christova PK, Christov NK, Imai R (2006) A cold inducible

multidomain cystatin from winter wheat inhibits growth of

the snow mold fungus, Microdochium nivale. Planta 223:1207–

1218

Diop NN, Kidric M, Repellin A, Gareil M, d’Arcy-Lameta A, Pham

Thi AT, Zuily-Fodil Y (2004) A multicystatin is induced by

drought-stress in cowpea (Vigna unguiculata (L.) Walp.) leaves.

FEBS Lett 577:545–550

Evans HC (1980) Pleomorphism in Crinipellis perniciosa, causal

agent of witches’ broom disease of cocoa. Trans Br Mycol Soc

74:515–523

Freitas-Filho D, Pungartnik C, Cascardo JMC, Brendel M (2006)

Broken hyphae of the basidiomycete Crinipellis perniciosa allow

quantitative assay of toxicity. Curr Microbiol 52:407–412

Garcia O, Macedo JA, Tiburcio R, Zaparoli G, Rincones J,

Bittencourt LM, Ceita GO, Micheli F, Gesteira A, Mariano

Planta (2010) 232:1485–1497 1495

123

AC, Schiavinato MA, Medrano FJ, Meinhardt LW, Pereira GA,

Cascardo JC (2007) Characterization of necrosis and ethylene-

inducing proteins (NEP) in the basidiomycete Moniliophthoraperniciosa, the causal agent of witches’ broom in Theobromacacao. Mycol Res 111:443–455

Gesteira AS, Micheli F, Carels N, Da Silva AC, Gramacho KP,

Schuster I, Macedo JN, Pereira GA, Cascardo JC (2007)

Comparative analysis of expressed genes from cacao meristems

infected by Moniliophthora perniciosa. Ann Bot 100:129–140

Gholizadeh A, Santha IN, Kohnehrouz BB, Lodha ML, Kapoor HC

(2005) Cystatins may confer viral resistance in plants by

inhibition of a virus-induced cell death phenomenon in which

cysteine proteinases are active: cloning and molecular charac-

terization of a cDNA encoding cysteine-proteinase inhibitor

(celostatin) from Celosia cristata (crested cocks comb). Bio-

technol Appl Biochem 42:197–204

Gianotti A, Rios WM, Soares-Costa A, Nogaroto V, Carmona AK,

Oliva ML, Andrade SS, Henrique-Silva F (2006) Recombinant

expression, purification, and functional analysis of two novel

cystatins from sugarcane (Saccharum officinarum). Protein Expr

Purif 47:483–489

Henderson PJF (1972) A linear equation that describes the steady-

state kinetics of enzymes and subcellular particles interacting

with tightly bound inhibitors. Biochem J 127:321–333

Kondo H, Abe K, Nishimura I, Watanabe H, Emori Y, Arai S (1990)

Two distinct cystatin species in rice seeds with different

specificities against cysteine proteinases. J Appl Biol Chem

265:15832–15837

Kumar S, Tamura K, Jacobsen I, Nei M (2000) MEGA2: molecular

evolutionary genetics analysis, version 2.0. Pennsylvania and

Arizona State Universities, University Park, Pennsylvania and

Tempe, Arizona

Kuroda M, Kiyosaki T, Matsumoto I, Misaka T, Arai S, Abe K (2001)

Molecular cloning, characterization and expression of wheat

cystatins. Biosci Biotechnol Biochem 65:22–28

Liu Y, Dammann C, Bhattacharyya MK (2001) The matrix metallo-

proteinase gene GmMMP2 is activated in response to pathogenic

infections in soybean. Plant Physiol 127:1788–1797

Margis R, Reis EM, Villeret V (1998) Structural and phylogenetic

relationships among plant and animal cystatins. Arch Biochem

Biophys 359:24–30

Margis-Pinheiro M, Zolet ACT, Loss G, Pasquali G, Margis R (2008)

Molecular evolution and diversification of plant cysteine

proteinase inhibitors: new insights after the poplar genome.

Mol Phylogenet Evol 49:349–355

Martinez M, Abraham Z, Gambardella M, Echaide M, Carbonero P,

Diaz I (2005) The strawberry gene Cyf1 encodes a phytocystatin

with antifungal properties. J Exp Bot 56:1821–1829

Martinez M, Diaz-Mendoza M, Carrillo L, Diaz I (2007) Carboxy

terminal extended phytocystatins are bifunctional inhibitors of

papain and legumain cysteine proteinases. FEBS Lett

581:2914–2918

Michaud D, Cantin L, Raworth DA, Vrain TC (1996) Assessing the

stability of cystatin/cysteine proteinase complexes using mildly-

denaturing gelatin-polyacrylamide gel electrophoresis. Electro-

phoresis 17:74–79

Mondego JM, Carazzolle MF, Costa GG, Formighieri EF, Parizzi LP,

Rincones J, Cotomacci C, Carraro DM, Cunha AF, Carrer H,

Vidal RO, Estrela RC, Garcıa O, Thomazella DP, de Oliveira

BV, Pires AB, Rio MC, Araujo MR, de Moraes MH, Castro LA,

Gramacho KP, Goncalves MS, Neto JP, Neto AG, Barbosa LV,

Guiltinan MJ, Bailey BA, Meinhardt LW, Cascardo JC, Pereira

GA (2008) A genome survey of Moniliophthora perniciosa gives

new insights into witches’ broom disease of cacao. BMC

Genomics 9:548. doi:10.1186/1471-2164-9-548

Nielsen H, Engelbrecht J, Brunak S, von Heijne G (1997) Identifi-

cation of prokaryotic and eukaryotic signal peptides and

prediction of their cleavage sites. Protein Eng 10:1–6

Pak C, van Doorn WG (2005) Delay of iris flower senescence by

protease inhibitors. New Phytol 165:473–480

Pirovani CP, Carvalho HA, Machado RC, Gomes DS, Alvim FC,

Pomella AW, Gramacho KP, Cascardo JC, Pereira GA, Micheli

F (2008) Protein extraction for proteome analysis from cacao

leaves and meristems, organs infected by Moniliophthoraperniciosa, the causal agent of the witches’ broom disease.

Electrophoresis 29:2391–2401

Reis EM, Margis R (2001) Sugarcane phytocystatins: identification,

classification, and expression pattern analysis. Genet Mol Biol

24:291–296

Sambrook J, Russell DW (1989) Molecular cloning: a laboratory

manual. Cold Spring Harbor Laboratory Press, New York

Shindo T, Hoorn R (2008) Papain-like cysteine proteases: key players

at molecular battlefields employed by both plants and their

invaders. Mol Plant Pathol 9:119–125

Shyu DJH, Chou WN, Yiu TJ, Lin CPC, Tzen JTC (2004) Cloning,

functional expression and characterization of cystatin in sesame

seeds. J Agric Food Chem 52:1350–1356

Silva SD, Luz EDMN, Almeida OC, Gramacho K, Bezerra JL (2002)

Redescricao da sintomatologia causada por Crinipellis pernic-iosa em cacaueiro. Agrotropica 1:1–23

Soares-Costa A, Beltramini LM, Thiemann OH, Henrique-Silva F

(2002) A sugarcane cystatin: recombinant expression, purifica-

tion, and antifungal activity. Biochem Biophys Res Commun

296:1194–1199

Tian L, Zhang L, Zhang J, Song Y, Guo Y (2009) Differential

proteomic analysis of soluble extracellular proteins reveals the

cysteine protease and cystatin involved in suspension-cultured

cell proliferation in rice. Biochim Biophys Acta 3:459–467

Valdes-Rodrıguez S, Guerrero-Rangel A, Melgoza-Villagomez C,

Chagolla-Lopez A, Delgado-Vargas F, Martınez-Gallardo N,

Sanchez-Hernandez C, Delano-Frier J (2007) Cloning of a

cDNA encoding a cystatin from grain amaranth (Amaranthushypochondriacus) showing a tissue-specific expression that is

modified by germination and abiotic stress. Plant Physiol

Biochem 45:790–798

Van der Hoorn RAL, Jones JDG (2004) The plant proteolytic

machinery and its role in defense. Curr Opin Plant Biol

7:400–407

Waldron C, Wegrich LM, Merlo PAO, Walsh TA (1993) Character-

ization of a genomic sequence coding for potato multicystatin,

an eight-domain cysteine proteinase inhibitor. Plant Mol Biol

23:801–812

Wang KM, Kumar S, Cheng YS, Venkatagiri S, Yang AH, Yeh KW

(2008) Characterization of inhibitory mechanism and antifungal

activity between group-1 and group-2 phytocystatins from taro

(Colocasia esculenta). FEBS J 275:4980–4989

Weeda SM, Mohan Kumar GN, Knowles RN (2009) Developmen-

tally linked changes in proteases and protease inhibitors suggest

a role for potato multicystatin in regulating protein content of

potato tubers. Planta 230:73–84

Womack JS, Randall J, Kemp JD (2000) Identification of a signal

peptide for oryzacystatin-I. Planta 210:844–847

Wood GAR, Lass RA (1987) Cocoa, 4th edn. London, Longman

Scientific and Technical, Tropical Agriculture Series

Wu J, Haard NF (2004) Purification and characterization of a cystatin

from the leaves of methyl jasmonate-treated tomato plants.

Comp Biochem Physiol 127:209–220

Yang AH, Yeh KW (2005) Molecular cloning, recombinant gene

expression, and antifungal activity of cystatin from taro (Col-ocasia esculenta cv. Kaosiung no. 1). Planta 221:493–501

1496 Planta (2010) 232:1485–1497

123

Yoza K, Nakamura S, Yaguchi M, Haraguchi K, Ohtsubo K (2002)

Molecular cloning and functional expression of cDNA encoding

a cysteine proteinase inhibitor, cystatin, from Job’s tears (Coixlacryma-jobi L. var Ma-yuen Stapf). Biosci Biotechnol Biochem

66:2287–2291

Zhao Y, Botella MA, Subramanian L, Niu X, Nielsen SS, Bressan

RA, Hasegawa PM (1996) Two wound inducible soybean

cysteine proteinases have greater insect digestive proteinase

inhibitory activities than a constitutive homolog. Plant Physiol

111:1299–1306

Planta (2010) 232:1485–1497 1497

123