UNIVERSIDADE FEDERAL DE PELOTASPrograma de Pós

Produção de antígenos de

Pichia pastoris

Daiane Drawanz Hartwig

UNIVERSIDADE FEDERAL DE PELOTASPrograma de Pós-Graduação em Biotecnologia

Tese

Produção de antígenos de Leptospira interrogans e avaliação do potencial imunoprotetor

contra leptospirose

Daiane Drawanz Hartwig

Pelotas, 2010

UNIVERSIDADE FEDERAL DE PELOTAS Graduação em Biotecnologia

Leptospira interrogans em potencial imunoprotetor

1

DAIANE DRAWANZ HARTWIG PRODUÇÃO DE ANTÍGENOS DE Leptospira interrogans EM Pichia pastoris E

AVALIAÇÃO DO POTENCIAL IMUNOPROTETOR CONTRA LEPTOSP IROSE

Tese apresentada ao Programa de Pós-Graduação em Biotecnologia da Universidade Federal de Pelotas, como requisito parcial à obtenção do título de Doutor em Ciências (área do conhecimento: Biologia Molecular e Imunologia).

Orientador: Odir Antônio Dellagostin Co-Orientador (a): Fabiana Kömmling Seixas

Pelotas, 2010

2

Dados de catalogação na fonte: Ubirajara Buddin Cruz – CRB-10/1032 Biblioteca de Ciência & Tecnologia - UFPel

H337p Hartwig, Daiane Drawanz

Produção de antígenos de Leptospira interrogans em Pichia pastoris e avaliação do potencial imunoprotetor contra leptospirose / Daiane Drawanz Hartwig. – 103f. – Tese (Doutorado). Programa de Pós-Graduação em Biotecnologia. Universidade Federal de Pelotas. Centro de Desenvolvimento Tecnológico. Pelotas, 2010. – Orientador Odir Antônio Dellagostin ; co-orientador Fabiana Kömmling Seixas.

1.Biotecnologia. 2.Leptospirose. 3.Leptospira

interrogans. 4.Vacina recombinante. 5.Pichia pastoris. I.Dellagostin, Odir Antônio. II.Seixas, Fabiana Kömmling. III.Título.

CDD: 662.8

3

Banca examinadora:

Prof. Dr. Alan John Alexander McBride, Centro de Pesquisas Gonçalo Moniz

Prof. Dr. Fabricio Rochedo Conceição, Universidade Federal de Pelotas

Prof. Dra. Flávia Weykamp da Cruz McBride, Universidade Federal da Bahia

Prof. Dr. Odir Antônio Dellagostin, Universidade Federal de Pelotas

4

Dedicatória

Aos meus amados pais, minha irmã Andréia e ao Élcio, por participarem deste vínculo de amor, suporte e alegria que é a minha família.

5

Agradecimentos

À Universidade Federal de Pelotas pela oportunidade de realizar um Curso de

Pós-Graduação de qualidade.

Ao meu orientador, Odir A. Dellagostin, pela orientação durante o doutorado,

sem a qual não seria possível a realização deste trabalho.

A minha co-orientadora e amiga Fabiana K. Seixas, pela amizade, pela

incansável ajuda e presença constante, mesmo durante sua licença maternidade.

A toda a minha família, principalmente meus pais, minha irmã Andréia e o

Élcio, pela dedicação, laços de amor, amizade e respeito construídos durante toda a

vida, pelo exemplo de caráter, por estarem do meu lado nos momentos de alegria e

tristeza, vibrando com minhas vitórias e me consolando nas derrotas, também pelos

momentos de descontração tão preciosos.

A todos os amigos e colegas do laboratório de Biologia Molecular, Amilton,

André, Caroline, Clarisse, Daniela, Karen, Kátia Bacelo, Kátia, Michel, Michele,

Samuel, Sérgio, Silvana, Thaís, Vanessa, Vanuza e em especial a Karine Forster,

por toda a ajuda, pela amizade, convívio e pelo apoio quer fosse com palavras ou

gestos de incentivo.

A minha estagiária Thaís, por todo o apoio e dedicação dispensados durante

a execução dos experimentos.

Aos demais colegas da Pós-Graduação, professores, alunos e funcionários do

Centro de Biotecnologia, pelos momentos de descontração, amizade, bom convívio

e apoio durante todo o Doutorado.

Aos funcionários e amigos do Biotério Central da Universidade Federal de

Pelotas pelos cuidados dispensados com os animais da experimentação e pela

dedicação. Aos hamsters, sem os quais não seria possível a realização de etapas

fundamentais deste estudo.

A todos que contribuíram de alguma forma para a realização deste trabalho.

Ao CNPq, pela concessão da bolsa de Doutorado.

A Deus por me dar a força espiritual necessária para conseguir seguir em

frente e muitas vezes me guiar pelo melhor caminho, mesmo sem que eu

percebesse, fazendo as coisas acontecerem no momento certo.

Muito obrigada!

6

RESUMO

HARTWIG, Daiane Drawanz. Produção de antígenos de Leptospira interrogans

em Pichia pastoris e avaliação do potencial imunoprotetor contra lept ospirose.

2010. 103 f. Tese (Doutorado) - Programa de Pós-Graduação em Biotecnologia.

Universidade Federal de Pelotas, Pelotas.

Leptospirose é uma doença infecciosa grave causada por espiroquetas patogênicas

do gênero Leptospira, sendo classificada como uma zoonose de ampla distribuição

mundial. Esta doença resulta morbidade e mortalidade em humanos e animais,

justificando a aplicação de estratégias profiláticas. As vacinas atuais contra a

leptospirose são compostas por bactérias inativadas e não estimulam proteção

cruzada. Assim, existe a necessidade de desenvolver uma vacina efetiva. No

presente estudo, as proteínas de membrana externa LigANI e LipL32 foram

utilizadas, pois são apontadas como potenciais vacinógenos. Estas, em sua forma

recombinante, costumam ser expressas em Escherichia coli e, como vacina de

subunidade tem apresentado eficiência variável. Nós descrevemos neste trabalho a

utilização da levedura Pichia pastoris como sistema de expressão alternativo. Os

genes ligANI e lipL32 foram clonados no vetor pPICZαB, que permitiu a expressão

secretória das proteínas em P. pastoris. O rendimento das proteínas neste sistema

foi de 276 mg/L para LigANI e 285 mg/L para LipL32. As proteínas recombinantes

foram glicosiladas e mantiveram-se antigênicas. O potencial imunoprotetor das

proteínas foi avaliado em modelo hamster desafiado com cepa virulenta de L.

interrogans sorovar Copenhageni. Ambas as proteínas induziram altas taxas de

anticorpos (P < 0,001). Os animais imunizados com LigANI e LipL32, utilizando

hidróxido de alumínio como adjuvante, não apresentaram proteção contra o desafio,

mas demonstraram um aumento significativo na sobrevida (P < 0,001). Em

conclusão, a levedura P. pastoris demonstrou ser um eficiente sistema de expressão

heterólogo das proteínas LigANI e LipL32 de L. interrogans. A proteína LigANI

secretada e glicosilada pode ser utilizada no controle da leptospirose, embora

estudos adicionais sejam necessários.

Palavras-chave: leptospirose; Leptospira interrogans; vacina recombinante; Pichia

pastoris.

7

ABSTRACT

HARTWIG, Daiane Drawanz. Production antigens from Leptospira interrogans in

Pichia pastoris and evaluation of immunoprotective potential again st

leptospirosis. 2010. 103 p. Tese (Doutorado) – Programa de Pós-Graduação em

Biotecnologia, Universidade Federal de Pelotas, Pelotas.

Leptospirosis is a serious infectious disease caused by pathogenic spirochetes of the

genus Leptospira, it is classified as a zoonosis of worldwide distribution. This disease

results morbidity and mortality in humans and animals, justifying the application of

prophylactic strategies. Current vaccines against leptospirosis are composed of

inactivated bacteria and do not stimulate cross-protection. Thus, there is need to

develop a safe and effective vaccine. In this study, we used the outer membrane

proteins LigANI e LipL32, because they have been identified as vaccinogens. These,

in their recombinant form, are usually expressed in Escherichia coli and as subunit

vaccines have shown variable efficacy. We describe in this work the use of Pichia

pastoris as an alternative expression system. The genes ligANI and lipL32 were

cloned into vector pPICZαB, which allowed the secretory expression of proteins in P.

pastoris. The protein yield in this system was 276 mg/L for LigANI and 285 mg/L for

LipL32. The recombinant proteins were glycosylated and remained antigenic. The

immunoprotective potential was evaluated in the hamster model, challenged with

virulent L. interrogans serovar Copenhageni. Both proteins induced high levels of

antibodies (P < 0.001). The animals immunized with LigANI and LipL32 using

aluminium hydroxide as adjuvant, showed no protection against challenge, but

showed a significant increase in survival (P < 0.001). In conclusion, the yeast

P. pastoris has proved an efficient heterologous expression system of LigANI and

LipL32 L. interrogans proteins. The secreted and glycosylated LigANI protein may be

used in the control of leptospirosis, although additional studies are needed.

Keywords: leptospirosis, Leptospira interrogans; recombinant vaccine; Pichia

pastoris.

8

SUMÁRIO

PRODUÇÃO DE ANTÍGENOS DE Leptospira interrogans EM Pichia pastoris E

AVALIAÇÃO DO POTENCIAL IMUNOPROTETOR CONTRA LEPTOSP IROSE ..... 1

RESUMO..................................................................................................................... 6

ABSTRACT .......................................... ....................................................................... 7

1 INTRODUÇÃO GERAL................................. ......................................................... 10

2 ARTIGO 1 .............................................................................................................. 15

LEPTOSPIROSIS: RECENT ADVANCES IN VACCINES AND IMMU NE PROFILE16

3 ARTIGO 2 .............................................................................................................. 42

HIGH YIELD EXPRESSION OF LEPTOSPIROSIS VACCINE CAND IDATES LIGA

AND LIPL32 IN THE METHYLOTROPHIC YEAST PICHIA

PASTORIS………………………………………………………………………………….43

ABSTRACT……………………………………………………………………………...44

BACKGROUND…………………………………………………………………………45

RESULTS……………………………...………………………………………………...46

DISCUSSION….………………………………………………………………………..48

CONCLUSIONS….......…………………………………………………………………50

METHODS………………………………………………………………………….……51

COMPETING INTERESTS…………………………………………………………….55

AUTHORS’ CONTRIBUTIONS………………………………………………………..56

ACKNOWLEDGEMENTS…..................................................................................56

REFERENCES......................................................................................................57

4 ARTIGO 3 .............................................................................................................. 69

IMMUNOPROTECTION BY LIGA AND LIPL32 PRODUCED IN PICHIA PASTORIS

AND EVALUATED IN THE HAMSTER MODEL OF LETHAL

LEPTOSPIROSIS……………………………………………………………………….....70

ABSTRACT……………………………………………………………………………...71

INTRODUCTION………………………………………………………………………..72

MATERIAL AND METHODS…...…...………………………………………………...73

RESULTS…...….………………………………………………………………………..77

9

DISCUSSION…….......…………………………………………………………………79

REFERENCES......................................................................................................83

5 CONCLUSÕES.......................................................................................................95 6 REFERÊNCIAS.......................................................................................................96

7 ANEXOS...............................................................................................................103

10

1. INTRODUÇÃO GERAL

Leptospirose, causada por bactérias patogênicas do gênero Leptospira, é

uma zoonose de importância global que afeta o homem e demais mamíferos

(BHARTI,A.R. et al., 2003;FAINE,S.B. et al., 1999;VINETZ,J.M., 2001). A

globalização e as desigualdades sociais produzem padrões epidemiológicos

divergentes para a leptospirose (MCBRIDE,A.J. et al., 2005;REIS,R.B. et al., 2008).

É caracterizada como uma doença re-emergente de maior ocorrência em regiões

tropicais e subtropicais, que apresentam condições precárias de saneamento

(BHARADWAJ,R., 2004), podendo estar associada ainda a atividades recreacionais,

esportivas ou a desastres naturais (DESAI,S. et al., 2009).

Humanos podem infectar-se através do contato com urina de animais

portadores de leptospiras patogênicas, principalmente roedores. No entanto, muitos

outros animais podem estar envolvidos na transmissão, pois é uma doença comum

entre animais domésticos e silvestres (BHARTI,A.R. et al.,

2003;KOIZUMI,N.;WATANABE,H., 2005a;LEVETT,P.N., 2001). No homem, a

apresentação clínica é altamente variável, sendo em sua fase inicial sugestiva de

influenza, malária ou dengue, necessitando de um diagnóstico diferencial efetivo em

áreas com epidemia ou alta incidência destas doenças (ELLIS,T. et al., 2008). Em

sua forma aguda, a leptospirose pode desencadear uma série de sinais clínicos e

afetar múltiplos órgãos, incluindo o fígado (icterícia), rins (nefrite), pulmões

(hemorragia pulmonar) e cérebro (meningite), com taxas de mortalidade de 10-15%,

associadas à doença de Weil, chegando a 70%, nos casos de síndrome

hemorrágica pulmonar grave (FAINE,S.B. et al., 1999;GOUVEIA,E.L. et al.,

2008;SEGURA,E.R. et al., 2005). Nestes casos graves mesmo com estratégias de

intervenção agressivas, as taxas de mortalidade permanecem altas. A expressão

gênica aumentada de efetores imunes pró e anti-inflamatórios, induzidos por uma

grande carga infectante de leptospiras patogências parece ser a causa de quadros

de leptospirose severa (VERNEL-PAUILLAC,F.;GOARANT,C., 2010)

Sendo considerado um problema de saúde pública, somado as perdas

econômicas no setor agropecuário, o uso de vacinas contra a leptospirose se

justifica em populações de risco. Ainda não existe uma vacina efetiva para uso

humano, embora existam ensaios em fase pré-clinica e clínica neste sentido. Em

Cuba, foram vacinadas mais de 10.000 pessoas com uma bacterina, obtendo-se

11

78% de proteção (MARTINEZ,R. et al., 2004). Já na China, o protótipo de vacina

testado em humanos não protegeu crianças menores de 14 anos (ZHUO,J.T. et al.,

1995). As vacinas em desenvolvimento para uso humano, assim como as

disponíveis para uso animal, e que se baseiam na célula inteira inativada de isolados

locais, caracterizam-se por induzir imunidade baixa e de curta duração, além de

sorovar específica, pois induzem anticorpos contra o lipopolissacarídeo (LPS) destas

bactérias, requerendo imunizações anuais (ANDRE-FONTAINE,G. et al.,

2003;KOIZUMI,N.;WATANABE,H., 2005a;PETERSEN,A.M. et al., 2001;SONRIER,C.

et al., 2000). Estas vacinas em alguns casos podem prevenir o desenvolvimento da

doença, mas não a leptospirúria (ALT,D.P. et al., 2001). Existem mais de 270

sorovares patogênicos de Leptospira e esta diversidade antigênica tem sido

atribuída a composição do LPS (BULACH,D.M. et al., 2000). Estas limitações

dificultam a obtenção de uma vacina multivalente efetiva.

Dentre as leptospiras patogênicas que tiveram seu genoma seqüenciado, L.

interrogans contém cerca de 3530 prováveis seqüências codificadoras (CDS) no

sorovar Copenhageni e 3613 no sorovar Lai, enquanto L. borgpetersenii sorovar

Hardjo apresenta 2909 e 2949 CDS para os isolados L550 e JB197,

respectivamente (BULACH,D.M. et al., 2006). A análise da seqüência genômica dos

isolados de Leptospira seqüenciados tem possibilitado a identificação de novos

alvos candidatos ao desenvolvimento da vacina ou de novos testes para diagnóstico.

Atualmente, estudos celulares e moleculares destes antígenos têm focado em

fatores de mobilidade bacteriana, LPS, proteínas de membrana externa (outer

membrane proteins_OMPs) e fatores de virulência (WANG,Z. et al., 2007). Dentre

eles, nosso grupo de pesquisa tem avaliado o potencial de OMPs, como a

lipoproteína LipL32 e as Leptospiral immunoglobulin-like proteins (Lig).

LipL32, também chamada de proteina-1 associada a hemolisina (Hap-1)

(BRANGER,C. et al., 2001), é a OMP mais abundante exposta na superfície celular

(CULLEN,P.A. et al., 2005), sendo conservada entre as espécies patogênicas e

ausente nas saprófitas (HAAKE,D.A. et al., 2004). Esta proteína é altamente

imunogênica e cerca de 95% dos pacientes com leptospirose produzem anticorpos

anti-LipL32 durante a infecção (FLANNERY,B. et al., 2001). Além disso, foi

demonstrado que ela é expressa durante a infecção em hamsters (HAAKE,D.A. et

al., 2000), modelo clássico de estudo para a leptospirose (HAAKE,D.A., 2006).

LipL32 é uma proteína ligante de componentes da matriz extracelular (EMC), como

12

colágeno, fibronectina e laminina (HAUK,P. et al., 2008). As proteínas Ligs também

são expostas na superfície de leptospiras patogênicas e têm como característica

repetições em tandem de 90 aminoácidos, que constituem domínios, os chamados

Big (bacterial immunoglobulin-like repeat domains). Estes domínios foram

originalmente identificados em moléculas de adesão de outras bactérias, como

intiminas de Escherichia coli e invasinas de Yersinia pseudotuberculosis

(HAMBURGER,Z.A. et al., 1999;LUO,Y. et al., 2000). Os genes lig deixam de ser

transcritos em cepas de alta passagem, e estão ausentes nas saprófitas

(MATSUNAGA,J. et al., 2003;PALANIAPPAN,R.U. et al., 2002;PALANIAPPAN,R.U.

et al., 2004). As proteínas Lig medeiam interações com proteínas que compõem a

ECM das células do hospedeiro, como fibronectina, fibrinogênio, colágeno, laminina,

elastina e tropoelastina (CHOY,H.A. et al., 2007;LIN,Y.P. et al., 2009). O potencial

imunoprotetor das proteínas LipL32 e LigA tem sido demonstrado e, para o antígeno

LipL32, foi relatado que não há indução de resposta imune protetora quando a

proteína recombinante é inoculada com adjuvante, mas este antígeno protege como

vacina de DNA (BRANGER,C. et al., 2005) ou quando expresso por adenovírus

(BRANGER,C. et al., 2001) ou Mycobacterium bovis BCG (SEIXAS,F.K. et al., 2007).

Já para o antígeno LigA tanto sob a forma proteína recombinante (SILVA,E.F. et al.,

2007), quanto como vacina de DNA (FAISAL,S.M. et al., 2008) ou utilizando micro-

esferas e lipossomos (FAISAL,S.M. et al., 2009) demonstraram proteção em

hamsters.

Dentre as vacinas recombinantes existentes: (i) vacinas de subunidade, (ii)

vacinas de DNA e (iii) vacinas vetorizadas, as de subunidade recombinante

apresentam a clara vantagem de serem licenciadas pelos órgãos de regulamentação

competentes (CLARK,T.G.;CASSIDY-HANLEY,D., 2005) e de apresentarem pouco

ou nenhum efeito colateral (KOIZUMI,N.;WATANABE,H., 2005b). Para a produção

destas subunidades recombinantes tem-se utilizado sistemas de expressão

baseados em procariotos e em eucariotos.

Certos procariotos não têm a capacidade de auxiliar no folding da proteína e

nem realizar modificações pós-traducionais, as proteínas produzidas neste modelo

são expressas na maioria das vezes na forma insolúvel, originando corpúsculos de

inclusão, o que leva ao emprego de etapas adicionais de solubilização e re-folding

destas proteínas (JENKINS,N. et al., 1996;MELDGAARD,M.;SVENDSEN,I., 1994). A

alternativa para a ampla gama de proteínas que não podem ser expressas com

13

sucesso em Escherichia coli, é produzi-las na levedura metilotrófica Pichia pastoris.

Este eucarioto emergiu como um poderoso sistema de expressão heteróloga de

proteínas recombinantes (CEREGHINO,J.L.;CREGG,J.M., 2000). A utilização desta

plataforma oferece vantagens sobre os sistemas de expressão em procariotos,

destacando o alto crescimento em meios de cultura relativamente simples,

possibilidade de expandir a produção para escalas industriais, bem como, a

presença neste sistema de um forte promotor induzível com metanol

(DALY,R.;HEARN,M.T., 2006;MACAULEY-PATRICK,S. et al., 2005). O uso da

levedura P. pastoris permite a produção de proteínas com modificações pós-

traducionais, como glicosilação e adição de pontes dissulfeto, além disso, há a

possibilidade de secreção de proteínas heterólogas de forma solúvel no meio, o que

simplifica etapas de purificação (CEREGHINO,G.P. et al.,

2002;CEREGHINO,J.L.;CREGG,J.M., 2000;GELLISSEN,G., 2000). Até o presente

momento, não existem relatos na literatura da avaliação do potencial imunoprotetor

de proteínas recombinantes de Leptospira produzidas na levedura P. pastoris.

Este trabalho foi delineado visando produzir proteínas recombinantes de L.

interrogans em um sistema eucarioto baseado na levedura metilotrófica P. pastoris.

As hipóteses deste estudo foram que as proteínas expressas neste sistema fossem

solúveis e apresentassem um rendimento superior ao sistema de expressão

baseado em E. coli. Além disso, a secreção destas proteínas permitiria sua

glicosilação, característica esta que poderia interferir em sua antigenicidade,

imunogenicidade e potencial imunoprotetor. Desta forma, tínhamos como objetivo

geral produzir duas proteínas de L. interrogans, LigANI e LipL32, utilizando P.

pastoris como sistema de expressão e avaliar seu potencial imunoprotetor em

hamsters. Para isso, traçamos os seguintes objetivos específicos: (i) clonar os genes

ligANI e lipL32 no plasmídeo pPICZαB de expressão em P. pastoris, (ii) expressar e

purificar as proteínas LigANI e LipL32 e (iii) avaliar o potencial antigênico,

imunogênico e imunoprotetor das proteínas produzidas neste sistema eucarioto.

Os dados gerados nesta tese estão apresentados na forma de artigos

científicos. Esta forma de apresentação, comparada ao modelo de tese tradicional,

visa propiciar uma divulgação objetiva e rápida dos resultados obtidos. Neste

contexto, o artigo 1 trata de uma revisão sobre vacinas e imunidade contra a

leptospirose. Neste artigo abordamos os avanços no estudo da imunidade contra

Leptospira e também o potencial imunoprotetor em modelos animais de antígenos

14

avaliados entre leptospiras patogênicas. Esse trabalho está formatado segundo as

normas do periódico Expert Review of Vaccines .

Em seguida, o artigo 2 descreve a utilização da levedura P. pastoris na

expressão das proteínas LigANI e LipL32 de L. interrogans. Este trabalho relata a

expressão secretória destas proteínas em sua forma glicosilada, com rendimento

significativamente maior que o obtido quando produzidas em E. coli. Este trabalho

está aceito para publicação no periódico Microbial Cell Factories .

Como prosseguimento deste estudo, avaliamos o potencial imunogênico e

imunoprotetor das proteínas LigANI e LipL32 produzidas em P. pastoris. Neste

estudo, utilizamos o modelo animal hamster em ensaio desafio com cepa virulenta

de L. interrogans. Este trabalho originou o artigo 3 desta tese, que está formatado

segundo as normas do periódico Clinical and Vaccine Immunology .

15

2. ARTIGO 1

Leptospirosis: recent advances in vaccines and immune profile

(Revisão formatada segundo as normas do periódico Expert Review of

Vaccines)

16

Leptospirosis: recent advances in vaccines and immune profile

Daiane Drawanz Hartwig1; Fabiana Kömmling Seixas1; Odir Antônio Dellagostin1*

1Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico, Universidade

Federal de Pelotas, Pelotas, RS, Brazil

§Corresponding author: Odir A. Dellagostin, Centro de Biotecnologia, Universidade

Federal de Pelotas, Campus Universitário, Caixa Postal 354, CEP 96010-900, Pelotas,

RS, Brazil. Tel. +55 53 3275 7587; Fax +55 53 3275 7551

17

Summary

The immune response induced by vaccines against leptospirosis composed by

whole-cell preparations prevents the disease. However, it has several drawbacks

including incomplete, short-term, serovar-specific effects and poor immunological

memory. These limitations of the killed whole-cell vaccines highlight the need for

obtaining an effective multivalent vaccine preparation and the development of improved

immunization protocols. Several leptospiral recombinant proteins have been evaluated

regarding their potential for use as vaccine candidates. In this paper, we summarized the

current findings on immunity against Leptospira and on leptospiral antigens that have

been evaluated as immunogens and that induce protective immunity in animal models.

Keywords: Leptospira; leptospirosis; immunity; vaccines.

Introduction

Leptospirosis, one of the most widespread zoonotic diseases in the world is

caused by spirochete Leptospira (1,2,3). It has a higher incidence in tropical and

subtropical regions (4). Leptospirosis is an occupational disease which affects humans

and animals that come into frequently contact with rodents or polluted water and soil

(4,5). Leptospira infection occurs after penetration of the bacterium through mucosa or

skin lesion, and is usually an acute disease, however organisms sometimes escape

immune defenses and may induced a chronic disease (6). Symptoms range from a mild

influenza-like illness, often confused with other febrile diseases, to a severe infection

with renal and hepatic failure (Weil’s disease), or severe pulmonary haemorrhage

syndrome (SPHS) with a case-fatality rate of 50% or more (7,8).

18

The immunity against Leptospira is reported traditionally as humoral. It

involves the stimulation and maturation of B cells producer of immunoglobulins (Ig)

with specificities primarily directed at the polysaccharide components of the leptospiral

lipopolysaccharides (LPS) (3). Recently, the role of the cell-mediated immunity in

protection against leptospirosis, characterized by CD4 and gammadelta (γδ) T cells, was

examined (9,10,11,12). Moreover, it was demonstrated that pathogenic leptospires can

stimulate production of type 1 cell-mediated immune (Th1) cytokines (13). The

establishment of correlation between the Th1 and Th2 anti-Leptospira immunity is of

major importance to understanding the pathogenesis of induced or natural infection as

well as to obtain a successful vaccine against leptospirosis.

There are more than 270 pathogenic serovars of Leptospira and this antigenic

diversity has been attributed to distribution and composition of the LPS (14). This

serological diversity precludes the obtaining of an effective multivalent vaccine and the

development of immunization protocols based on whole-cell or membrane preparations.

Scientists who work on vaccine development have focused on bacterial mobility, LPS,

outer membrane proteins (OMPs) and virulence factors, revised by Wang et. al (15).

Recently, many antigens have been evaluated regarding antigenicity and

immunogenicity properties. Based on antibody production, lymphocyte proliferation

and determination of cytokine profile, studies have shown that constructs tested as

vaccine modulated both Th1 and Th2 immune response (16,17,18,19,20,21).

In this review we present the recent advances in the field of immunity and

vaccines against leptospirosis. The immunity induced by Leptospira, novel vaccination

strategies, vaccine candidates (subunit, vectored, DNA and DNA prime/protein boost

vaccines), new forms of antigen presentation and the immunity induced by them are

discussed.

19

Immunity against Leptospira

The first step in the activation of the immune system by Leptospira is the

antibody production, but the events involved remain undefined. During the initial stages

of infection leptospires evade the host innate immune system and some reports indicate

that they acquire complement factor H and fluid-phase regulators (22) using the

leptospiral endostatinlike (Len) proteins as ligands (23,24). Spirochete invasion and

toxicity of outer membrane components cause robust inflammatory host responses (25).

The high production of the pro-inflammatory cytokines causes deleterious effects in the

host. The up-regulated gene expression of both pro- and anti-inflammatory immune

effectors together with a higher Leptospira burden, suggest that these gene expression

levels could be predictors of adverse outcome in leptospirosis (26).

An important finding regarding the innate immune response against leptospiral

was that the macrophages activation by leptospiral LPS occurred through CD14 and the

Toll-like receptor 2 (TLR2) (27). L. interrogans produces an atypical LPS that differs in

several biochemical, physical and biological properties, as degree of acylation,

phosphorylation, or the length of acyl chains (28), and this can be responsible for

modified pro-inflammatory properties of LPS. Indeed, the TLR2 is the predominant

receptor for Gram-positive bacteria and for other bacterial products that are distinct

from Gram-negative LPS (29,30,31). Other microorganisms that have an atypical LPS have

been reported to signal through TLR2 pathway, like Porphyromonas gingivalis,

Rhizobium, Legionella pneumophila and Helicobacter pylori (32,33,34). L. pneumophila

and H. pylori present an atypical lipid A that shows some similarities with the lipid A

from Leptospira. This characteristic of the lipid A in Leptospira may be responsible for

its ability to adapt and colonize different hosts. However, the role of TLR4 in immunity

20

against leptospirosis is not ruled out, mediated by a leptospiral ligand(s) other than LPS

(35). Nahori et al. demonstrated the existence of an important difference between human

and mouse specificity in TLR recognition (36). This may have important consequences

for leptospiral LPS sensing and subsequent susceptibility to leptospirosis.

After the entry of the spirochete in the host, T and B cells are stimulated. The

initial removal is done by phagocytes, the majority of leptospires is digested in the

vacuoles of macrophages and neutrophils, where the phagocytic activity is initiated by

opsonizant antibodies (Sambasiva et al., 2003). The antibody response against

leptospirosis is classic, starting with a peak of IgM, which is quickly followed by

increased IgG levels and this persist for a longer period.

The paradigm in the study of immunity induced by Leptospira is that the

protective immunity is not exclusively humoral (3) and the mechanism by which

leptospires activate the immune system and the role of cell-mediated immunity in host

defense to Leptospira remains poorly understood. Indeed, there were evidences that

anti-LPS antibodies are not the only mechanism that play a role in naturally acquired

protective immunity (37). This fact was reexamined by other authors and in these works

it was showed that the immunity in vaccinated cattle with a protective monovalent

serovar Hardjo vaccine is associated with induction of a Th1 response, because the

animals produced gamma interferon (IFN-γ) by gammadelta (γδ) T cells, with the

remaining cells being CD4 T cells (11,12,38,9). It is speculated that this might be due to the

fact that γδ T cell are the first to be stimulated in an infection or inflammatory reaction

and the CD4 T cells may be more efficient once they are engaged and expanded.

Direct injury by microbial factors and cytokines produced in response to

infection has been proposed to be involved in pathogenesis of leptospirosis. The

evaluation of cytokine production against virulent leptospires has been performed in a

21

lethal hamster model of leptospirosis. The expression levels of cytokine mRNA in the

peripheral blood mononuclear cells was evaluated in a kinetic study, and a pronounced

expression of Th1 cytokine mRNA, such as the tumor necrosis factor alpha (TNF-α),

interferon gamma (IFN-γ), and interleukin-12 (IL-12) was observed (13). In another

study the Leptospira infection resulted also in the production of anti-inflammatory

cytokines, including transforming growth factor beta (TGF-β) and IL-10 (39). In humans

the TNF-α have been reported to be involved in leptospirosis cases and it was

demonstrated a significant increase in patients with this disease (40). The expression of

this factor in plasma represents a host global response and it was associated with

severity of disease and mortality (41). Recently, it has been demonstrated that the human

leptospirosis does not seem to generate memory T cells specific for Leptospira or its

protein antigens (42). In addition, the first report on global responses of

pathogenic Leptospira to innate immunity was published (43). In this work it was

revealed that as an immune evasion strategy of L. interrogans it down-regulates the

major outer membrane proteins (OMP) and a putative transcription factors may be

involved in governing these down-regulations. Concluding, the interaction of

Leptospira with the host immune system components requires further studies for

providing qualified information for selection of vaccine candidates.

Novel vaccination strategies

The drawbacks presented by vaccines prepared from killed whole leptospiral

cells highlight the need of new vaccine strategies for the prevention of the leptospirosis.

The identification of proteins that elicit protective immunity has become a major focus

of current leptospirosis vaccine research. Additionally, the way these antigens are

administrated is important. Several leptospiral recombinant vaccines have been

22

constructed using advanced methods and evaluated in animal models. These include

subunit vaccines, DNA vaccines and vectored vaccines.

Subunit vaccines

Research on interaction of spirochetes with the host's immune system has a strong

emphasis on OMPs. In fact, these structures have been convincingly shown to activate

immune cells via CD14 and TLR2, and recent data also indicate an interaction with LPS

binding protein (LBP) (44). Immunization with a combination of the LipL41, a surface-

exposed lipoprotein and OmpL1, a transmembrane porin, provided synergistic

protection in hamsters (71% survival), higher than protection obtained with these

proteins alone (45). This synergism in immune protection may be due to the combination

of two membrane proteins classes in the immune system stimulation. The LipL41-

attached lipid being required for immunogenicity and/or the membrane conformation of

the OmpL1 porin being required to conserve conformational epitopes (46). Other

lipoproteins, including rLIC12730 (44%), rLIC10494 (40%) and rLIC12922 (30%)

were also evaluated in the same animal model challenged with a lethal dose of a virulent

strain of Leptospira (47).

The recombinant Lig proteins (LigA and LigB) induced complete protection in

CH3/HeJ mice (48), however the mouse model is not the ideal for leptospirosis studies,

because large infective doses are required for disease development. The classic model

for leptospirosis is the hamster, due to its susceptibility to infection and reproducibility

of the results (49). Using the hamster model, recombinant LigA was evaluated as vaccine

candidate against infection by L. interrogans serovar Pomona (50). LigA was truncated

into conserved (rLigAcon) and variable (rLigAvar) regions and expressed in

Escherichia coli as a fusion protein with glutathione-S-transferase (GST). The

difference between survival rates of LigA immunized and control animals was

23

significant using aluminum hydroxide as adjuvant, and the vaccine conferred sterilizing

immunity. One year later the proteins LigA and LigB from L. interrogans serovar

Copenhageni were used in the immunization of hamsters using Freund's adjuvant (51). A

single fragment, named LigANI, which corresponds to the six carboxy-terminal Ig-like

repeat domains of the LigA molecule, conferred immune protection against mortality

(67-100%) in homologue challenge, but this fragment did not confer sterilizing

immunity. LigB did not present significant immune protection in this study, but in

another (52) this protein was truncated into conserved (LigBcon) and variable (varB1,

varB2) fragments and expressed as GST/His-tag fusion proteins. The challenge

experiment was performed in hamster model with a virulent L. interrogans serovar

Pomona. rLigBcon was able to aford protection (71%), followed by rVarB1 (54%) and

rVarB2 (33%). The administration of all three fragments enhanced the protective

efficacy of the vaccine (83%).

The efficacy of the subunit vaccine is usually variable and it is attributed to

incorrect folding of the recombinant protein (51), or due to low expression, when the

recombinant protein is toxic for the cells (53,50). Considering the importance of the

protein structural integrity to confer immune protection, new strategies have been

developed for recombinant proteins refolding. The recombinant OmpA was produced in

E. coli as an insoluble form and high hydrostatic pressure (HHP) in association with

redox-shuffling reagents (oxidized and reduced glutathione) and guanidine

hydrochloride or l-arginine were used to refold aggregated as inclusion bodies (54).

About 40% of the protein was refolded and the circular dichroism revealed the presence

of secondary structure, and high antibody titers were seen after immunization with this

protein, and sera from infected hamsters reacted with soluble OmpA70 (54).

24

OmpA-like proteins were also evaluated and may serve as novel vaccine

candidates for leptospirosis (55). Of the proteins studied, Lp4337 was able to impart

maximum protection (75%), followed by Lp3685 (58%) and Lp0222 (42%), against

lethal infection of Leptospira in the immunized animals. In a synergist study 12 OMPs

were evaluated and three proteins, rLp1454, rLp1118 and rMceII were found to be

protective in a hamster model of leptospirosis (71%, 75% and 100%, respectively) and

synergistically (87%) against serovar Pomona infection, which may help us to develop a

multicomponent vaccine for leptospirosis (56).

Vectored vaccines

A vaccine vectored by adenovirus was tested with the Hap1 (Hemolysis-

Associated Protein 1), also known as LipL32 (57) in a gerbil model (58). The adenovirus

vector containing this antigen stimulated significant protection against a heterologous

Leptospira challenge, while the recombinant protein did not confer protection (59).

Substantial evidences suggest that the immune system immunomodulation and

induction of the protective immunity is dependent on cellular mechanism.

The bacillus Calmette-Guerin (BCG), a live attenuated Mycobacterium bovis is

used to protect against tuberculosis (60), and is considered a promising candidate as a

vector system for delivery of foreign antigens to the immune system. The gene coding

for LipL32 was cloned into several mycobacterial vectors for expression in BCG (61).

Hamsters immunized with recombinant BCG (rBCG) expressing LipL32 were protected

against mortality upon challenge with a lethal inoculum of L. interrogans serovar

Copenhageni. Autopsy examination did not reveal macroscopic or histological evidence

of disease in rBCG immunized hamsters that survived the lethal challenge. The

efficiency of these vectored vaccines may be in its capacity of induced a strong cellular

25

and humoral immune response against foreign antigens, suggesting that the way the

immune system is induced is important for protection against leptospirosis.

DNA vaccines and DNA prime/protein boost

In leptospirosis vaccine development there are reports of DNA immunization and

a variation of this technique, called DNA prime, a combination of the DNA and protein

immunization. DNA vaccines take advantage of the fact that plasmid DNA can directly

transfect animal cells, provide prolonged antigen expression in vivo leading to

amplification of the immune response (62). These vaccines appear to offer several

advantages, such as easy construction, temperature stability, low cost of mass

production and capacity to induce both humoral and cellular immunity (63,64,65).

The first report of Leptospira DNA vaccine evaluation, that presented survival

rate, was the immunization of guinea pigs with DNA recombinant plasmid rpDJt

expressing protein P68 derived from a genomic library of serovar lai strain 017 (66). The

survival percentage of P68 immunized group was 100% and the group rpDJt was 77%,

a high percentage for a negative control group. The same animal model was used by

outer authors for evaluation of the immune protection induced by the plasmid VR1012

encoding the 33 kDa endoflagellin of L. interrogans serovar lai (67). In this study it was

reported 90% of survival compared to control group. Five years later the use of DNA

constructs encoding leptospiral protein Hap1 was tested (59). The immune protection

was demonstrated using a hamster model with a survival rate of the 60% against a

serovar canicola challenge.

The protein OmpL1 of serovar Copenhageni was cloned in a mammalian

expression vector pcDNA3.1(+) and the survival evaluated in hamsters challenged with

the heterologous serovar Pomona (68). The authors reported that the animals immunized

26

with pcDNA3.1(+)/ompL1 plasmid DNA presented a survival rate of 33%. This vector

was used for expressing the OMP LipL21 of serovar Lai, but in this study guinea pigs

were used as model. All animal survived the lethal challenge, and the titer of specific

antibodies and stimulation index of splenocytes increased (69). Furthermore, no obvious

pathologic changes were observed in the pcDNA3.1(+)/lipL21 immunized guinea pigs.

Still on the use of OMPs in the DNA vaccines evaluation, three antigens were cloned

into a pVAX1 plasmid using a linking prime PCR method to construct a lipL32-lipL41-

ompL1 fusion gene (70). BALB/c mice were immunized using DNA-DNA, DNA-protein

(DNA prime) and protein-protein strategies. The groups receiving the recombined

LipL32-LipL41-OmpL1 vaccine had anti-LipL41 and anti-OmpL1 antibodies and

yielded better splenocyte proliferation values than the groups receiving LipL32. DNA

prime and protein boost immune strategy stimulated more antibodies than DNA-DNA

and yielded greater cytokine and splenocyte proliferation than protein-protein. In this

study the authors did not evaluate the immune protective potential.

As mentioned before, the recombinant protein LigA induced significant

protection against serovar Pomona challenge in hamsters. In another study it was

demonstrated the protective efficacy of a LigA DNA vaccine (21). The LigA DNA

vaccine was constructed in two truncated forms: a conserved portion (LigAcon) and a

variable portion (LigAvar) and challenge with a virulent serovar Pomona. In this study

all groups immunized with LigA constructs presented 100% of survival, however the

control groups also had high level (62%).

New forms of antigen delivery

The development of the novel ways of antigen presentation and availability of

improved adjuvants suitable for clinical use is highly desirable and necessary.

Adjuvants play a pivotal role in vaccination, principally when the vaccine antigen itself

27

has only weak immunogenicity. Actually, aluminum hydroxide is the adjuvant licenced

for use in vaccine formulations for human use, however if it is used for many times, it

can cause severe toxics reactions such as erythema, subcutaneous nodules and contact

hypersensivity. Additionally, it is unable to activate the cell mediated immunity (71,72,73).

Therefore, delivery vehicles that act as adjuvants have been evaluated against

various infectious diseases, such as leptospirosis. Liposomes from total polar lipids of

non-pathogenic L. biflexa serovar Patoc were evaluated as deliveries of Lp0607,

Lp1118 and Lp1454 of L. interrogans serovar Pomona in a hamster model (74). The

protective efficacy of the leptosomes (so called by the authors) based vaccines was

75%. These leptossomes are phospholipids vesicles that elicit humoral and cell

mediated immunity (75,76). These authors that tested leptosomes in preliminary studies,

evaluated smegmossomes (vesicles originated of the polar lipids from Mycobacterium

smegmatis), testing the same antigens (77). The vaccine constructions evaluated by them

demonstrate that 75% of the animals survival the challenge, compared to only 37%

survival rate in the aluminum hydroxide group.

PLGA microspheres were used for LigA delivery (78). Microspheres are

composed of poly-lactide co-glycolides, that are biodegradable and biocompatible

components (79). LigA protein presented by this vehicle to the immune system

demonstrated that 75% of the hamsters were protected, but aluminum hydroxide alone

protects 50% of them. The use of particulate adjuvants in subunit vaccines present

success because prevent antigen degradation, enhancing its presentation to professional

APCs including macrophages and dendritic cells, immunostimulating components such

as TLR ligants, toxins and cytokines, thus inducing humoral and cell mediated immune

responses.

28

Immunity stimulated by new vaccines

Currently, a considerable number of antigens used in vaccine formulations

have been evaluated regarding the immune response profile induced based on antibody

production, lymphocyte proliferation and determination of cytokine profile. Most

recombinant vaccines induced strong humoral responses with high levels of IgG, Th2

citokynes (IL-4, IL-10) and cell mediated immunity marked by T cell proliferation and

Th1 citokynes (IFN-γ) production (77,74,78,16,21). The cytokines are responsible for

activation, differentiation and cell proliferation, acting on its target cells through

specific receptors and may provide a useful method for the accurate study of

mechanisms of anti-Leptospira immunity, indications of prognostic factors and

evaluation of the effectiveness of the vaccine against leptospirosis (26). IL-4 is secreted

by Th2 cells, which are the major modulating cells of humoral immunity. IL-4 can

promote proliferation of B cells and it can also regulate the Th1/Th2 cytokine balance

(80). IL-10 is classically described as an anti-inflammatory cytokine with effects in

immune regulation and inflammation by down-regulating the expression of Th1

cytokines (81). IFN-γ is a potent pro-inflammatory cytokine (82). Its production was

shown as dependent on IL12p40 in human blood stimulated by L. interrogans notably

inhibiting Th2 cell activity (83).

Conclusions

The findings reviewed in this work represent recent progress made in the

Leptospira immnunity and recombinant vaccine development against leptospirosis.

Many antigens have been expressed in different heterologous systems and some have

shown to provide protection. A number of different factors have been evaluated and

identified as important in the induction of immune response. With these important

29

findings, the search for an efficient and broad serovar-range vaccine against

leptospirosis rapidly progressing.

30

References 1

2

1. Bharti AR, Nally JE, Ricaldi JN et al. Leptospirosis: a zoonotic disease of global 3

importance. Lancet Infect.Dis. 3(12), 757-771 (2003). 4

2. Adler B , de la Pena MA. Leptospira and leptospirosis. Vet.Microbiol. 140(3-4), 5

287-296 (2010). 6

3. Faine SB, Adler B, Bolin C, and Perolat P. Leptospira and Leptospirosis. 7

Melbourne: MediSci;2nd Ed. (1999) 8

4. Levett PN. Leptospirosis. Clin.Microbiol.Rev. 14(2), 296-326 (2001). 9

5. Waitkins SA. Leptospirosis as an occupational disease. Br.J.Ind.Med. 43(11), 10

721-725 (1986). 11

6. Schmid GP, Steere AC, Kornblatt AN et al. Newly recognized Leptospira 12

species ("Leptospira inadai" serovar lyme) isolated from human skin. 13

J.Clin.Microbiol. 24(3), 484-486 (1986). 14

7. Gouveia EL, Metcalfe J, de Carvalho AL et al. Leptospirosis-associated severe 15

pulmonary hemorrhagic syndrome, Salvador, Brazil. Emerg.Infect.Dis. 14(3), 16

505-508 (2008). 17

8. Segura ER, Ganoza CA, Campos K et al. Clinical spectrum of pulmonary 18

involvement in leptospirosis in a region of endemicity, with quantification of 19

leptospiral burden. Clin.Infect.Dis. 40(3), 343-351 (2005). 20

31

9. Baldwin CL, Sathiyaseelan T, Naiman B et al. Activation of bovine peripheral 21

blood gammadelta T cells for cell division and IFN-gamma production. 22

Vet.Immunol.Immunopathol. 87(3-4), 251-259 (2002). 23

10. Klimpel GR, Matthias MA, Vinetz JM. Leptospira interrogans activation of 24

human peripheral blood mononuclear cells: preferential expansion of TCR 25

gamma delta+ T cells vs TCR alpha beta+ T cells. J.Immunol. 171(3), 1447-26

1455 (2003). 27

11. Naiman BM, Alt D, Bolin CA, Zuerner R, Baldwin CL. Protective killed 28

Leptospira borgpetersenii vaccine induces potent Th1 immunity comprising 29

responses by CD4 and gammadelta T lymphocytes. Infect.Immun. 69(12), 7550-30

7558 (2001). 31

12. Naiman BM, Blumerman S, Alt D et al. Evaluation of type 1 immune response 32

in naive and vaccinated animals following challenge with Leptospira 33

borgpetersenii serovar Hardjo: involvement of WC1(+) gammadelta and CD4 T 34

cells. Infect.Immun. 70(11), 6147-6157 (2002). 35

13. Vernel-Pauillac F , Merien F. Proinflammatory and immunomodulatory cytokine 36

mRNA time course profiles in hamsters infected with a virulent variant of 37

Leptospira interrogans. Infect.Immun. 74(7), 4172-4179 (2006). 38

14. Bulach DM, Kalambaheti T, Pena-Moctezuma A, Adler B. Lipopolysaccharide 39

biosynthesis in Leptospira. J.Mol.Microbiol.Biotechnol. 2(4), 375-380 (2000). 40

15. Wang Z, Jin L, Wegrzyn A. Leptospirosis vaccines. Microb.Cell Fact. 6, 39- 41

(2007). 42

32

16. Yan W, Faisal SM, McDonough SP et al. Identification and characterization of 43

OmpA-like proteins as novel vaccine candidates for Leptospirosis. Vaccine 44

28(11), 2277-2283 (2010). 45

17. Faisal SM, Yan W, McDonough SP, Mohammed HO, Divers TJ, Chang YF. 46

Immune response and prophylactic efficacy of smegmosomes in a hamster 47

model of leptospirosis. Vaccine 27(44), 6129-6136 (2009). 48

18. Faisal SM, Yan W, McDonough SP, Chang CF, Pan MJ, Chang YF. Leptosome-49

entrapped leptospiral antigens conferred significant higher levels of protection 50

than those entrapped with PC-liposomes in a hamster model. Vaccine 27(47), 51

6537-6545 (2009). 52

19. Faisal SM, Yan W, McDonough SP, Chang YF. Leptospira immunoglobulin-53

like protein A variable region (LigAvar) incorporated in liposomes and PLGA 54

microspheres produces a robust immune response correlating to protective 55

immunity. Vaccine 27(3), 378-387 (2009). 56

20. Yan W, Faisal SM, McDonough SP et al. Immunogenicity and protective 57

efficacy of recombinant Leptospira immunoglobulin-like protein B (rLigB) in a 58

hamster challenge model. Microbes.Infect. 11(2), 230-237 (2009). 59

21. Faisal SM, Yan W, Chen CS, Palaniappan RU, McDonough SP, Chang YF. 60

Evaluation of protective immunity of Leptospira immunoglobulin like protein A 61

(LigA) DNA vaccine against challenge in hamsters. Vaccine 26(2), 277-287 62

(2008). 63

33

22. Meri T, Murgia R, Stefanel P, Meri S, Cinco M. Regulation of complement 64

activation at the C3-level by serum resistant leptospires. Microb.Pathog. 39(4), 65

139-147 (2005). 66

23. Stevenson B, Choy HA, Pinne M et al. Leptospira interrogans endostatin-like 67

outer membrane proteins bind host fibronectin, laminin and regulators of 68

complement. PLoS.One. 2(11), e1188- (2007). 69

24. Verma A, Hellwage J, Artiushin S et al. LfhA, a novel factor H-binding protein 70

of Leptospira interrogans. Infect.Immun. 74(5), 2659-2666 (2006). 71

25. Yang CW, Hung CC, Wu MS et al. Toll-like receptor 2 mediates early 72

inflammation by leptospiral outer membrane proteins in proximal tubule cells. 73

Kidney Int. 69(5), 815-822 (2006). 74

26. Vernel-Pauillac F , Goarant C. Differential cytokine gene expression according 75

to outcome in a hamster model of leptospirosis. PLoS.Negl.Trop.Dis. 4(1), e582- 76

(2010). 77

27. Werts C, Tapping RI, Mathison JC et al. Leptospiral lipopolysaccharide 78

activates cells through a TLR2-dependent mechanism. Nat.Immunol. 2(4), 346-79

352 (2001). 80

28. Darveau RP. Lipid A diversity and the innate host response to bacterial 81

infection. Curr.Opin.Microbiol. 1(1), 36-42 (1998). 82

29. Aderem A , Ulevitch RJ. Toll-like receptors in the induction of the innate 83

immune response. Nature 406(6797), 782-787 (2000). 84

34

30. Tapping RI, Akashi S, Miyake K, Godowski PJ, Tobias PS. Toll-like receptor 4, 85

but not toll-like receptor 2, is a signaling receptor for Escherichia and 86

Salmonella lipopolysaccharides. J.Immunol. 165(10), 5780-5787 (2000). 87

31. Hirschfeld M, Ma Y, Weis JH, Vogel SN, Weis JJ. Cutting edge: repurification 88

of lipopolysaccharide eliminates signaling through both human and murine toll-89

like receptor 2. J.Immunol. 165(2), 618-622 (2000). 90

32. Hirschfeld M, Weis JJ, Toshchakov V et al. Signaling by toll-like receptor 2 and 91

4 agonists results in differential gene expression in murine macrophages. 92

Infect.Immun. 69(3), 1477-1482 (2001). 93

33. Girard R, Pedron T, Uematsu S et al. Lipopolysaccharides from Legionella and 94

Rhizobium stimulate mouse bone marrow granulocytes via Toll-like receptor 2. 95

J.Cell Sci. 116(Pt 2), 293-302 (2003). 96

34. Tran AX, Karbarz MJ, Wang X et al. Periplasmic cleavage and modification of 97

the 1-phosphate group of Helicobacter pylori lipid A. J.Biol.Chem. 279(53), 98

55780-55791 (2004). 99

35. Viriyakosol S, Matthias MA, Swancutt MA, Kirkland TN, Vinetz JM. Toll-like 100

receptor 4 protects against lethal Leptospira interrogans serovar 101

icterohaemorrhagiae infection and contributes to in vivo control of leptospiral 102

burden. Infect.Immun. 74(2), 887-895 (2006). 103

36. Nahori MA, Fournie-Amazouz E, Que-Gewirth NS et al. Differential TLR 104

recognition of leptospiral lipid A and lipopolysaccharide in murine and human 105

cells. J.Immunol. 175(9), 6022-6031 (2005). 106

35

37. Truccolo J, Serais O, Merien F, Perolat P. Following the course of human 107

leptospirosis: evidence of a critical threshold for the vital prognosis using a 108

quantitative PCR assay. FEMS Microbiol.Lett. 204(2), 317-321 (2001). 109

38. Brown RA, Blumerman S, Gay C, Bolin C, Duby R, Baldwin CL. Comparison 110

of three different leptospiral vaccines for induction of a type 1 immune response 111

to Leptospira borgpetersenii serovar Hardjo. Vaccine 21(27-30), 4448-4458 112

(2003). 113

39. Lowanitchapat A, Payungporn S, Sereemaspun A et al. Expression of TNF-114

alpha, TGF-beta, IP-10 and IL-10 mRNA in kidneys of hamsters infected with 115

pathogenic Leptospira. Comp Immunol.Microbiol.Infect.Dis. (2009). 116

40. Estavoyer JM, Racadot E, Couetdic G, Leroy J, Grosperrin L. Tumor necrosis 117

factor in patients with leptospirosis. Rev.Infect.Dis. 13(6), 1245-1246 (1991). 118

41. Tajiki H , Salomao R. Association of plasma levels of tumor necrosis factor 119

alpha with severity of disease and mortality among patients with leptospirosis. 120

Clin.Infect.Dis. 23(5), 1177-1178 (1996). 121

42. Tuero I, Vinetz JM, Klimpel GR. Lack of demonstrable memory T cell 122

responses in humans who have spontaneously recovered from leptospirosis in 123

the Peruvian Amazon. J.Infect.Dis. 201(3), 420-427 (2010). 124

43. Xue F, Dong H, Wu J et al. Transcriptional responses of Leptospira interrogans 125

to host innate immunity: significant changes in metabolism, oxygen tolerance, 126

and outer membrane. PLoS.Negl.Trop.Dis. 4(10), e857- (2010). 127

36

44. Schroder NW, Eckert J, Stubs G, Schumann RR. Immune responses induced by 128

spirochetal outer membrane lipoproteins and glycolipids. Immunobiology 213(3-129

4), 329-340 (2008). 130

45. Haake DA, Mazel MK, McCoy AM et al. Leptospiral outer membrane proteins 131

OmpL1 and LipL41 exhibit synergistic immunoprotection. Infect.Immun. 132

67(12), 6572-6582 (1999). 133

46. Cullen PA, Haake DA, Adler B. Outer membrane proteins of pathogenic 134

spirochetes. FEMS Microbiol.Rev. 28(3), 291-318 (2004). 135

47. Atzingen MV, Goncales AP, de Morais ZM et al. Characterization of leptospiral 136

proteins that afford partial protection in hamsters against lethal challenge with 137

Leptospira interrogans. J.Med.Microbiol. 59(Pt 9), 1005-1015 (2010). 138

48. Koizumi N , Watanabe H. Leptospiral immunoglobulin-like proteins elicit 139

protective immunity. Vaccine 22(11-12), 1545-1552 (2004). 140

49. Haake DA. Hamster model of leptospirosis. Curr.Protoc.Microbiol. Chapter 12, 141

Unit- (2006). 142

50. Palaniappan RU, McDonough SP, Divers TJ et al. Immunoprotection of 143

recombinant leptospiral immunoglobulin-like protein A against Leptospira 144

interrogans serovar Pomona infection. Infect.Immun. 74(3), 1745-1750 (2006). 145

51. Silva EF, Medeiros MA, McBride AJ et al. The terminal portion of leptospiral 146

immunoglobulin-like protein LigA confers protective immunity against lethal 147

infection in the hamster model of leptospirosis. Vaccine (2007). 148

37

52. Yan W, Faisal SM, McDonough SP et al. Immunogenicity and protective 149

efficacy of recombinant Leptospira immunoglobulin-like protein B (rLigB) in a 150

hamster challenge model. Microbes.Infect. 11(2), 230-237 (2009). 151

53. Palaniappan RU, Chang YF, Jusuf SS et al. Cloning and molecular 152

characterization of an immunogenic LigA protein of Leptospira interrogans. 153

Infect.Immun. 70(11), 5924-5930 (2002). 154

54. Fraga TR, Chura-Chambi RM, Goncales AP et al. Refolding of the recombinant 155

protein OmpA70 from Leptospira interrogans from inclusion bodies using high 156

hydrostatic pressure and partial characterization of its immunological properties. 157

J.Biotechnol. 148(2-3), 156-162 (2010). 158

55. Yan W, Faisal SM, McDonough SP et al. Identification and characterization of 159

OmpA-like proteins as novel vaccine candidates for Leptospirosis. Vaccine 160

28(11), 2277-2283 (2010). 161

56. Chang YF, Chen CS, Palaniappan RU et al. Immunogenicity of the recombinant 162

leptospiral putative outer membrane proteins as vaccine candidates. Vaccine 163

25(48), 8190-8197 (2007). 164

57. Cullen PA, Xu X, Matsunaga J et al. Surfaceome of Leptospira spp. 165

Infect.Immun. 73(8), 4853-4863 (2005). 166

58. Branger C, Sonrier C, Chatrenet B et al. Identification of the hemolysis-167

associated protein 1 as a cross-protective immunogen of Leptospira interrogans 168

by adenovirus-mediated vaccination. Infect.Immun. 69(11), 6831-6838 (2001). 169

38

59. Branger C, Chatrenet B, Gauvrit A et al. Protection against Leptospira 170

interrogans sensu lato challenge by DNA immunization with the gene encoding 171

hemolysin-associated protein 1. Infect.Immun. 73(7), 4062-4069 (2005). 172

60. Bloom BR, Fine PEM. The BCG experience: implications for future vaccines 173

against tuberculosis. In: Tuberculosis: Pathogenesis, Protection, and Control. 174

Bloom BR (Eds.). ASM Press, 531-558 (1994) 175

61. Seixas FK, da Silva EF, Hartwig DD et al. Recombinant Mycobacterium bovis 176

BCG expressing the LipL32 antigen of Leptospira interrogans protects hamsters 177

from challenge. Vaccine 26(1), 88-95 (2007). 178

62. Wolff JA, Malone RW, Williams P et al. Direct gene transfer into mouse muscle 179

in vivo. Science 247(4949 Pt 1), 1465-1468 (1990). 180

63. Mor G , Eliza M. Plasmid DNA vaccines. Immunology, tolerance, and 181

autoimmunity. Mol.Biotechnol. 19(3), 245-250 (2001). 182

64. Gurunathan S, Wu CY, Freidag BL, Seder RA. DNA vaccines: a key for 183

inducing long-term cellular immunity. Curr.Opin.Immunol. 12(4), 442-447 184

(2000). 185

65. Gurunathan S, Klinman DM, Seder RA. DNA vaccines: immunology, 186

application, and optimization*. Annu.Rev.Immunol. 18, 927-974 (2000). 187

66. Dai B, Jiang N, Li S et al. [Immunoprotection in guinea pigs using DNA 188

recombinant plasmid rpDJt and expressed protein P68 in L. interrogans serovar 189

lai]. Hua Xi.Yi.Ke.Da.Xue.Xue.Bao. 29(3), 248-251 (1998). 190

39

67. Dai B, You Z, Chen Z, Yan H, Fang Z. Protection against leptospirosis by 191

immunization with plasmid DNA encoding 33 kDa endoflagellin of L. 192

interrogans serovar lai. Chin Med.Sci.J. 15(1), 14-19 (2000). 193

68. Maneewatch S, Tapchaisri P, Sakolvaree Y et al. OmpL1 DNA vaccine cross-194

protects against heterologous Leptospira spp. challenge. Asian Pac.J.Allergy 195

Immunol. 25(1), 75-82 (2007). 196

69. He HJ, Wang WY, Wu ZD, Lv ZY, Li J, Tan LZ. Protection of guinea pigs 197

against Leptospira interrogans serovar Lai by LipL21 DNA vaccine. Cell 198

Mol.Immunol. 5(5), 385-391 (2008). 199

70. Feng CY, Li QT, Zhang XY, Dong K, Hu BY, Guo XK. Immune strategies 200

using single-component LipL32 and multi-component recombinant LipL32-41-201

OmpL1 vaccines against leptospira. Braz.J.Med.Biol.Res. 42(9), 796-803 (2009). 202

71. Gupta RK. Aluminum compounds as vaccine adjuvants. Adv.Drug Deliv.Rev. 203

32(3), 155-172 (1998). 204

72. Gupta RK, Relyveld EH, Lindblad EB, Bizzini B, Ben-Efraim S, Gupta CK. 205

Adjuvants--a balance between toxicity and adjuvanticity. Vaccine 11(3), 293-206

306 (1993). 207

73. Relyveld EH, Bizzini B, Gupta RK. Rational approaches to reduce adverse 208

reactions in man to vaccines containing tetanus and diphtheria toxoids. Vaccine 209

16(9-10), 1016-1023 (1998). 210

74. Faisal SM, Yan W, McDonough SP, Chang CF, Pan MJ, Chang YF. Leptosome-211

entrapped leptospiral antigens conferred significant higher levels of protection 212

40

than those entrapped with PC-liposomes in a hamster model. Vaccine 27(47), 213

6537-6545 (2009). 214

75. Alving CR. Immunologic aspects of liposomes: presentation and processing of 215

liposomal protein and phospholipid antigens. Biochim.Biophys.Acta 1113(3-4), 216

307-322 (1992). 217

76. Gregoriadis G. Immunological adjuvants: a role for liposomes. Immunol.Today 218

11(3), 89-97 (1990). 219

77. Faisal SM, Yan W, McDonough SP, Mohammed HO, Divers TJ, Chang YF. 220

Immune response and prophylactic efficacy of smegmosomes in a hamster 221

model of leptospirosis. Vaccine 27(44), 6129-6136 (2009). 222

78. Faisal SM, Yan W, McDonough SP, Chang YF. Leptospira immunoglobulin-223

like protein A variable region (LigAvar) incorporated in liposomes and PLGA 224

microspheres produces a robust immune response correlating to protective 225

immunity. Vaccine 27(3), 378-387 (2009). 226

79. Eldridge JH, Staas JK, Meulbroek JA, McGhee JR, Tice TR, Gilley RM. 227

Biodegradable microspheres as a vaccine delivery system. Mol.Immunol. 28(3), 228

287-294 (1991). 229

80. Klein SL, Cernetich A, Hilmer S, Hoffman EP, Scott AL, Glass GE. Differential 230

expression of immunoregulatory genes in male and female Norway rats 231

following infection with Seoul virus. J.Med.Virol. 74(1), 180-190 (2004). 232

41

81. Al-Ashy R, Chakroun I, El-Sabban ME, Homaidan FR. The role of NF-kappaB 233

in mediating the anti-inflammatory effects of IL-10 in intestinal epithelial cells. 234

Cytokine 36(1-2), 1-8 (2006). 235

82. Shtrichman R , Samuel CE. The role of gamma interferon in antimicrobial 236

immunity. Curr.Opin.Microbiol. 4(3), 251-259 (2001). 237

83. Chierakul W, de FM, Suputtamongkol Y et al. Differential expression of 238

interferon-gamma and interferon-gamma-inducing cytokines in Thai patients 239

with scrub typhus or leptospirosis. Clin.Immunol. 113(2), 140-144 (2004). 240

42

3. ARTIGO 2

High yield expression of leptospirosis vaccine cand idates LigA and

LipL32 in the methylotrophic yeast Pichia pastoris

(Artigo aceito para publicação no periódico Microbial Cell Factories)

43

High yield expression of leptospirosis vaccine cand idates LigA and

LipL32 in the methylotrophic yeast Pichia pastoris

Daiane D. Hartwig1, Thaís L. Oliveira1, Fabiana K. Seixas1, Karine M. Forster1, Caroline

Rizzi1, Cláudia P. Hartleben1, Alan J. A. McBride2, Odir A. Dellagostin1§

1Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico, Universidade Federal de

Pelotas, Pelotas, RS, Brazil

2Laboratório de Patologia e Biologia Molecular, Instituto Gonçalo Moniz, Fiocruz-BA,

Salvador, BA, Brazil

§Corresponding author: Alan J. A. McBride; Odir A. Dellagostin, Centro de Biotecnologia,

Universidade Federal de Pelotas, Campus Universitário, Caixa Postal 354, CEP 96010-900,

Pelotas, RS, Brazil. Tel. +55 53 3275 7587; Fax +55 53 3275 7551

Email addresses:

DDH: daianehartwig@gmail.com CR: ccrizzi@yahoo.com.br

TLO: thais.larreoliveira@gmail.com CPH: claudia.fernandes@ufpel.tche.br

FKS: seixas.fk@gmail.com AJAM: alanm@bahia.fiocruz.br

KMF: kmacielforster@yahoo.com.br OAD: odir@ufpel.edu.br

44

Abstract

Background

Leptospirosis, a zoonosis caused by Leptospira spp., is recognized as an emergent infectious

disease. Due to the lack of adequate diagnostic tools, vaccines are an attractive intervention

strategy. Recombinant proteins produced in Escherichia coli have demonstrated promising

results, albeit with variable efficacy. Pichia pastoris is an alternative host with several

advantages for the production of recombinant proteins.

Results

The vaccine candidates LigANI and LipL32 were cloned and expressed in P. pastoris as

secreted proteins. Large-scale expression resulted in a yield of 276 mg/L for LigANI and 285

mg/L for LipL32. The recombinant proteins were glycosylated and were recognized by

antibodies present in the sera of patients with severe leptospirosis.

Conclusions

The expression of LigANI and LipL32 in P. pastoris resulted in a significant increase in yield

compared to expression in E. coli. In addition, the proteins were secreted, allowing for easy

purification, and retained the antigenic characteristics of the native proteins, demonstrating

their potential application as subunit vaccine candidates.

45

Background

Leptospira interrogans sensu lato is the causative agent of Leptospirosis, one of the most

widespread zoonotic diseases in the world [1-3]. In Brazil alone there are over 10,000 cases

of leptospirosis reported annually during the epidemics that affect the poor communities in

the major urban centres of Brazil [4]. Mortality ranges from 10-15% in cases of the

traditional Weil’s disease and can be over 70% in cases of severe pulmonary haemorrhage

syndrome (SPHS) and, even with aggressive intervention strategies, mortality remains high

[5-7]. Due to the lack of adequate tools leptospirosis is under-diagnosed, therefore

vaccination remains a viable alternative for the management of this disease. Several groups,

including our own, have demonstrated the use of subunit vaccines against leptospirosis, albeit

with varying degrees of efficacy [8-10], in particular the use of the Leptospiral

immunoglobulin-like (Lig) proteins, LigA and LigB [11-14], and the immunodominant

lipoprotein, LipL32 [15-18].

Escherichia coli has been used extensively as a host for heterologous protein

expression, but potential limitations include the yield, folding and post-translational

modifications of the recombinant protein. An alternative host to E. coli is the methylotrophic

yeast, Pichia pastoris. This yeast strain has emerged as a powerful and inexpensive

expression system for the heterologous production of recombinant proteins with the

following characteristics: (i) techniques for genetic modifications are available; (ii) proteins

may be secreted; (iii) post-translational modification and (iv) high yield, reviewed in [19-21].

We previously expressed the Lig polypeptides, LigANI, LigBNI and LigBrep, in

several E. coli-based expression systems. To date the recombinant proteins were insoluble,

required extensive dialysis during purification and the yield was poor [13]. In this work we

describe the use of the methylotrophic yeast P. pastoris for the cloning, expression,

46

purification and antigenic characterization of the leptospiral vaccine candidates LigANI and

LipL32.

Results

Plasmid construction and sequence analysis

The DNA sequences that encode for the LigA polypeptide, LigANI, (1800 bp) and LipL32

(766 bp) were amplified by PCR and cloned into the P. pastoris expression vector pPICZαB.

Of the 150 P. pastoris colonies screened for expression of each recombinant protein, 30

colonies were strongly recognised by a monoclonal antibody (Mab) specific to the 6×His tag

at the C-terminus of the recombinant proteins. Colony PCR was used to confirm the presence

of the insert in the expression vector and clones exhibiting the highest expression levels were

selected for further expression studies, Figure 1.

Expression of LigANI and LipL32 in P. pastoris

The coding sequences for the recombinant proteins LigANI (rLigANI) and LipL32 (rLipL32)

cloned in pPICZαB were under the control of the AOX1 promoter. In addition, pPICZαB

contains the α-factor signal sequence from S. cerevisiae, allowing secretion of the

recombinant protein. The concentration of rLigANI and rLipL32 in the culture supernatant

was found to increase with time, Figure 2A, and is related with a decrease in the intracellular

concentration of rLigANI, Figure 2B and C. In contrast, while the secretion of rLipL32

increased, so did the intracellular concentration, Figure 2D and E. Recombinant proteins of

the expected size were observed, rLigANI (61 kDa) and rLipL32 (32 kDa), yet there was

evidence of larger proteins, suggesting that the recombinant proteins had been glycosylated

by P. pastoris. Following 196 h induction at 28°C, the concentration of secreted protein

reached 0.93 g/L and 1.2 g/L for rLigANI and rLipL32, respectively. Large-scale (2 L

47

cultures) expression of rLigANI and rLipL32 resulted in yields of 276 mg/L and 285 mg/L,

respectively.

Recombinant protein purification and concentration

The supernatant containing the secreted rLigANI and rLipL32 was collected and

purified/concentrated using three alternative methods. In the first method, the proteins were

purified by ammonium sulphate precipitation. The optimal salt concentration for rLigANI

was 70-80%, while the precipitation of rLipL32 was similar under all concentrations tested.

The recombinant proteins were dialyzed to remove the ammonium sulphate and then

analysed by Western blotting, Figure 3A, B. Once again, there was evidence of post-

translation modification of the recombinant proteins. The yield for both rLigANI and

rLipL32 was similar, approximately 70 mg/L, corresponding to 24.5 and 27.6% of total

protein, respectively. In the second method, the supernatant was concentrated by

ultrafiltration which reduced the starting volume by 97%. The yield for rLigANI was 183

mg/L (66.3% total protein) compared to 106 mg/L (37.3% total protein) for rLipL32. The

samples were observed by 12% SDS-PAGE and compared to recombinant proteins expressed

and purified from E. coli (Figure 3 C). In the third method, the secreted proteins were

concentrated by lyophilisation. There was a 10-fold reduction in the initial sample volume

and the yield was 239 mg/L rLigANI and 224 mg/L rLipL32, equivalent to 86.7 and 70.7%

total protein, respectively.

Deglycosylation of LigANI and LipL32

In an analysis, using Vector NTI Advance 10.0 (Invitrogen) software, of the recombinant

protein amino acid sequences, LigANI was found to have seven potential N-glycosylation

sites, compared to one for LipL32. N-Glycosidase F (PNGase F) removes oligomannose,

48

hybrid, and complex N-glycans attached to asparagine, while Endoglycosidase H (Endo H)

releases oligomannose and hybrid N-glycans, but not complex N-glycans, and were used to

deglycosylate the recombinant proteins. Following deglycosylation, the larger molecular

weight species were no longer evident and the size of the rLigANI and rLipL32 corresponded

to the equivalent protein produced in E. coli, Figure 4. There did not appear to be any

difference in action between the two enzymes used.

Antigenicity of the recombinant LigANI and LipL32 p roteins

The antigenicity of the purified proteins was evaluated by Western blotting with sera from

leptospirosis patients and with rabbit anti-Leptospira hyperimmune sera. The recombinant

proteins LigANI and LipL32 produced in E. coli were included as positive controls. Both

glycosylated and deglycosylated (Endo H and PNGase F treated) rLigANI were recognised

by the human and rabbit immune sera, Figure 5A, C and D, as were the glycosylated and

deglycosylated forms of rLipL32, Figure 5B, C and D.

Discussion

Previous studies have demonstrated the use of the Lig proteins and LipL32 in a range of

formats, including recombinant proteins [11-14], DNA vaccines [17, 22], microspheres and

liposomes [23, 24], fused to a cholera toxin subunit [25] or expressed in M. bovis bacille

Calmette-Guérin [16]. However, vaccine efficacy in the animal models has been highly

variable for these and other Leptospira proteins and they do not induce sterilizing immunity,

reviewed in [26]. Several reports suggest that the most likely explanation for the lack of a

consistent protective effect with recombinant proteins produced in E. coli is the failure of the

proteins to fold correctly [13, 22]. Structural modelling of Lig molecules predicted that the

49

bacterial immunoglobulin-like (Big) repeat domains have a highly folded β-immunoglobulin

sandwich structure [27]. E. coli expressed the full-length LigA at very low levels because of

its high toxicity, which resulted in a 50-fold decrease in viability of cells [28]. Furthermore,

expression of recombinant LigA in the E. coli pET expression system failed [14].

P. pastoris is an important host organism for the production of recombinant proteins

[19]. The large-scale production of recombinant proteins is necessary for pharmaceutical,

biomedical and biotechnological applications, therefore it is important to develop and to

optimize techniques for increased yield of the proteins of interest. In this work we cloned and

expressed a C-terminal fragment of LigA, LigANI, which includes six Big repeat domains of

the LigA protein, in the methylotrophic yeast P. pastoris. In addition, the full-length LipL32

protein was also expressed as a secreted protein. Previously we reported the expression of

recombinant LigANI in E. coli with a yield of 6-10 mg/L [13], while recombinant LipL32

was expressed at 40 mg/L [29]. In this study we report that large-scale expression in P.

pastoris resulted in yields of over 250 mg/L for both rLigANI and rLipL32, without the need

for subsequent solubilisation and/or re-folding steps. The strain used in this study, KM71H,

has a deletion in the AOX1 gene, which is partly replaced by ARG4 from S. cerevisiae and the

phenotype of these strains is MutS (Methanol utilization slow). The use of such strains is

advantageous as they do not require large amounts of methanol in large-scale cultures [19-

21].

Three low-cost purification strategies were evaluated, namely: i) ammonium

sulphate precipitation and desalting by dialysis, ii) ultrafiltration and iii) lyophilisation. The

most significant results in terms of yield were obtained using lyophilisation and ultrafiltration

to purify and/or concentrate the proteins. This is an important observation as these techniques

are applicable to large-scale cultures grown in bioreactors on an industrial scale. During

ultrafiltration the columns used had a cut-off of 30 kDa and our results demonstrated a

50

decreased yield of the rLipL32 protein, possibly due to the fact that the cut-off is very close

to the molecular weight of the recombinant protein. There was a significantly lower yield of

both rLigANI and rLipL32 when purified by ammonium sulphate precipitation.

LigANI and LipL32 were predicted to contain potential N-glycosylation sites and

treatment of the recombinant proteins with the enzymes Endo H and PNGase F confirmed

that post-translational modification had occurred during production and secretion in P.

pastoris, Figure 4. Deglycosylation removed the N-glycans attached to asparagine and when

analysed by SDS-PAGE and Western blotting, rLigANI and rLipL32 had similar molecular

weights as the corresponding proteins expressed in E. coli. N-glycosylation in yeast has a

composition of MannGlcNAc2 (Man: Mannose; GlcNAc: N-acetylglucosamine), where n is

the number of mannose oligosaccharides attached to the structure. This number has been

found to vary in P. pastoris from 3 to 17, depending on the expressed protein [30, 31]. The

attachment of a large number of mannose residues, known as hyperglycosylation, is rarely

observed in P. pastoris, compared to S. cerevisiae which hyperglycosylates the majority of

expressed proteins. Glycosylation can be influenced by some of the bioprocess parameters

used during growth and purification steps [32, 33]. Therefore, secreted proteins that are easily

recovered from the growth medium are likely to maintain the structure of the recombinant

protein. This may improve the protective immune response against leptospirosis when

rLigANI and rLipL32 are used as subunit vaccine candidates.

Conclusions

We believe that this is the first report of the use of P. pastoris to express pathogenic

Leptospira antigens. The aim of the study was to evaluate the large-scale expression of the

vaccine candidates LigA and LipL32 proteins in P. pastoris. The rLigANI and rLipL32

51

proteins described in this study were soluble and the purification step used simple and

inexpensive methods. Indeed, not only were the proteins expressed at a high level, but they

retained the antigenic characteristics of native the proteins. Furthermore, glycosylated

rLigANI and rLpiL32 were recognised by the antibodies presents in the sera of leptospirosis

patients and with antibodies raised against a heterologous Leptospira serovar.

Methods

Bacterial strains and growth conditions

L. interrogans serovar Copenhageni strain Fiocruz L1-130, originally isolated from a patient

with severe leptospirosis [34], was cultivated in Ellinghausen-McCullough-Johnson-Harris

(EMJH) medium supplemented with Leptospira Enrichment EMJH (Difco, USA) at 30 ºC. E.

coli strain TOP10 (Invitrogen) was grown in Luria-Bertani (LB) medium (1% tryptone, 0.5%

yeast extract, 0.5% NaCl and 2% agar) at 37 ºC with the addition of the zeocin 25 µg/mL.

P. pastoris strain KM71H (MutS, Invitrogen) was grown in Yeast extract peptone dextrose

(YPD) medium (1% yeast extract, 2% peptone and 2% D-glucose) supplemented with 100

µg/mL of zeocin at 28 ºC.

Cloning ligA and lipL32

We previously identified a C-terminal fragment of LigA, LigANI, as a vaccine candidate

[13]. Primers to amplify the DNA sequences coding for the LigANI polypeptide and the full-

length lipL32 gene were designed according the genome sequence of L. interrogans serovar

Copenhageni strain Fiocruz L1-130 [GenBank: AE016823]. The primer sequences (EcoRI

and KpnI sites are underlined) used in this study were: ligANI_F: 5'-

CGGAATTCAATAATGTCTGATATTCTTACCGT, ligANI_R: 5'-

TAGGTACCATGGCTCCGTTTTAATAGAG and lipL32_F: 5'-

52

CGGAATTCTAGGTGGTCTGCCAA, lipL32_R: 5'-GGGGTACCACTTAGTCGCGTCA.

The PCR products were cloned in-frame into the pPICZαB vector (Invitrogen, Brazil). The

identity of the inserts was determined by DNA sequencing using the DYEnamic ET Dye

Terminator Cycle Sequencing Kit for MegaBACE DNA Analysis Systems – MegaBACE 500

(GE Healthcare, Brazil). Recombinant plasmids containing the LigANI coding sequence,

pPIC-LigANI, and lipL32, pPIC-LipL32, were propagated in E. coli TOP10, and the

plasmids isolated using the Perfectprep Plasmid Maxi kit (Eppendorf, USA). The plasmids

were linearized with restriction enzyme PmeI (New England BioLabs, USA). The linear

plasmid DNA was purified by phenol-chloroform extraction and DNA precipitation. P.

pastoris competent cells were transformed by electroporation (25 µF, 200 Ω, 2 kV) with 10

µg of linear plasmid DNA.

Screening for expression of recombinant LigANI and LipL32

Approximately 150 colonies of each plasmid construct were plated onto Buffered methanol-

complex medium (BMMY: 1% yeast extract, 2% peptone, 1.34% yeast nitrogen base,

0.00004% biotin, 0.5% methanol, 100 mM potassium phosphate and 2% agar, pH 6.0).

Following 24, 48 and 72 h incubation at 28ºC, expression of rLigANI and rLipL32 was

induced with 1% methanol and evaluated after 96 h. Expression of the recombinant proteins

was confirmed by colony immunoblotting [35]. Briefly, a nitrocellulose membrane (Hybond

ECL, GE Healthcare) was placed onto the surface of each petri dish and in direct contact with

the colonies for 3 h at 28°C. Any adherent matter was removed from the membrane by

washing with PBST (PBS, pH 7.4, 0.05% (v/v) Tween 20). After blocking (PBST, 5% non-

fat dried milk), the membrane was incubated for 1 h at room temperature with anti-6×His-

peroxidase conjugate (Sigma-Aldrich, Brazil) at a dilution of 1:8,000 in PBS. After three

53

washes (5 min each) positive colonies were detected with 4-chloro-1-naphthol (Sigma-

Aldrich).

The presence of the PCR products in the recombinant plasmids was also confirmed

by colony PCR. Crude genomic DNA extracts were prepared by boiling selected yeast

recombinant clones in water. PCR was performed as described above, using the crude

genomic DNA extracts as template. PCR products were analysed by horizontal gel

electrophoresis and visualized with GelRed (Uniscience, Brazil).

Expression of LigANI and LipL32 proteins in P. pastoris KM71H

A recombinant clone for each construct (rLigANI and rLipL32), positive for expression and

colony PCR, was selected and inoculated into a 1 L baffled flask containing 200 mL BMGY

broth (differs from BMMY in that the 1% methanol is replaced by 1% glycerol). The cultures

were incubated at 28°C, with shaking (250 rpm), for approximately 16–18 h until an OD600 of

2 to 6 was reached. The cells were harvested by centrifugation at 3,000 × g for 5 min and the

cell pellet suspended in the supernatant in 1/10 of the original volume (20 mL). The culture

was place in a 100 mL baffled flask and return to the incubator. Expression was induced by

the addition of methanol to a final concentration of 0.5%. Samples (supernatant and cells)

were collected at the following time points: 0, 24, 48, 72, 96, 120, 144, 168 and 196 h and

stored at –80°C. The cell pellets were suspended in breaking buffer (50 mM sodium

phosphate, 1 mM PMSF, 1 mM EDTA and 5% glycerol) and an equal volume of acid-

washed glass beads (0.5 mm Ø). The samples were vortexed for 30 s followed by incubation

on ice for 30 s (8 cycles), centrifuged at 16,000 × g for 10 min at 4 ºC and the cleared

supernatant stored at –80°C.

The expression of the recombinant proteins were analysed by (12%) sodium dodecyl

sulphate-polyacrylamide gel electrophoresis (SDS–PAGE) and visualised by staining with

54

Coomassie Blue or Western blotting (WB). Samples were suspended in loading buffer (2%

SDS, 500 mM Tris pH 7.6, 1% bromophenol blue, 50% glycerol and 1% 2-mercaptoethanol)

and boiled for 10 min before separation by SDS-PAGE. For the WB assay the proteins were

electro transferred to a nitrocellulose membrane (Hybond ECL, GE Healthcare). After

blocking, PBS, 5% non-fat dried milk, overnight at 4ºC and three washes (5 min per wash) in

PBS-T, the membranes were incubated for 1 h with anti-LipL32 Mab (1:500 in PBS) or

mouse anti-LigANI polyclonal (1:500 in PBS), followed by 3 washes (5 min per wash) in

PBS-T. The rabbit anti-mouse IgG peroxidase conjugate (Sigma-Aldrich), diluted 1:6,000 in

PBS, was added and incubated for 1 h. The membranes were washed 5× in PBS-T and the

reactions were developed with 4-chloro-1-naphthol (Sigma-Aldrich).

LigANI and LipL32 were produced in large-scale using the P. pastoris MutS

secretory phenotype prior to purification, about the same conditions described above. Briefly,

P. pastoris was grown in BMGY medium (2 L) to an OD600 of 2 to 6, harvested by

centrifugation and suspended in BMMY expression medium in 1/10 of the original culture

volume (200 mL). The expression of the recombinant proteins was induced for 144 h with

methanol 0.5%. The supernatant containing the secreted recombinant proteins was cleared by

centrifugation, and stored at –80°C.

Purification and concentration of rLigANI and rLipL 32

Three different strategies were used to purify and concentrate the secreted recombinant

proteins. The first strategy was based on ammonium sulphate precipitation: 85% ammonium

sulphate was added to the culture supernatant at 4°C, to final concentrations of: 25, 35, 45,

60, 70 and 80%. The precipitated proteins were collected by centrifugation at 10,000 × g for

15 min at 4°C and suspended in PBS and dialyzed in the same buffer for 48 h. Microcon YM-

30 Amicon Bioseparation filters (Millipore, USA), 30 kDa cut-off, were used to concentrate

55

the recombinant proteins expressed in the supernatant, following the manufacturer’s protocol.

Alternatively, proteins were concentrated by lyophilisation (Edwards Micro Modulyo) over

28 h and suspended in PBS, resulting in a concentration 10-fold of the initial sample. The

protein concentration in culture supernatants, concentrate and purified proteins samples were

determined by BCA Protein Assay Kit (Pierce, USA) with bovine serum albumin (BSA) as a

the standard.

Deglycosylation of rLigANI and rLipL32

Purified rLigANI and rLipL32 (1-20 µg) were incubated with 1× glycoprotein reaction buffer

at 100°C for 10 min to completely denature the glycoproteins. Deglycosylation was carried

out at 37°C for 1 h with 5× G5 (Endoglycosidase H) or 10× G7 (N-Glycosidase F) reaction

buffer and 1-5 µl of the relevant enzyme (Endoglycosidase H or N-Glycosidase F) according

to the manufacturer’s instructions (New England BioLabs).

Antigenicity of rLigANI and rLipL32

The ability of the recombinant proteins to interact specifically with products of the immune

response was determined by WB using sera collected from leptospirosis patients and

hyperimmune sera from infected rabbits. The use of subject sera for these experiments was

approved by the Internal Review Board of the Gonçalo Moniz Institute, Fiocruz-BA. A pool

of convalescent sera from severe leptospirosis patients was used at a dilution of 1:300 and an

anti-human IgG peroxidase conjugate at a 1:2,000 dilution. Rabbit anti-Leptospira

hyperimmune sera, specific to L. interrogans serovar Canicola strain Tande, was used at a

dilution of 1:500 and an anti-rabbit IgG peroxidase conjugate at a 1:3,000 dilution.

Competing interests

56

AJAM and OAD are inventors on a patent submission entitled: LigA and LigB proteins

(Leptospiral Ig-like (Lig) domains) for vaccination and diagnosis (Patent nos. BRPI0505529

and WO 2007070996). The other authors declare no competing interests.

Authors’ Contributions

DDH participated in the study design, performed the experiments and in the writing of the

manuscript. TLO performed the experiments. FKS participated in the construction of the

plasmids. KMF and CPH participated in the experiments on protein antigenicity and CR

participated in the protein purification steps. AJAM participated in the data analysis and the

writing of the manuscript. OAD coordinated the study and participated in the writing of the

manuscript. All authors read and approved the final manuscript.

Acknowledgements

This work was supported by the Brazilian National Research Council (CNPq), grant

475540/2008-5, the Research Support Foundation for the State of Bahia (FAPESB), grant

PES-0092/2008 (to AJAM) and the Oswaldo Cruz Foundation (to AJAM). DDH and KMF

received scholarships from CNPq. The funders had no role in study design, data collection

and analysis, decision to publish, or preparation of the manuscript.

57

References

1. Bharti AR, Nally JE, Ricaldi JN, Matthias MA, Diaz MM, Lovett MA, Levett PN,

Gilman RH, Willig MR, Gotuzzo E et al: Leptospirosis: a zoonotic disease of global

importance. Lancet Infect Dis 2003, 3(12):757-771.

2. Adler B, de la Pena Moctezuma A: Leptospira and leptospirosis. Vet Microbiol

2010, 140(3-4):287-296.

3. Faine SB, Adler B, Bolin C, Perolat P: Leptospira and leptospirosis, 2nd edn.

Melbourne: MediSci; 1999.

4. Reis RB, Ribeiro GS, Felzemburgh RD, Santana FS, Mohr S, Melendez AX, Queiroz

A, Santos AC, Ravines RR, Tassinari WS et al: Impact of environment and social

gradient on leptospira infection in urban slums. PLoS Negl Trop Dis 2008,

2(4):e228.

5. McBride AJ, Athanazio DA, Reis MG, Ko AI: Leptospirosis. Curr Opin Infect Dis

2005, 18(5):376-386.

6. Gouveia EL, Metcalfe J, de Carvalho AL, Aires TS, Villasboas-Bisneto JC, Queirroz

A, Santos AC, Salgado K, Reis MG, Ko AI: Leptospirosis-associated Severe

Pulmonary Hemorrhagic Syndrome, Salvador, Brazil. Emerg Infect Dis 2008,

14(3):505-508.

7. Segura ER, Ganoza CA, Campos K, Ricaldi JN, Torres S, Silva H, Cespedes MJ,

Matthias MA, Swancutt MA, Lopez Linan R et al: Clinical spectrum of pulmonary

involvement in leptospirosis in a region of endemicity, with quantification of

leptospiral burden. Clin Infect Dis 2005, 40(3):343-351.

58

8. Haake DA, Mazel MK, McCoy AM, Milward F, Chao G, Matsunaga J, Wagar EA:

Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic

immunoprotection. Infect Immun 1999, 67(12):6572-6582.

9. Yan W, Faisal SM, McDonough SP, Chang CF, Pan MJ, Akey B, Chang YF:

Identification and characterization of OmpA-like proteins as novel vaccine

candidates for Leptospirosis. Vaccine 2010, 28(11):2277-2283.

10. Wang Z, Jin L, Wegrzyn A: Leptospirosis vaccines. Microb Cell Fact 2007, 6:39.

11. Koizumi N, Watanabe H: Leptospiral immunoglobulin-like proteins elicit

protective immunity. Vaccine 2004, 22(11-12):1545-1552.

12. Yan W, Faisal SM, McDonough SP, Divers TJ, Barr SC, Chang CF, Pan MJ, Chang

YF: Immunogenicity and protective efficacy of recombinant Leptospira

immunoglobulin-like protein B (rLigB) in a hamster challenge model. Microbes

Infect 2009, 11(2):230-237.

13. Silva EF, Medeiros MA, McBride AJ, Matsunaga J, Esteves GS, Ramos JG, Santos

CS, Croda J, Homma A, Dellagostin OA et al: The terminal portion of leptospiral

immunoglobulin-like protein LigA confers protective immunity against lethal

infection in the hamster model of leptospirosis. Vaccine 2007, 25(33):6277-6286.

14. Palaniappan RU, McDonough SP, Divers TJ, Chen CS, Pan MJ, Matsumoto M,

Chang YF: Immunoprotection of recombinant leptospiral immunoglobulin-like

protein A against Leptospira interrogans serovar Pomona infection. Infect Immun

2006, 74(3):1745-1750.

15. Feng CY, Li QT, Zhang XY, Dong K, Hu BY, Guo XK: Immune strategies using

single-component LipL32 and multi-component recombinant LipL32-41-OmpL1

vaccines against leptospira. Braz J Med Biol Res 2009, 42(9):796-803.

59

16. Seixas FK, da Silva EF, Hartwig DD, Cerqueira GM, Amaral M, Fagundes MQ,

Dossa RG, Dellagostin OA: Recombinant Mycobacterium bovis BCG expressing

the LipL32 antigen of Leptospira interrogans protects hamsters from challenge.

Vaccine 2007, 26(1):88-95.

17. Branger C, Chatrenet B, Gauvrit A, Aviat F, Aubert A, Bach JM, Andre-Fontaine G:

Protection against Leptospira interrogans sensu lato challenge by DNA

immunization with the gene encoding hemolysin-associated protein 1. Infect

Immun 2005, 73(7):4062-4069.

18. Sonrier C, Branger C, Michel V, Ruvoen-Clouet N, Ganiere JP, Andre-Fontaine G:

Evidence of cross-protection within Leptospira interrogans in an experimental

model. Vaccine 2000, 19(1):86-94.

19. Sorensen HP: Towards universal systems for recombinant gene expression.

Microb Cell Fact 2010, 9:27.

20. Cos O, Ramon R, Montesinos JL, Valero F: Operational strategies, monitoring and

control of heterologous protein production in the methylotrophic yeast Pichia

pastoris under different promoters: a review. Microb Cell Fact 2006, 5:17.

21. Cregg JM, Cereghino JL, Shi J, Higgins DR: Recombinant protein expression in

Pichia pastoris. Mol Biotechnol 2000, 16(1):23-52.

22. Faisal SM, Yan W, Chen CS, Palaniappan RU, McDonough SP, Chang YF:

Evaluation of protective immunity of Leptospira immunoglobulin like protein A

(LigA) DNA vaccine against challenge in hamsters. Vaccine 2008, 26(2):277-287.

23. Faisal SM, Yan W, McDonough SP, Chang YF: Leptospira immunoglobulin-like

protein A variable region (LigAvar) incorporated in liposomes and PLGA

microspheres produces a robust immune response correlating to protective

immunity. Vaccine 2009, 27(3):378-387.

60

24. Faisal SM, Yan W, McDonough SP, Chang CF, Pan MJ, Chang YF: Leptosome-

entrapped leptospiral antigens conferred significant higher levels of protection

than those entrapped with PC-liposomes in a hamster model. Vaccine 2009,

27(47):6537-6545.

25. Habarta A, Abreu PA, Olivera N, Hauk P, Cedola MT, Ferrer MF, Ho PL, Gomez

RM: Increased Immunogenicity to LipL32 of Leptospira interrogans when

Expressed as a Fusion Protein with the Cholera Toxin B Subunit. Curr Microbiol

2010, Aug 19. [Epub ahead of print]

26. Ko AI, Goarant C, Picardeau M: Leptospira: the dawn of the molecular genetics

era for an emerging zoonotic pathogen. Nat Rev Microbiol 2009, 7(10):736-747.

27. Matsunaga J, Barocchi MA, Croda J, Young TA, Sanchez Y, Siqueira I, Bolin CA,

Reis MG, Riley LW, Haake DA et al: Pathogenic Leptospira species express

surface-exposed proteins belonging to the bacterial immunoglobulin

superfamily. Mol Microbiol 2003, 49(4):929-945.

28. Palaniappan RU, Chang YF, Jusuf SS, Artiushin S, Timoney JF, McDonough SP,

Barr SC, Divers TJ, Simpson KW, McDonough PL et al: Cloning and molecular

characterization of an immunogenic LigA protein of Leptospira interrogans.

Infect Immun 2002, 70(11):5924-5930.

29. Seixas FK, Fernandes CH, Hartwig DD, Conceicao FR, Aleixo JA, Dellagostin OA:

Evaluation of different ways of presenting LipL32 to the immune system with

the aim of developing a recombinant vaccine against leptospirosis. Can J

Microbiol 2007, 53(4):472-479.

30. Daly R, Hearn MT: Expression of heterologous proteins in Pichia pastoris: a

useful experimental tool in protein engineering and production. J Mol Recognit

2005, 18(2):119-138.

61

31. Montesino R, Garcia R, Quintero O, Cremata JA: Variation in N-linked

oligosaccharide structures on heterologous proteins secreted by the

methylotrophic yeast Pichia pastoris. Protein Expr Purif 1998, 14(2):197-207.

32. Goochee CF, Monica T: Environmental effects on protein glycosylation.

Biotechnology (N Y) 1990, 8(5):421-427.

33. Jenkins N, Parekh RB, James DC: Getting the glycosylation right: implications for

the biotechnology industry. Nat Biotechnol 1996, 14(8):975-981.

34. Ko AI, Galvao Reis M, Ribeiro Dourado CM, Johnson WD, Jr., Riley LW: Urban

epidemic of severe leptospirosis in Brazil. Salvador Leptospirosis Study Group.

Lancet 1999, 354(9181):820-825.

35. Sambrook J, Russell DW: Molecular Cloning: A Laboratory Manual, 3rd edn.

Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 2000.

62

Figure legends

Figure 1 - Screening for P. pastoris recombinant clones expressing rLigANI and

rLipL32.

Colony blot analysis of transformed P. pastoris strain KM71H with anti-6×His Mab. The tgD

recombinant protein expressed in P. pastoris KM71H was the positive control (+) and

untransformed P. pastoris KM71H was the negative control (–). Spots 1-7 are representative

rLigANI colonies and 8-12 are representative rLipL32 colonies. Arrows indicate the colonies

that were selected for large-scale expression studies.

Figure 2 - Expression of rLigANI and rLipL32 protei ns in P. pastoris.

Time courses for the expression of secreted rLigANI and rLipL32 by P. pastoris induced for

up to 192 hours (8 days), (A) as determined by protein concentration (mg/mL). Western blot

analysis of the intracellular (pellet) and secreted (supernatant) expression of rLigANI (B and

C, respectively) and rLipL32 (D and E, respectively), using polyclonal anti-LigANI sera or

anti-LipL32 Mab. Samples (cells and supernatant) were collected at the various hourly time

points indicated. KM – negative control: untransformed P. pastoris KM71H culture.

Figure 3 - Purification of rLigANI and rLipL32 expr essed in P. pastoris.

Recombinant proteins purified by precipitation with ammonium sulphate or by ultrafiltration.

Ammonium sulphate precipitated proteins were detected by Western blotting with (A)

polyclonal anti-LigANI sera or (B) an anti-LipL32 Mab. The effect of the various

concentrations of ammonium sulphate (expressed as percentage values) on the precipitation

of the recombinant proteins is displayed. (C) Affinity chromatography purified recombinant

LigANI (61 kDa) and LipL32 (32 kDa) produced in E. coli compared to purification by

63

ultrafiltration of rLigANI and rLipL32 secreted by P. pastoris. An equal volume (10 µL) of

both proteins was loaded on the gel.

Figure 4 - Deglycosylation of rLigANI and rLipL32 p roduced by P. pastoris.

To evaluate the post-translational modification of the rLigANI and rLipL32 proteins

produced and secreted by P. pastoris, the proteins were deglycosylated with PNGase F and

Endo H. The resultant proteins were visualized by (A) Western blotting with polyclonal anti-

LigANI sera and an anti-LipL32 Mab or by (B) SDS-PAGE stained with Coomassie blue.

The proteins were digested with PNGase F, Endo H or without enzyme (-). E-LigANI (61

kDa) and E-LipL32 (32 kDa) recombinant proteins were expressed and purified from E. coli.

Figure 5 - Antigenicity of the various forms of rLi gANI and rLipL32.

Antigenicity was evaluated using rabbit anti-Leptospira sera (A) Lanes: 1 - rLigANI +

PNGase F; 2 - rLigANI + Endo H; 3 - glycosylated rLigANI and (B) Lanes: 4 - rLipL32 +

PNGase F; 5 - rLipL32 + Endo H; 6 – glycosylated rLipL32 or (C) convalescent sera from

leptospirosis patients, Lanes: 1 - glycosylated rLipL32; 2 - glycosylated rLigANI and (D) 3 –

rLipL32 + PNGAse F; 4 – LipL32 + Endo H; 5 - rLigANI + PNGAse F; 6 - rLigANI + Endo

H. E-LigANI (61 kDa) and E-LipL32 (32 kDa) recombinant proteins were expressed and

purified from E. coli.

64

Figure 1

(+) 1 2 (-)

3 4 5 6 7

8 9 10 11 12

65

Figure 2

0h 24h 48h 72h 96h 120h 144h KM

0h 24h 48h 72h 96h 120h 144h KM

B

C

D

E

61 kDa

61 kDa

32 kDa

32 kDa

0h 24h 48h 72h 96h 120h 144h KM

0h 24h 48h 72h 96h 120h 144h KM

A

66

Figure 3

E-LipL32 25% 35% 45% 60% 70% 80%

32 kDa

61 kDa

B

E-LigANI 25% 35% 45% 60% 70% 80% A

E-LigANI E-LipL32 rLigANI rLipL32 E. coli P. pastoris

C

32 kDa

61 kDa 61 kDa

32 kDa

67

Figure 4

PNGase F Endo H ( - ) E-LigANI PNGase F Endo H ( - ) E-LipL32

PNGase F Endo H ( - ) E-LigANI PNGase F Endo H ( - ) E-LipL32

A

B

61 kDa 32 kDa

61 kDa 32 kDa

68

Figure 5

LigANI

1 2 3 E-LigANI 4 5 6 E-LipL32

61 kDa

E-rLipL32 E-LigANI 1 2 3 4 5 6

61 kDa

32 kDa

A

C

B

D

LipL32

32 kDa

32 kDa

61 kDa

rLipL32 rLigANI

69

4. ARTIGO 3

Immunoprotection by LigA and LipL32 produced in Pichia pastoris

and evaluated in the hamster model of lethal leptospirosis

(Artigo a ser submetido ao periódico Clinical and Vaccine Immunology)

70

Immunoprotection by LigA and LipL32 produced in Pichia pastoris and evaluated in

the hamster model of lethal leptospirosis

Running title: P. pastoris recombinant LigA and LipL32 protection in hamsters

Daiane D. Hartwig1, Karine M. Forster1, Thaís L. Oliveira1, Fabiana K. Seixas1, Marta

Amaral2, Alan J. A. McBride3 and Odir A. Dellagostin1*

1Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico, Universidade Federal de

Pelotas, Pelotas, RS, Brazil

2Instituto de Biologia, Universidade Federal de Pelotas, Pelotas, RS, Brazil

3Laboratório de Patologia e Biologia Molecular, Instituto Gonçalo Moniz, Fiocruz-BA,

Salvador, BA, Brazil

*Corresponding author: Odir A. Dellagostin, Centro de Biotecnologia, Universidade

Federal de Pelotas, Campus Universitário, Caixa Postal 354, CEP 96010-900, Pelotas, RS,

Brazil. Tel. +55 53 3275 7587; Fax +55 53 3275 7551

71

ABSTRACT

Leptospirosis is a widespread zoonosis of great importance to public health,

particularly in developing countries. A priority in research on leptospirosis is the

development of a vaccine able to elicit long-term immunity and to induce cross-protection

against the most common pathogenic Leptospira serovars. Several antigens of Leptospira

interrogans produced in Escherichia coli for use as subunit vaccines have demonstrated

promising results, but have presented with variable efficacy and low yield. The expression of

recombinant proteins in the methylotrophic yeast, Pichia pastoris, is relatively fast and

inexpensive. In addition, for purposes of vaccination, yeast recombinant proteins have been

shown to have natural adjuvant activity. In this study, we evaluated LigANI, which

corresponds to the six carboxy-terminal repeat domains of LigA, and the lipoprotein LipL32,

produced in P. pastoris. Both recombinant proteins induced significant immune humoral

responses in hamsters (P < 0.001), evaluated by ELISA. The LigANI vaccine preparation

significantly improved survival (P < 0.001) in hamsters challenged with 5×LD50 of L.

interrogans serovar Copenhageni. These results demonstrate that the large-scale production

of LigANI by P. pastoris shows potential as a potential vaccine candidate but requires further

development.

KEYWORDS: Leptospirosis, Vaccine, Pichia pastoris; Leptospira interrogans; LigA

protein; LipL32 protein; immunoprotection; hamster challenge model.

72

INTRODUCTION

Vaccination strategies remain the principal tool for the prevention of many infectious

diseases, including Leptospirosis. Pathogenic Leptospira spp. cause this zoonotic disease, one

of the most common in the world (1,2,29,39). In developed countries leptospirosis is an

emerging infectious disease associated with sporting events, tourism and recreational

activities, while in developing countries it is linked to poverty and poor sanitation. Globally,

more than 500,000 cases are reported each year (1,29). Severe infection is associated with a

mortality of 10-15% in cases of the traditional Weil’s disease and can be over 70% in cases

of severe pulmonary haemorrhage syndrome (SPHS) (15,29,35). In livestock, Leptospira

infection is associated with abortion, stillbirth, milk drop syndrome and occasionally death

(16).

However, an efficient vaccine with cross-protection against the different pathogenic

serovars remains a challenge. Efforts to develop recombinant leptospiral vaccines have

therefore focused on outer membrane proteins (OMP) (10,17,22). The Leptospiral

immunoglobulin-like (Lig) proteins, LigA, LigB and LigC, belong to a family of bacterial

immunoglobulin-like (Big) repeat domain proteins. They encode virulence determinants in

pathogenic strains (8,24,28,31), and are highly conserved (70–99 % identity) in

pathogenic Leptospira isolates (30). Several independent studies have evaluated these

proteins as potential vaccine candidates, with varying degrees of efficacy

(12,14,21,32,37,40). The lipoprotein LipL32, also known as haemolysis-associated protein 1

(Hap1) (4), is described as the most abundant OMP exposed on the surface of the cell (11).

The lipL32 coding sequence is specific to the pathogenic Leptospira spp. (18). When this

protein was delivered as DNA vaccine, adenovirus mediated-vaccination or in a recombinant

Mycobacterium bovis BCG strain, it provided significant protection in gerbils or hamsters.

73

However, it failed to induce a protective immune response when used as recombinant subunit

vaccine (3,4,36).

Our group recently described the high yield expression of the LigANI (rLigANI) and

LipL32 (rLipL32) proteins by the methylotrophic yeast Pichia pastoris, using simple and

inexpensive expression and purification methods (20). This eukaryotic expression system is

used as a host for industrial production of recombinant proteins, has advantages such as high

and efficient expression of heterologous proteins that can be secreted into medium and

growth at high density in bioreactors (6,9,26). P. pastoris harbouring an expression vector

can efficiently secrete heterologous protein in the correctly folded, soluble and biologically

active form (34). The rLigANI and rLipL32 proteins secreted by P. pastoris were

glycosylated with the addition of mannose residues. In this study, we evaluated the specific

humoral immune response against rLigANI and rLipL32, expressed by P. pastoris, and their

efficacy as potential vaccine candidates in the hamster model of lethal leptospirosis.

MATERIALS AND METHODS

Bacterial strains and growth conditions. A virulent pathogenic L. interrogans serovar

Copenhageni strain FORSTER/CDTEC (unpublished data) was cultivated in Ellinghausen-

McCullough-Johnson-Harris (EMJH) medium supplemented with Leptospira Enrichment

EMJH (Difco, USA) at 30 ºC. Pichia pastoris strain KM71H MutS phenotype (Invitrogen,

Brazil) was grown in Yeast Extract Peptone Dextrose (YPD) medium (1% yeast extract, 2%

peptone and 2% D-glucose) at 30 ºC supplemented with 100 µg/ml of zeocin.

Experimental animals. Golden Syrian hamsters were housed at the animal facility of the

Biotechnology Centre, Federal University of Pelotas (UFPel). The animals were maintained

74

in accordance with the guidelines of the Ethics Committee in Animal Experimentation of

UFPel throughout the experimental period.

Production of the LigANI and LipL32 recombinant proteins in P. pastoris. The

expression of rLigANI and rLipL32 MutS secretory phenotype was performed using the

eukaryotic system based in P. pastoris, as described previously (20). Briefly, the recombinant

clones were grown in a baffled flask containing 2 L of BMGY broth (1% yeast extract, 2%

peptone, 1.34% yeast nitrogen base, 0.00004% biotin, 1% glycerol, 100 mM potassium

phosphate and 2% agar, pH 6.0). The cultures were incubated at 28°C until an OD600 of 2 to 6

was reached. The cells were harvested by centrifugation at 3,000 g for 5 min and the cell

pellet was resuspended in the BMMY broth (differs from BMGY in that the 1% glycerol is

replaced by 1% methanol) to 1/10 of the original volume (0.2 L). The culture was place in a 1

L baffled flask and return to the incubator. Maximum yield achieved by the addition of

methanol to a final concentration of 0.5% for 144 h. The Microcon YM-30 Amicon

Bioseparations (Millipore) were used to concentrate the recombinant proteins expressed in

the supernatant, following manufacturer’s protocol. The recombinant proteins were analysed

by (12%) sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS–PAGE) and

visualized by staining with Coomassie Blue and Western blotting (WB). The LigANI and

LipL32 recombinant proteins concentration were determined by BCA Protein Assay Kit

(Pierce, USA) method using bovine serum albumin (BSA) as a standard.

Immunization and hamsters challenge experiments. Female hamsters, 4 - 6 weeks of age,

were used in all experiments. Animals were divided into groups of 12 animals, food and

water were provided ad libitum. Animals were immunized with rLigANI (80 µg) or rLipL32

(80 µg) together with 15% aluminium hydroxide adjuvant by intramuscular injection in the

75

hind legs twice, at 14 day intervals. Blood samples were collected through the retro-orbital

plexus before each immunization and challenge, the sera was collected and stored at −20ºC.

Twenty-eight days after the first dose all hamsters were challenged intraperitoneally with a

dose of 101 leptospires, equivalent to 5× LD50 of the L. interrogans serovar Copenhageni

strain FORSTER/CDTEC (unpublished data). The negative control group was inoculated

with phosphate buffered saline (PBS) + 15% aluminium hydroxide, the positive control group

was immunized with a bacterin vaccine consisting of 109 heat-killed whole-leptospires, as

previously described (36). Hamsters were monitored daily for clinical signs of leptospirosis

and euthanized when clinical signs of terminal disease appeared.

Evaluation of the humoral immune response. Antibody responses were monitored by an

indirect ELISA using rLigANI and rLipL32. ELISA plates (Polysorp Surface, Nunc) were

coated overnight at 4°C with 200 ng of recombinant protein per well, diluted in carbonate-

bicarbonate buffer pH 9.6. The plates were washed three times in PBS (pH 7.4) with 0.05%

(v/v) Tween 20 (PBST) and incubated with 200 µl of 5% blocking buffer, at 37ºC for 1 h.

The hamster sera, diluted 1:50, was added and the plate incubated for 1 h at 37ºC, followed

by three washes with PBST. Goat anti-hamster IgG peroxidase conjugate, 1:8,000 dilution,

(Serotec, USA) was added and incubated at 37ºC for 1 h, washed 5× with PBST and the

reaction visualized with o-phenylenediamine dihydrochloride (Sigma-Aldrich, Brazil) and

hydrogen peroxide. The reaction was stopped by the addition of 0.1 M sulphuric acid and

absorbance was determined at 492 nm using a Multiskan MCC/340 ELISA reader (Titertek

Instruments, USA). Mean values were calculated from sera samples assayed in triplicate.

Culture and histopathology analysis. Surviving hamsters on day 30 post challenge were

euthanized. Kidney and lung tissues were harvested post-euthanasia and studied for

76

histopathology. Sterilizing immunity was determined by culture isolation of leptospires from

kidney samples. From each organ 1 - 2 g of tissue was aseptically removed, processed and

transferred to 5 mL of EMJH medium (pH 7.2). Dark-field microscopy was performed during

8-week incubation period to identify positive cultures. For histopathological studies, kidney

and lung tissues samples were fixed in 10% formalin (pH 7.0) and embedded in paraffin. Six

sections of 5 - 6 µm thickness from organs were stained with haematoxylin and eosin and

examined by a qualified pathologist for evidence of interstitial nephritis or pulmonary

haemorrhage.

Imprint detection. The presence of leptospires in the kidneys of immunized hamster was

evaluated by the imprint method (7). Briefly, imprints were obtained by direct pressure of the

cut surface of the tissue sample onto poly-L-lysine-coated glass slides. Imprint slides were

dried at room temperature, fixed in methanol (10 min at 4ºC) and incubated for 30 min in a

dark humid chamber at 30°C. After three washes with 10% bovine foetal serum (BFS) diluted

in PBS, a Mab against LipL32 (1D9), diluted 1:100, was added and incubated in a dark

humid chamber at 30°C (1 h). The imprints were incubated (1 h) under the same conditions

with an anti-Leptospira FITC conjugate, diluted 1:100, after three washes with PBS + 10%

BSF. Nucleic acids were visualized by counterstaining with Hoestch, diluted 1:10, for 30 min

at 30oC in a dark humid chamber. Following five washes with PBS + 10% BSF, mounting

medium was added and a cover slip was sealed in place with acrylic. Staining was visualized

by fluorescence microscopy (Olympus) at an excitation wavelength of 450 nm.

Statistical analysis. Variance analysis was used to determine significant differences between

the assay results. The Fisher exact test and the Wilcoxon log-rank test were used to determine

significant differences for mortality and survival, respectively, using Epi Info 6 (Centres for

77

Disease Control, USA) and Prism 5 (Graphpad, USA), differences were considered

significant at P < 0.05.

RESULTS

Expression of rLigANI and rLipL32 in P. pastoris. The 61 kDa and 32 kDa bands which

corresponded to rLigANI and rLipL32, respectively, were secreted by P. pastoris after

methanol induction and visualized in SDS-PAGE (Fig. 1 A and B). There was evidence of

larger proteins, because the recombinant proteins had been glycosylated by P. pastoris. The

recombinant proteins accumulated in the culture medium during 144 h of methanol induction

and were purified by ultrafiltration for use in hamster immunoprotection assays.

Humoral immune response elicited by recombinant proteins in hamsters. Twenty-eight

days after the first immunization, the hamsters were challenged with a virulent strain of L.

interrogans serovar Copenhageni. Hamsters immunized with rLigANI, rLipL32 and

aluminium hydroxide gained weight during the 28 days post-immunization, reaching and

average of 92.24 ± 2.70 g. To quantify the specific antibody response, an ELISA was

performed with the sera collected on days 0, 14 and 28 post-immunization (pi) (Fig. 2).

Significant levels of circulating IgG antibodies were detected (P < 0.001). Fourteen days after

the first dose with rLipL32 there was a significant (P < 0.001) induction of IgG levels in the

hamster immunized compared to the negative control group (PBS/aluminium hydroxide).

However, the IgG level in those hamsters immunized with rLigANI did not differ from the

negative control group at\ 14 days. In the twenty-eight days after the first dose was observed

difference (P < 0.001) between the three groups (rLigANI, rLipL32 and aluminium

hydroxide), Fig. 2.

78

Immunoprotection of hamsters immunized with rLigANI and rLipL32. Female hamsters

were challenged with 101 leptospires (5 × LD50 for female hamsters) 28 days after the first

immunization and mortality was determined for up to 30 days post-challenge. Of the

hamsters immunized with 2× 80 µg of rLigANI in aluminium hydroxide, 25% (3/12) were

protected against lethal challenge (Table 1) however, this was not significant, P = 0.22, in

terms of mortality (Fisher exact test). Nonetheless, immunization with rLigANI significantly

improved survival (Wilcoxon Log-rank test) compared to the negative control group, P <

0.001. Median survival in the negative control group was nine days compared to 17.5 days in

the rLigANI group (Fig. 3). Immunization with rLipL32 failed to induce protection in the

hamster model (Table 1 and Fig. 3). However, survival in hamsters immunized with rLipL32

was significant compared to the control group, P < 0.001 (Wilcoxon Log-rank test). Median

survival in the negative control group was nine days compared to 12 days in the rLipL32

group. All hamsters in the positive control group (Table 1, Fig. 3) were protected against

mortality, P < 0.001 (Fisher exact test).

Histopathological analysis. Thirty days after the challenge with a virulent leptospiral strain

the surviving hamsters were necropsied. During this 30-day follow-up period there was no

clinical evidence of infection, but of the surviving hamsters immunized with LigANI one

present macroscopic evidence of pulmonary haemorrhage and two hamsters present icteric

kidneys. Severe pathological lesions were found in animals vaccinated with rLigANI, which

survived during the course of the experiment, as prominent interstitial infiltrate of

lymphocytes and plasma cells, hemorrhage and necrosis. In the lung was evidenced

hemorrhage and edema, including in animals immunized with bacterin.

79

Detection of leptospires in surviving hamsters post-challenge. Among the rLigANI

immunized hamsters which survived, leptospires were isolated in kidney tissues cultures. The

imprint evaluation confirmed these results, in the three hamsters that survived challenge,

leptospires were detected in the kidney samples, Fig. 4 A and B. In contrast, none of the

hamsters in the positive control group (bacterin vaccine) had evidence of leptospires (culture

or imprint), indicating that sterilizing immunity was induced, Fig. 4 C and D.

DISCUSSION

Our previous work described the cloning and expression of the vaccine candidates

LigANI and LipL32 from L. interrogans in P. pastoris. We showed the soluble expression of

these proteins in methylotrophic yeast, resulting in a significant increase in yield compared to

expression in E. coli. In addition, the proteins were glycosylated and retained the antigenic

characteristics of the native proteins (20). In the present study the main objective was to

assess the potential of rLigANI and rLipL32 secreted in a mannosylated form by P. pastoris

as vaccine candidates against leptospirosis, using the standard hamster model. LigA and the

LipL32 were evaluated in previous studies as vaccine candidates however, efficacy varied

considerably (3,12-14,19,21,32,36). A potential problem with subunit vaccines is the

incorrect folding of the recombinant protein by the E. coli host. In a previous study, LigANI

required solubilisation in urea and extensive dialysis to maintain the protein in solution prior

to vaccine preparation (37). There were further reports of inefficient expression in E. coli,

possibly due to toxicity of the recombinant proteins (31,32). In contrast, the rLigANI and

rLipL32 expressed in P. pastoris were soluble and easily purified. Another possible

explanation for the variable efficacies reported in the previous studies is the challenge strain,

the majority used poorly virulent strains that required a high lethal dose, 106 - 108 leptospires,

and even then failed to cause 100% mortality in the control groups (3,12,32). The challenge

80

strain used in this study was highly virulent, the challenge dose was 10 leptospires, equivalent

to 5× the LD50.

We previously expressed LigANI (a polypeptide fragment corresponding to the six

carboxy-terminal Ig-like repeat domains of LigA) in an E. coli-based expression system and

this antigen significantly protected immunized hamsters (37). However, the vaccine

preparation included Freund’s adjuvant and this is incompatible for human and animal use. In

a study using aluminium hydroxide adjuvant, LigA significantly protected hamsters against

lethal challenge. In addition, anti-LigA antibodies were protective but there were extensive

kidney lesions present in the surviving hamsters (32). When evaluated as DNA vaccine, LigA

was immunoprotective but there was extensive kidney damage and the negative control

groups demonstrated a high survival rate (12). In the current study, we used a highly virulent

strain of L. interrogans serovar Copenhageni, which a low challenge dose that reproducibly

induced characteristic disease manifestations and death in all negative control animals. The

rLigANI evaluated in the present study demonstrated an efficacy of only 25%, furthermore

all of the surviving animals were culture positive and contained lesions typical of severe

leptospirosis. However, rLigANI significantly increased survival compared to the control

group. This result once again demonstrates the variable efficacy associated with the Lig

vaccine candidates. As the rLigANI polypeptide used in this study was expressed in P.

pastoris it is likely that the glycosylated recombinant protein varied significantly from the

native protein. This finding is further supported by the observation that rLigANI induced a

significant IgG response in the immunized hamsters, but one that was not protective (Fig. 2).

Although immunization with rLipL32 elicited a significant IgG response (Fig. 2), it

failed to protect against lethal challenge. Yet, as seen with rLigANI, immunization with

rLipL32 significantly increased survival. These results are in agreement with previous studies

using recombinant LipL32 expressed in E. coli (3). However, this antigen when expressed in

81

an adenovirus construct, recombinant M. bovis BCG or used as DNA vaccine demonstrated a

protective effect (3,36). These observations indicate that the efficacy of the antigens is

correlated to the form in which they are presented to the host immune system (27).

Adjuvant/antigen delivery vehicles including microspheres and liposomes were evaluated and

demonstrated significantly higher protection in hamsters compared to aluminium hydroxide

adjuvant (14).

The rLigANI and rLipL32 proteins evaluated in this study were predicted to contain

potential N-glycosylation sites and this was shown experimentally (20). Glycosylation is

known to play a critical role in antigen recognition and immunity (33). N-linked

oligosaccharides in P. pastoris have been reported to consist of eight to 14 mannose residues,

are branched and exclusively found as the terminal sugar of the secreted proteins by P.

pastoris strains (5,38). Thus, the variability in glycan structure may have an impact on the

ability of the mannosylated protein to bind at mannose receptors and influence its

presentation to immune system. As the mannosylated proteins are recognized by the mannose

receptors (MR) on macrophages and dendritic cells, these antigens are presented by class I

and II major histocompatibility complexes (MHC), resulting in the activation of CD4+ (23)

and CD8+ T cells (25).

The current study demonstrated that the rLigANI and rLipL32 proteins expressed in

P. pastoris induced significant antibody levels in immunized hamsters, nevertheless, they

failed to protect against lethal challenge. Although the recombinant proteins increased

survival in immunized hamsters it appears that the glycosylation or folding of LigANI by P.

pastoris is not compatible with that of the native protein. It is possible that glycosylation of

the recombinant proteins evaluated in this study failed to stimulate a protective immune

response. The major benefit of the P. pastoris expression system in the production of subunit

82

vaccine is the high yields reported. However, this is of no benefit if the efficacy of the

vaccine preparation is poor.

83

REFERENCES

1. Adler, B. and M. A. de la Pena. 2010. Leptospira and leptospirosis. Vet.Microbiol.

140:287-296. doi:S0378-1135(09)00116-3 [pii];10.1016/j.vetmic.2009.03.012 [doi].

2. Bharti, A. R., J. E. Nally, J. N. Ricaldi, M. A. Matthias, M. M. Diaz, M. A. Lovett, P.

N. Levett, R. H. Gilman, M. R. Willig, E. Gotuzzo, and J. M. Vinetz. 2003.

Leptospirosis: a zoonotic disease of global importance. Lancet Infect.Dis. 3:757-771.

3. Branger, C., B. Chatrenet, A. Gauvrit, F. Aviat, A. Aubert, J. M. Bach, and G.

Andre-Fontaine. 2005. Protection against Leptospira interrogans sensu lato challenge by

DNA immunization with the gene encoding hemolysin-associated protein 1.

Infect.Immun. 73:4062-4069.

4. Branger, C., C. Sonrier, B. Chatrenet, B. Klonjkowski, N. Ruvoen-Clouet, A. Aubert,

G. Andre-Fontaine, and M. Eloit. 2001. Identification of the hemolysis-associated

protein 1 as a cross-protective immunogen of Leptospira interrogans by adenovirus-

mediated vaccination. Infect.Immun. 69:6831-6838.

5. Bretthauer, R. K. and F. J. Castellino. 1999. Glycosylation of Pichia pastoris-derived

proteins. Biotechnol.Appl.Biochem. 30 ( Pt 3):193-200.

6. Cereghino, G. P., J. L. Cereghino, C. Ilgen, and J. M. Cregg. 2002. Production of

recombinant proteins in fermenter cultures of the yeast Pichia pastoris.

Curr.Opin.Biotechnol. 13:329-332. doi:S0958166902003300 [pii].

7. Chagas-Junior, A. D., A. J. McBride, D. A. Athanazio, C. P. Figueira, M. A.

Medeiros, M. G. Reis, A. I. Ko, and F. W. McBride. 2009. An imprint method for

detecting leptospires in the hamster model of vaccine-mediated immunity for leptospirosis.

J.Med.Microbiol. 58:1632-1637. doi:jmm.0.014050-0 [pii];10.1099/jmm.0.014050-0

[doi].

84

8. Choy, H. A., M. M. Kelley, T. L. Chen, A. K. Moller, J. Matsunaga, and D. A. Haake.

2007. Physiological osmotic induction of Leptospira interrogans adhesion: LigA and LigB

bind extracellular matrix proteins and fibrinogen. Infect.Immun. 75:2441-2450.

doi:IAI.01635-06 [pii];10.1128/IAI.01635-06 [doi].

9. Cregg, J. M., J. L. Cereghino, J. Shi, and D. R. Higgins. 2000. Recombinant protein

expression in Pichia pastoris. Mol.Biotechnol. 16:23-52. doi:MB:16:1:23

[pii];10.1385/MB:16:1:23 [doi].

10. Cullen, P. A., D. A. Haake, and B. Adler. 2004. Outer membrane proteins of pathogenic

spirochetes. FEMS Microbiol.Rev. 28:291-318.

11. Cullen, P. A., X. Xu, J. Matsunaga, Y. Sanchez, A. I. Ko, D. A. Haake, and B. Adler.

2005. Surfaceome of Leptospira spp. Infect.Immun. 73:4853-4863.

12. Faisal, S. M., W. Yan, C. S. Chen, R. U. Palaniappan, S. P. McDonough, and Y. F.

Chang. 2008. Evaluation of protective immunity of Leptospira immunoglobulin like

protein A (LigA) DNA vaccine against challenge in hamsters. Vaccine 26:277-287.

doi:S0264-410X(07)01189-9 [pii];10.1016/j.vaccine.2007.10.029 [doi].

13. Faisal, S. M., W. Yan, S. P. McDonough, C. F. Chang, M. J. Pan, and Y. F. Chang.

2009. Leptosome-entrapped leptospiral antigens conferred significant higher levels of

protection than those entrapped with PC-liposomes in a hamster model. Vaccine 27:6537-

6545. doi:S0264-410X(09)01236-5 [pii];10.1016/j.vaccine.2009.08.051 [doi].

14. Faisal, S. M., W. Yan, S. P. McDonough, and Y. F. Chang. 2009. Leptospira

immunoglobulin-like protein A variable region (LigAvar) incorporated in liposomes and

PLGA microspheres produces a robust immune response correlating to protective

immunity. Vaccine 27:378-387. doi:S0264-410X(08)01504-1

[pii];10.1016/j.vaccine.2008.10.089 [doi].

85

15. Gouveia, E. L., J. Metcalfe, A. L. de Carvalho, T. S. Aires, J. C. Villasboas-Bisneto,

A. Queirroz, A. C. Santos, K. Salgado, M. G. Reis, and A. I. Ko. 2008. Leptospirosis-

associated severe pulmonary hemorrhagic syndrome, Salvador, Brazil. Emerg.Infect.Dis.

14:505-508.

16. Guitian, J., M. C. Thurmond, and S. K. Hietala. 1999. Infertility and abortion among

first-lactation dairy cows seropositive or seronegative for Leptospira interrogans serovar

hardjo. J.Am.Vet.Med.Assoc. 215:515-518.

17. Haake, D. A., M. K. Mazel, A. M. McCoy, F. Milward, G. Chao, J. Matsunaga, and

E. A. Wagar. 1999. Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit

synergistic immunoprotection. Infect.Immun. 67:6572-6582.

18. Haake, D. A., M. A. Suchard, M. M. Kelley, M. Dundoo, D. P. Alt, and R. L.

Zuerner. 2004. Molecular evolution and mosaicism of leptospiral outer membrane

proteins involves horizontal DNA transfer. J.Bacteriol. 186:2818-2828.

19. Habarta, A., P. A. Abreu, N. Olivera, P. Hauk, M. T. Cedola, M. F. Ferrer, P. L.

Ho, and R. M. Gomez. 2010. Increased Immunogenicity to LipL32 of Leptospira

interrogans when Expressed as a Fusion Protein with the Cholera Toxin B Subunit.

Curr.Microbiol. doi:10.1007/s00284-010-9739-6 [doi].

20. Hartwig, D. D., T. L. Oliveira, F. K. Seixas, K. M. Forster, C. Rizzi, C. P. Hartleben,

A. J. McBride, and O. A. Dellagostin. 2010. High yield expression of leptospirosis

vaccine candidates LigA and LipL32 in the methylotrophic yeast Pichia pastoris.

Microb.Cell Fact. 9:98. doi:1475-2859-9-98 [pii];10.1186/1475-2859-9-98 [doi].

21. Koizumi, N. and H. Watanabe. 2004. Leptospiral immunoglobulin-like proteins elicit

protective immunity. Vaccine 22:1545-1552.

22. Koizumi, N. and H. Watanabe. 2005. Leptospirosis vaccines: past, present, and future.

J.Postgrad.Med. 51:210-214.

86

23. Lam, J. S., M. K. Mansour, C. A. Specht, and S. M. Levitz. 2005. A model vaccine

exploiting fungal mannosylation to increase antigen immunogenicity. J.Immunol.

175:7496-7503. doi:175/11/7496 [pii].

24. Lin, Y. P. and Y. F. Chang. 2007. A domain of the Leptospira LigB contributes to high

affinity binding of fibronectin. Biochem.Biophys.Res.Commun. 362:443-448.

doi:S0006-291X(07)01696-8 [pii];10.1016/j.bbrc.2007.07.196 [doi].

25. Luong, M., J. S. Lam, J. Chen, and S. M. Levitz. 2007. Effects of fungal N- and O-

linked mannosylation on the immunogenicity of model vaccines. Vaccine 25:4340-4344.

doi:S0264-410X(07)00337-4 [pii];10.1016/j.vaccine.2007.03.027 [doi].

26. Macauley-Patrick, S., M. L. Fazenda, B. McNeil, and L. M. Harvey. 2005.

Heterologous protein production using the Pichia pastoris expression system. Yeast

22:249-270. doi:10.1002/yea.1208 [doi].

27. Marciani, D. J. 2003. Vaccine adjuvants: role and mechanisms of action in vaccine

immunogenicity. Drug Discov.Today 8:934-943. doi:S1359644603028642 [pii].

28. Matsunaga, J., M. A. Barocchi, J. Croda, T. A. Young, Y. Sanchez, I. Siqueira, C.

A. Bolin, M. G. Reis, L. W. Riley, D. A. Haake, and A. I. Ko. 2003. Pathogenic

Leptospira species express surface-exposed proteins belonging to the bacterial

immunoglobulin superfamily. Mol.Microbiol. 49:929-945.

29. McBride, A. J., D. A. Athanazio, M. G. Reis, and A. I. Ko. 2005. Leptospirosis.

Curr.Opin.Infect.Dis. 18:376-386.

30. McBride, A. J., G. M. Cerqueira, M. A. Suchard, A. N. Moreira, R. L. Zuerner, M.

G. Reis, D. A. Haake, A. I. Ko, and O. A. Dellagostin. 2009. Genetic diversity of the

Leptospiral immunoglobulin-like (Lig) genes in pathogenic Leptospira spp.

Infect.Genet.Evol. 9:196-205. doi:S1567-1348(08)00219-0

[pii];10.1016/j.meegid.2008.10.012 [doi].

87

31. Palaniappan, R. U., Y. F. Chang, S. S. Jusuf, S. Artiushin, J. F. Timoney, S. P.

McDonough, S. C. Barr, T. J. Divers, K. W. Simpson, P. L. McDonough, and H. O.

Mohammed. 2002. Cloning and molecular characterization of an immunogenic LigA

protein of Leptospira interrogans. Infect.Immun. 70:5924-5930.

32. Palaniappan, R. U., S. P. McDonough, T. J. Divers, C. S. Chen, M. J. Pan, M.

Matsumoto, and Y. F. Chang. 2006. Immunoprotection of recombinant leptospiral

immunoglobulin-like protein A against Leptospira interrogans serovar Pomona

infection. Infect.Immun. 74:1745-1750.

33. Rudd, P. M., T. Elliott, P. Cresswell, I. A. Wilson, and R. A. Dwek. 2001.

Glycosylation and the immune system. Science 291:2370-2376.

34. Sagt, C. M., B. Kleizen, R. Verwaal, M. D. de Jong, W. H. Muller, A. Smits, C.

Visser, J. Boonstra, A. J. Verkleij, and C. T. Verrips. 2000. Introduction of an N-

glycosylation site increases secretion of heterologous proteins in yeasts.

Appl.Environ.Microbiol. 66:4940-4944.

35. Segura, E. R., C. A. Ganoza, K. Campos, J. N. Ricaldi, S. Torres, H. Silva, M. J.

Cespedes, M. A. Matthias, M. A. Swancutt, L. R. Lopez, E. Gotuzzo, H. Guerra, R.

H. Gilman, and J. M. Vinetz. 2005. Clinical spectrum of pulmonary involvement in

leptospirosis in a region of endemicity, with quantification of leptospiral burden.

Clin.Infect.Dis. 40:343-351.

36. Seixas, F. K., E. F. da Silva, D. D. Hartwig, G. M. Cerqueira, M. Amaral, M. Q.

Fagundes, R. G. Dossa, and O. A. Dellagostin. 2007. Recombinant Mycobacterium

bovis BCG expressing the LipL32 antigen of Leptospira interrogans protects hamsters

from challenge. Vaccine 26:88-95.

37. Silva, E. F., M. A. Medeiros, A. J. McBride, J. Matsunaga, G. S. Esteves, J. G.

Ramos, C. S. Santos, J. Croda, A. Homma, O. A. Dellagostin, D. A. Haake, M. G.

88

Reis, and A. I. Ko. 2007. The terminal portion of leptospiral immunoglobulin-like

protein LigA confers protective immunity against lethal infection in the hamster model

of leptospirosis. Vaccine.

38. Trimble, R. B., C. Lubowski, C. R. Hauer, III, R. Stack, L. McNaughton, T. R.

Gemmill, and S. A. Kumar. 2004. Characterization of N- and O-linked glycosylation of

recombinant human bile salt-stimulated lipase secreted by Pichia pastoris. Glycobiology

14:265-274. doi:10.1093/glycob/cwh036 [doi];cwh036 [pii].

39. Vinetz, J. M. 2001. Leptospirosis. Curr.Opin.Infect.Dis. 14:527-538.

40. Yan, W., S. M. Faisal, S. P. McDonough, T. J. Divers, S. C. Barr, C. F. Chang, M. J.

Pan, and Y. F. Chang. 2009. Immunogenicity and protective efficacy of recombinant

Leptospira immunoglobulin-like protein B (rLigB) in a hamster challenge model.

Microbes.Infect. 11:230-237. doi:S1286-4579(08)00335-

3.[pii];10.1016/j.micinf.2008.11.008 [doi].

89

Table 1. Prophylactic efficacy of rLigANI and rLipL32 vaccines in hamsters challenged with

a virulent leptospiral strain.

Treatment group No. of animals % Survival

rLigANI 12

12

12

6

25% (3)

rLipL32 0% (0)

aluminium hydroxide 0% (0)

killed whole-leptospires 100% (6)

90

Figure 1. SDS-page of the rLigANI and rLipL32 expressed by P. pastoris KM71H. The

recombinant proteins were concentrated and purified by ultrafiltration directly from the

culture supernatant. Lanes: rLigANI (61 kDa) and rLipL32 (32 kDa): recombinant proteins

expressed in P. pastoris.

Figure 2. Systemic antibodies absorbencies of hamsters inoculated with rLigANI, rLipL32

and aluminium hydroxide (control). Recombinant LigANI and rLipL32 expressed by P.

pastoris was used as antigen in the ELISA. Results are expressed as the mean absorbance. *P

< 0.001 in comparison to the control group. (IM) Intramuscular immunized animals. (C)

Intraperitoneally challenged. Each point corresponds to absorbance mean of each animal.

Figure 3. Survival of hamsters challenged with virulent L. interrogans after immunization

with recombinant proteins. The Wilcoxon Log-rank test was used to determine significant

differences for survival between the immunized group with rLigANI and rLipL32 or with

aluminium hydroxide and killed whole-leptospires control groups (P < 0.001).

Figure 4. Direct observation of leptospires in imprint samples. (A and B) Leptospires were

detected in kidney from hamsters immunized with rLigANI and challenge with a virulent

strain of L. interrogans serovar Copenhageni. (B and C) Absence of leptospires in kidney

samples of hamsters immunized with 109 killed whole-leptospires and challenge with a

virulent strain of L. interrogans serovar Copenhageni. Magnification_1000. Samples were

treated with FITC or Hoestch for LipL32 protein or DNA visualization, respectively.

91

Figure 1

61 kDa

32 kDa

rLigANI rLipL32

92

Figure 2

*

*

*

*

C IM IM

93

Figure 3

0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 300

102030405060708090

100aluminum hydroxide

rLigANI

rLipL32

killed whole-leptospires

Days

Per

cent

sur

viva

l

94

Figure 4

A B C D FITC FITC Hoestch Hoestch

95

5. CONCLUSÕES

A) As proteínas recombinantes rLigAni e rLipL32 de L. interrogans foram expressas

com sucesso na forma secretória em P. pastoris, utilizando o vetor pPICZαB;

B) O rendimento das proteínas recombinantes expressas neste sistema eucarioto foi

consideravelmente mais alto que o reportado em estudos prévio, onde foi utilizada a

bactéria E. coli;

C) As proteínas recombinantes foram glicosiladas e mantiveram-se antigênicas;

D) Além disso, na forma de vacina de subunidade recombinante as proteínas

glicosiladas foram capazes de induzir resposta imune humoral específica em

hamsters;

E) rLigANI e rLipL32 não demonstraram potencial imunoprotetor no referido modelo

animal, desafiado com cepa virulenta de L. interrogans sorovar Copenhageni. No

entanto, conferiram uma maior sobrevida aos animais imunizados com estas

proteínas, em comparação ao grupo controle negativo.

96

6. REFERÊNCIAS

ALT DP, ZUERNER RL, and BOLIN CA. Evaluation of antibiotics for treatment of

cattle infected with Leptospira borgpetersenii serovar hardjo. Journal of the American

Veterinary Medical Association, 219: 636-639, 2001.

ANDRE-FONTAINE G, BRANGER C, GRAY AW, and KLAASEN HL. Comparison of

the efficacy of three commercial bacterins in preventing canine leptospirosis.

Vet.Rec., 153: 165-169, 2003.

BHARADWAJ R. Leptospirosis--a reemerging disease? Indian J.Med.Res., 120: 136-

138, 2004.

BHARTI AR, NALLY JE, RICALDI JN, MATTHIAS MA, DIAZ MM, LOVETT MA,

LEVETT PN, GILMAN RH, WILLIG MR, GOTUZZO E, and VINETZ JM.

Leptospirosis: a zoonotic disease of global importance. Lancet Infect.Dis., 3: 757-

771, 2003.

BRANGER C, CHATRENET B, GAUVRIT A, AVIAT F, AUBERT A, BACH JM, and

ANDRE-FONTAINE G. Protection against Leptospira interrogans sensu lato

challenge by DNA immunization with the gene encoding hemolysin-associated

protein 1. Infect.Immun., 73: 4062-4069, 2005.

BRANGER C, SONRIER C, CHATRENET B, KLONJKOWSKI B, RUVOEN-CLOUET

N, AUBERT A, ANDRE-FONTAINE G, and ELOIT M. Identification of the hemolysis-

associated protein 1 as a cross-protective immunogen of Leptospira interrogans by

adenovirus-mediated vaccination. Infect.Immun., 69: 6831-6838, 2001.

BULACH DM, KALAMBAHETI T, PENA-MOCTEZUMA A, and ADLER B.

Lipopolysaccharide biosynthesis in Leptospira. J.Mol.Microbiol.Biotechnol., 2: 375-

380, 2000.

BULACH DM, ZUERNER RL, WILSON P, SEEMANN T, MCGRATH A, CULLEN PA,

DAVIS J, JOHNSON M, KUCZEK E, ALT DP, PETERSON-BURCH B, COPPEL RL,

97

ROOD JI, DAVIES JK, and ADLER B. Genome reduction in Leptospira

borgpetersenii reflects limited transmission potential. Proc.Natl.Acad.Sci.U.S.A, 103:

14560-14565, 2006.

CEREGHINO GP, CEREGHINO JL, ILGEN C, and CREGG JM. Production of

recombinant proteins in fermenter cultures of the yeast Pichia pastoris.

Curr.Opin.Biotechnol., 13: 329-332, 2002.

CEREGHINO JL and CREGG JM. Heterologous protein expression in the

methylotrophic yeast Pichia pastoris. FEMS Microbiol.Rev., 24: 45-66, 2000.

CHOY HA, KELLEY MM, CHEN TL, MOLLER AK, MATSUNAGA J, and HAAKE DA.

Physiological osmotic induction of Leptospira interrogans adhesion: LigA and LigB

bind extracellular matrix proteins and fibrinogen. Infect.Immun., 75: 2441-2450, 2007.

CLARK TG and CASSIDY-HANLEY D. Recombinant subunit vaccines: potentials

and constraints. Dev.Biol.(Basel), 121: 153-163, 2005.

CULLEN PA, XU X, MATSUNAGA J, SANCHEZ Y, KO AI, HAAKE DA, and ADLER

B. Surfaceome of Leptospira spp. Infect.Immun., 73: 4853-4863, 2005.

DALY R and HEARN MT. Expression of the human activin type I and II receptor

extracellular domains in Pichia pastoris. Protein Expr.Purif., 46: 456-467, 2006.

DESAI S, VAN TU, LIERZ M, ESPELAGE W, ZOTA L, SARBU A, CZERWINSKI M,

SADKOWSKA-TODYS M, AVDICOVA M, REETZ J, LUGE E, GUERRA B,

NOCKLER K, and JANSEN A. Resurgence of field fever in a temperate country: an

epidemic of leptospirosis among seasonal strawberry harvesters in Germany in 2007.

Clin.Infect.Dis., 48: 691-697, 2009.

98

ELLIS T, IMRIE A, KATZ AR, and EFFLER PV. Underrecognition of leptospirosis

during a dengue fever outbreak in Hawaii, 2001-2002. Vector.Borne.Zoonotic.Dis., 8:

541-547, 2008.

FAINE SB, ADLER B, BOLIN C, and PEROLAT P. Leptospira and Leptospirosis.

1999.

FAISAL SM, YAN W, CHEN CS, PALANIAPPAN RU, MCDONOUGH SP, and

CHANG YF. Evaluation of protective immunity of Leptospira immunoglobulin like

protein A (LigA) DNA vaccine against challenge in hamsters. Vaccine, 26: 277-287,

2008.

FAISAL SM, YAN W, MCDONOUGH SP, and CHANG YF. Leptospira

immunoglobulin-like protein A variable region (LigAvar) incorporated in liposomes

and PLGA microspheres produces a robust immune response correlating to

protective immunity. Vaccine, 27: 378-387, 2009.

FLANNERY B, COSTA D, CARVALHO FP, GUERREIRO H, MATSUNAGA J, DA

SILVA ED, FERREIRA AG, RILEY LW, REIS MG, HAAKE DA, and KO AI.

Evaluation of recombinant Leptospira antigen-based enzyme-linked immunosorbent

assays for the serodiagnosis of leptospirosis. J.Clin.Microbiol., 39: 3303-3310, 2001.

GELLISSEN G. Heterologous protein production in methylotrophic yeasts.

Appl.Microbiol.Biotechnol., 54: 741-750, 2000.

GOUVEIA EL, METCALFE J, DE CARVALHO AL, AIRES TS, VILLASBOAS-

BISNETO JC, QUEIRROZ A, SANTOS AC, SALGADO K, REIS MG, and KO AI.

Leptospirosis-associated severe pulmonary hemorrhagic syndrome, Salvador, Brazil.

Emerg.Infect.Dis., 14: 505-508, 2008.

HAAKE DA. Hamster model of leptospirosis. Curr.Protoc.Microbiol., Chapter 12: Unit,

2006.

99

HAAKE DA, CHAO G, ZUERNER RL, BARNETT JK, BARNETT D, MAZEL M,

MATSUNAGA J, LEVETT PN, and BOLIN CA. The leptospiral major outer membrane

protein LipL32 is a lipoprotein expressed during mammalian infection. Infect.Immun.,

68: 2276-2285, 2000.

HAAKE DA, SUCHARD MA, KELLEY MM, DUNDOO M, ALT DP, and ZUERNER

RL. Molecular evolution and mosaicism of leptospiral outer membrane proteins

involves horizontal DNA transfer. J.Bacteriol., 186: 2818-2828, 2004.

HAMBURGER ZA, BROWN MS, ISBERG RR, and BJORKMAN PJ. Crystal structure

of invasin: a bacterial integrin-binding protein. Science, 286: 291-295, 1999.

HAUK P, MACEDO F, ROMERO EC, VASCONCELLOS SA, DE MORAIS ZM,

BARBOSA AS, and HO PL. In LipL32, the major leptospiral lipoprotein, the C

terminus is the primary immunogenic domain and mediates interaction with collagen

IV and plasma fibronectin. Infect.Immun., 76: 2642-2650, 2008.

JENKINS N, PAREKH RB, and JAMES DC. Getting the glycosylation right:

implications for the biotechnology industry. Nat.Biotechnol., 14: 975-981, 1996.

KOIZUMI N and WATANABE H. Leptospirosis vaccines: past, present, and future.

J.Postgrad.Med., 51: 210-214, 2005a.

KOIZUMI N and WATANABE H. Leptospirosis vaccines: past, present, and future.

J.Postgrad.Med., 51: 210-214, 2005b.

LEVETT PN. Leptospirosis. Clin.Microbiol.Rev., 14: 296-326, 2001.

LIN YP, LEE DW, MCDONOUGH SP, NICHOLSON LK, SHARMA Y, and CHANG

YF. Repeated domains of leptospira immunoglobulin-like proteins interact with elastin

and tropoelastin. J.Biol.Chem., 284: 19380-19391, 2009.

100

LUO Y, FREY EA, PFUETZNER RA, CREAGH AL, KNOECHEL DG, HAYNES CA,

FINLAY BB, and STRYNADKA NC. Crystal structure of enteropathogenic

Escherichia coli intimin-receptor complex. Nature, 405: 1073-1077, 2000.

MACAULEY-PATRICK S, FAZENDA ML, MCNEIL B, and HARVEY LM.

Heterologous protein production using the Pichia pastoris expression system. Yeast,

22: 249-270, 2005.

MARTINEZ R, PEREZ A, QUINONES MC, CRUZ R, ALVAREZ A, ARMESTO M,

FERNANDEZ C, MENENDEZ J, RODRIGUEZ I, BARO M, DIAZ M, RODRIGUEZ J,

SIERRA G, OBREGON AM, TOLEDO ME, and FERNANDEZ N. Efficacy and safety

of a vaccine against human leptospirosis in Cuba. Rev.Panam.Salud Publica, 15:

249-255, 2004.

MATSUNAGA J, BAROCCHI MA, CRODA J, YOUNG TA, SANCHEZ Y, SIQUEIRA

I, BOLIN CA, REIS MG, RILEY LW, HAAKE DA, and KO AI. Pathogenic Leptospira

species express surface-exposed proteins belonging to the bacterial immunoglobulin

superfamily. Mol.Microbiol., 49: 929-945, 2003.

MCBRIDE AJ, ATHANAZIO DA, REIS MG, and KO AI. Leptospirosis.

Curr.Opin.Infect.Dis., 18: 376-386, 2005.

MELDGAARD M and SVENDSEN I. Different effects of N-glycosylation on the

thermostability of highly homologous bacterial (1,3-1,4)-beta-glucanases secreted

from yeast. Microbiology, 140 ( Pt 1): 159-166, 1994.

PALANIAPPAN RU, CHANG YF, HASSAN F, MCDONOUGH SP, POUGH M, BARR

SC, SIMPSON KW, MOHAMMED HO, SHIN S, MCDONOUGH P, ZUERNER RL,

QU J, and ROE B. Expression of leptospiral immunoglobulin-like protein by

Leptospira interrogans and evaluation of its diagnostic potential in a kinetic ELISA.

J.Med.Microbiol., 53: 975-984, 2004.

101

PALANIAPPAN RU, CHANG YF, JUSUF SS, ARTIUSHIN S, TIMONEY JF,

MCDONOUGH SP, BARR SC, DIVERS TJ, SIMPSON KW, MCDONOUGH PL, and

MOHAMMED HO. Cloning and molecular characterization of an immunogenic LigA

protein of Leptospira interrogans. Infect.Immun., 70: 5924-5930, 2002.

PETERSEN AM, BOYE K, BLOM J, SCHLICHTING P, and KROGFELT KA. First

isolation of Leptospira fainei serovar Hurstbridge from two human patients with Weil's

syndrome. J.Med.Microbiol., 50: 96-100, 2001.

REIS RB, RIBEIRO GS, FELZEMBURGH RD, SANTANA FS, MOHR S, MELENDEZ

AX, QUEIROZ A, SANTOS AC, RAVINES RR, TASSINARI WS, CARVALHO MS,

REIS MG, and KO AI. Impact of environment and social gradient on Leptospira

infection in urban slums. PLoS.Negl.Trop.Dis., 2: e228, 2008.

SEGURA ER, GANOZA CA, CAMPOS K, RICALDI JN, TORRES S, SILVA H,

CESPEDES MJ, MATTHIAS MA, SWANCUTT MA, LOPEZ LR, GOTUZZO E,

GUERRA H, GILMAN RH, and VINETZ JM. Clinical spectrum of pulmonary

involvement in leptospirosis in a region of endemicity, with quantification of leptospiral

burden. Clin.Infect.Dis., 40: 343-351, 2005.

SEIXAS FK, DA SILVA EF, HARTWIG DD, CERQUEIRA GM, AMARAL M,

FAGUNDES MQ, DOSSA RG, and DELLAGOSTIN OA. Recombinant

Mycobacterium bovis BCG expressing the LipL32 antigen of Leptospira interrogans

protects hamsters from challenge. Vaccine, 26: 88-95, 2007.

SILVA EF, MEDEIROS MA, MCBRIDE AJ, MATSUNAGA J, ESTEVES GS, RAMOS

JG, SANTOS CS, CRODA J, HOMMA A, DELLAGOSTIN OA, HAAKE DA, REIS

MG, and KO AI. The terminal portion of leptospiral immunoglobulin-like protein LigA

confers protective immunity against lethal infection in the hamster model of

leptospirosis. Vaccine, 2007.

102

SONRIER C, BRANGER C, MICHEL V, RUVOEN-CLOUET N, GANIERE JP, and

ANDRE-FONTAINE G. Evidence of cross-protection within Leptospira interrogans in

an experimental model. Vaccine, 19: 86-94, 2000.

VERNEL-PAUILLAC F and GOARANT C. Differential cytokine gene expression

according to outcome in a hamster model of leptospirosis. PLoS.Negl.Trop.Dis., 4:

e582, 2010.

VINETZ JM. Leptospirosis. Curr.Opin.Infect.Dis., 14: 527-538, 2001.

WANG Z, JIN L, and WEGRZYN A. Leptospirosis vaccines. Microb.Cell Fact., 6: 39,

2007.

ZHUO JT, WANG SS, and LAN WL. A discussion on setting up target age group for

immunization against leptospirosis. Zhonghua Liu Xing.Bing.Xue.Za Zhi., 16: 228-

230, 1995.

103

7. ANEXOS

Artigo 2: Publicado no periódico Microbial Cell Factories

RESEARCH Open Access

High yield expression of leptospirosis vaccinecandidates LigA and LipL32 in themethylotrophic yeast Pichia pastorisDaiane D Hartwig1, Thaís L Oliveira1, Fabiana K Seixas1, Karine M Forster1, Caroline Rizzi1, Cláudia P Hartleben1,Alan JA McBride2, Odir A Dellagostin1*

Abstract

Background: Leptospirosis, a zoonosis caused by Leptospira spp., is recognized as an emergent infectious disease.Due to the lack of adequate diagnostic tools, vaccines are an attractive intervention strategy. Recombinant proteinsproduced in Escherichia coli have demonstrated promising results, albeit with variable efficacy. Pichia pastoris is analternative host with several advantages for the production of recombinant proteins.

Results: The vaccine candidates LigANI and LipL32 were cloned and expressed in P. pastoris as secreted proteins.Large-scale expression resulted in a yield of 276 mg/L for LigANI and 285 mg/L for LipL32. The recombinantproteins were glycosylated and were recognized by antibodies present in the sera of patients with severeleptospirosis.

Conclusions: The expression of LigANI and LipL32 in P. pastoris resulted in a significant increase in yield comparedto expression in E. coli. In addition, the proteins were secreted, allowing for easy purification, and retained theantigenic characteristics of the native proteins, demonstrating their potential application as subunit vaccinecandidates.

BackgroundLeptospira interrogans sensu lato is the causative agentof Leptospirosis, one of the most widespread zoonoticdiseases in the world [1-3]. In Brazil alone there areover 10,000 cases of leptospirosis reported annually dur-ing the epidemics that affect the poor communities inthe major urban centres of Brazil [4]. Mortality rangesfrom 10-15% in cases of the traditional Weil’s diseaseand can be over 70% in cases of severe pulmonary hae-morrhage syndrome (SPHS) and, even with aggressiveintervention strategies, mortality remains high [5-7].Due to the lack of adequate tools leptospirosis is under-diagnosed, therefore vaccination remains a viable alter-native for the management of this disease. Severalgroups, including our own, have demonstrated the useof subunit vaccines against leptospirosis, albeit withvarying degrees of efficacy [8-10], in particular the use

of the Leptospiral immunoglobulin-like (Lig) proteins,LigA and LigB [11-14], and the immunodominant lipo-protein, LipL32 [15-18].Escherichia coli has been used extensively as a host for

heterologous protein expression, but potential limita-tions include the yield, folding and post-translationalmodifications of the recombinant protein. An alternativehost to E. coli is the methylotrophic yeast, Pichia pas-toris. This yeast strain has emerged as a powerful andinexpensive expression system for the heterologous pro-duction of recombinant proteins with the followingcharacteristics: (i) techniques for genetic modificationsare available; (ii) proteins may be secreted; (iii) post-translational modification and (iv) high yield, reviewedin [19-21].We previously expressed the Lig polypeptides, LigANI,

LigBNI and LigBrep, in several E. coli-based expressionsystems. To date the recombinant proteins were insolu-ble, required extensive dialysis during purification andthe yield was poor [13]. In this work we describe theuse of the methylotrophic yeast P. pastoris for the

* Correspondence: odir@ufpel.edu.br1Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico,Universidade Federal de Pelotas, Pelotas, RS, BrazilFull list of author information is available at the end of the article

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

© 2010 Hartwig et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative CommonsAttribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction inany medium, provided the original work is properly cited.

cloning, expression, purification and antigenic character-ization of the leptospiral vaccine candidates LigANI andLipL32.

ResultsPlasmid construction and sequence analysisThe DNA sequences that encode for the LigA polypep-tide, LigANI, (1800 bp) and LipL32 (766 bp) wereamplified by PCR and cloned into the P. pastoris expres-sion vector pPICZaB. Of the 150 P. pastoris coloniesscreened for expression of each recombinant protein, 30colonies were strongly recognised by a monoclonal anti-body (Mab) specific to the 6×His tag at the C-terminusof the recombinant proteins. Colony PCR was used toconfirm the presence of the insert in the expression vec-tor and clones exhibiting the highest expression levelswere selected for further expression studies, Figure 1.

Expression of LigANI and LipL32 in P. pastorisThe coding sequences for the recombinant proteinsLigANI (rLigANI) and LipL32 (rLipL32) cloned in pPIC-ZaB were under the control of the AOX1 promoter. Inaddition, pPICZaB contains the a-factor signal sequencefrom S. cerevisiae, allowing secretion of the recombinantprotein. The concentration of rLigANI and rLipL32 inthe culture supernatant was found to increase with time,Figure 2A, and is related with a decrease in the intracel-lular concentration of rLigANI, Figure 2B and 2C. Incontrast, while the secretion of rLipL32 increased, sodid the intracellular concentration, Figure 2D and 2E.Recombinant proteins of the expected size wereobserved, rLigANI (61 kDa) and rLipL32 (32 kDa), yetthere was evidence of larger proteins, suggesting thatthe recombinant proteins had been glycosylated by P.pastoris. Following 196 h induction at 28°C, the

concentration of secreted protein reached 0.93 g/L and1.2 g/L for rLigANI and rLipL32, respectively. Large-scale (2 L cultures) expression of rLigANI and rLipL32resulted in yields of 276 mg/L and 285 mg/L,respectively.

Recombinant protein purification and concentrationThe supernatant containing the secreted rLigANI andrLipL32 was collected and purified/concentrated usingthree alternative methods. In the first method, the pro-teins were purified by ammonium sulphate precipitation.The optimal salt concentration for rLigANI was 70-80%,while the precipitation of rLipL32 was similar under allconcentrations tested. The recombinant proteins weredialyzed to remove the ammonium sulphate and thenanalysed by Western blotting, Figure 3A, B. Once again,

(+) 1 2 (-)

3 4 5 6 7

8 9 10 11 12

Figure 1 Screening for P. pastoris recombinant clonesexpressing rLigANI and rLipL32. Colony blot analysis oftransformed P. pastoris strain KM71 H with anti-6×His Mab. The tgDrecombinant protein expressed in P. pastoris KM71 H was thepositive control (+) and untransformed P. pastoris KM71 H was thenegative control (-). Spots 1-7 are representative rLigANI coloniesand 8-12 are representative rLipL32 colonies. Arrows indicate thecolonies that were selected for large-scale expression studies.

0h 24h 48h 72h 96h 120h 144h KM

0h 24h 48h 72h 96h 120h 144h KM

B

C

D

E

61 kDa

61 kDa

32 kDa

32 kDa

0h 24h 48h 72h 96h 120h 144h KM

0h 24h 48h 72h 96h 120h 144h KM

A

Figure 2 Expression of rLigANI and rLipL32 proteins inP. pastoris. Time courses for the expression of secreted rLigANI andrLipL32 by P. pastoris induced for up to 192 hours (8 days), (A) asdetermined by protein concentration (mg/mL). Western blotanalysis of the intracellular (pellet) and secreted (supernatant)expression of rLigANI (B and C, respectively) and rLipL32 (D and E,respectively), using polyclonal anti-LigANI sera or anti-LipL32 Mab.Samples (cells and supernatant) were collected at the various hourlytime points indicated. KM - negative control: untransformedP. pastoris KM71 H culture.

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

Page 2 of 7

there was evidence of post-translation modification ofthe recombinant proteins. The yield for both rLigANIand rLipL32 was similar, approximately 70 mg/L, corre-sponding to 24.5 and 27.6% of total protein, respectively.In the second method, the supernatant was concentratedby ultrafiltration which reduced the starting volume by97%. The yield for rLigANI was 183 mg/L (66.3% totalprotein) compared to 106 mg/L (37.3% total protein) forrLipL32. The samples were observed by 12% SDS-PAGEand compared to recombinant proteins expressed andpurified from E. coli (Figure 3C). In the third method,the secreted proteins were concentrated by lyophilisa-tion. There was a 10-fold reduction in the initial samplevolume and the yield was 239 mg/L rLigANI and 224mg/L rLipL32, equivalent to 86.7 and 70.7% total pro-tein, respectively.

Deglycosylation of LigANI and LipL32In an analysis, using Vector NTI Advance 10.0 (Invitro-gen) software, of the recombinant protein amino acidsequences, LigANI was found to have seven potential

N-glycosylation sites, compared to one for LipL32.N-Glycosidase F (PNGase F) removes oligomannose,hybrid, and complex N-glycans attached to asparagine,while Endoglycosidase H (Endo H) releases oligoman-nose and hybrid N-glycans, but not complex N-glycans,and were used to deglycosylate the recombinant pro-teins. Following deglycosylation, the larger molecularweight species were no longer evident and the size ofthe rLigANI and rLipL32 corresponded to the equiva-lent protein produced in E. coli, Figure 4. There did notappear to be any difference in action between the twoenzymes used.

Antigenicity of the recombinant LigANI and LipL32proteinsThe antigenicity of the purified proteins was evaluatedby Western blotting with sera from leptospirosispatients and with rabbit anti-Leptospira hyperimmunesera. The recombinant proteins LigANI and LipL32 pro-duced in E. coli were included as positive controls. Bothglycosylated and deglycosylated (Endo H and PNGase Ftreated) rLigANI were recognised by the human andrabbit immune sera, Figure 5A, C and 5D, as were theglycosylated and deglycosylated forms of rLipL32, Figure5B, C and 5D.

DiscussionPrevious studies have demonstrated the use of the Ligproteins and LipL32 in a range of formats, includingrecombinant proteins [11-14], DNA vaccines [17,22],microspheres and liposomes [23,24], fused to a choleratoxin subunit [25] or expressed in M. bovis bacilleCalmette-Guérin [16]. However, vaccine efficacy in theanimal models has been highly variable for these and

E-LipL32 25% 35% 45% 60% 70% 80%

32 kDa

61 kDa

B

E-LigANI 25% 35% 45% 60% 70% 80% A

E-LigANI E-LipL32 rLigANI rLipL32

E. coli P. pastoris

C

32 kDa

61 kDa 61 kDa

32 kDa

Figure 3 Purification of rLigANI and rLipL32 expressed in P.pastoris. Recombinant proteins purified by precipitation withammonium sulphate or by ultrafiltration. Ammonium sulphateprecipitated proteins were detected by Western blotting with (A)polyclonal anti-LigANI sera or (B) an anti-LipL32 Mab. The effect ofthe various concentrations of ammonium sulphate (expressed aspercentage values) on the precipitation of the recombinant proteinsis displayed. (C) Affinity chromatography purified recombinantLigANI (61 kDa) and LipL32 (32 kDa) produced in E. coli comparedto purification by ultrafiltration of rLigANI and rLipL32 secreted by P.pastoris. An equal volume (10 μL) of both proteins was loaded onthe gel.

PNGase F Endo H ( - ) E-LigANI PNGase F Endo H ( - ) E-LipL32

PNGase F Endo H ( - ) E-LigANI PNGase F Endo H ( - ) E-LipL32

A

B

61 kDa 32 kDa

61 kDa 32 kDa

Figure 4 Deglycosylation of rLigANI and rLipL32 produced byP pastoris. To evaluate the post-translational modification of therLigANI and rLipL32 proteins produced and secreted by P. pastoris,the proteins were deglycosylated with PNGase F and Endo H. Theresultant proteins were visualized by (A) Western blotting withpolyclonal anti-LigANI sera and an anti-LipL32 Mab or by (B) SDS-PAGE stained with Coomassie blue. The proteins were digested withPNGase F, Endo H or without enzyme (-). E-LigANI (61 kDa) and E-LipL32 (32 kDa) recombinant proteins were expressed and purifiedfrom E. coli.

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

Page 3 of 7

other Leptospira proteins and they do not induce steri-lizing immunity, reviewed in [26]. Several reports sug-gest that the most likely explanation for the lack of aconsistent protective effect with recombinant proteinsproduced in E. coli is the failure of the proteins to foldcorrectly [13,22]. Structural modelling of Lig moleculespredicted that the bacterial immunoglobulin-like (Big)repeat domains have a highly folded b-immunoglobulinsandwich structure [27]. E. coli expressed the full-lengthLigA at very low levels because of its high toxicity,which resulted in a 50-fold decrease in viability of cells[28]. Furthermore, expression of recombinant LigA inthe E. coli pET expression system failed [14].P. pastoris is an important host organism for the pro-

duction of recombinant proteins [19]. The large-scaleproduction of recombinant proteins is necessary forpharmaceutical, biomedical and biotechnological appli-cations, therefore it is important to develop and to opti-mize techniques for increased yield of the proteins ofinterest. In this work we cloned and expressed a C-terminal fragment of LigA, LigANI, which includes sixBig repeat domains of the LigA protein, in the methylo-trophic yeast P. pastoris. In addition, the full-lengthLipL32 protein was also expressed as a secreted protein.Previously we reported the expression of recombinantLigANI in E. coli with a yield of 6-10 mg/L [13], whilerecombinant LipL32 was expressed at 40 mg/L [29]. Inthis study we report that large-scale expression in P.pastoris resulted in yields of over 250 mg/L for both rLi-gANI and rLipL32, without the need for subsequentsolubilisation and/or re-folding steps. The strain used inthis study, KM71 H, has a deletion in the AOX1 gene,which is partly replaced by ARG4 from S. cerevisiae and

the phenotype of these strains is MutS (Methanol utili-zation slow). The use of such strains is advantageous asthey do not require large amounts of methanol in large-scale cultures [19-21].Three low-cost purification strategies were evaluated,

namely: i) ammonium sulphate precipitation anddesalting by dialysis, ii) ultrafiltration and iii) lyophili-sation. The most significant results in terms of yieldwere obtained using lyophilisation and ultrafiltration topurify and/or concentrate the proteins. This is animportant observation as these techniques are applic-able to large-scale cultures grown in bioreactors on anindustrial scale. During ultrafiltration the columnsused had a cut-off of 30 kDa and our results demon-strated a decreased yield of the rLipL32 protein, possi-bly due to the fact that the cut-off is very close to themolecular weight of the recombinant protein. Therewas a significantly lower yield of both rLigANI andrLipL32 when purified by ammonium sulphateprecipitation.LigANI and LipL32 were predicted to contain poten-

tial N-glycosylation sites and treatment of the recombi-nant proteins with the enzymes Endo H and PNGase Fconfirmed that post-translational modification hadoccurred during production and secretion in P. pastoris,Figure 4. Deglycosylation removed the N-glycansattached to asparagine and when analysed by SDS-PAGE and Western blotting, rLigANI and rLipL32 hadsimilar molecular weights as the corresponding proteinsexpressed in E. coli. N-glycosylation in yeast has a com-position of MannGlcNAc2 (Man: Mannose; GlcNAc:N-acetylglucosamine), where n is the number of man-nose oligosaccharides attached to the structure. Thisnumber has been found to vary in P. pastoris from 3 to17, depending on the expressed protein [30,31]. Theattachment of a large number of mannose residues,known as hyperglycosylation, is rarely observed in P.pastoris, compared to S. cerevisiae which hyperglycosy-lates the majority of expressed proteins. Glycosylationcan be influenced by some of the bioprocess parametersused during growth and purification steps [32,33].Therefore, secreted proteins that are easily recoveredfrom the growth medium are likely to maintain thestructure of the recombinant protein. This may improvethe protective immune response against leptospirosiswhen rLigANI and rLipL32 are used as subunit vaccinecandidates.

ConclusionsWe believe that this is the first report of the use ofP. pastoris to express pathogenic Leptospira antigens.The aim of the study was to evaluate the large-scaleexpression of the vaccine candidates LigA and LipL32proteins in P. pastoris. The rLigANI and rLipL32

LigANI

1 2 3 E-LigANI 4 5 6 E-LipL32

61 kDa

E-rLipL32 E-LigANI 1 2 3 4 5 6

61 kDa

32 kDa

A

C

B

D

LipL32

32 kDa

32 kDa

61 kDa

rLipL32 rLigANI

Figure 5 Antigenicity of the various forms of rLigANI andrLipL32. Antigenicity was evaluated using rabbit anti-Leptospira sera(A) Lanes: 1 - rLigANI + PNGase F; 2 - rLigANI + Endo H; 3 -glycosylated rLigANI and (B) Lanes: 4 - rLipL32 + PNGase F; 5 -rLipL32 + Endo H; 6 - glycosylated rLipL32 or (C) convalescent serafrom leptospirosis patients, Lanes: 1 - glycosylated rLipL32; 2 -glycosylated rLigANI and (D) 3 - rLipL32 + PNGAse F; 4 - LipL32 +Endo H; 5 - rLigANI + PNGAse F; 6 - rLigANI + Endo H. E-LigANI (61kDa) and E-LipL32 (32 kDa) recombinant proteins were expressedand purified from E. coli.

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

Page 4 of 7

proteins described in this study were soluble and thepurification step used simple and inexpensive methods.Indeed, not only were the proteins expressed at a highlevel, but they retained the antigenic characteristics ofnative the proteins. Furthermore, glycosylated rLigANIand rLpiL32 were recognised by the antibodies presentsin the sera of leptospirosis patients and with antibodiesraised against a heterologous Leptospira serovar.

MethodsBacterial strains and growth conditionsL. interrogans serovar Copenhageni strain Fiocruz L1-130, originally isolated from a patient with severe leptos-pirosis [34], was cultivated in Ellinghausen-McCullough-Johnson-Harris (EMJH) medium supplemented withLeptospira Enrichment EMJH (Difco, USA) at 30°C. E.coli strain TOP10 (Invitrogen) was grown in Luria-Ber-tani (LB) medium (1% tryptone, 0.5% yeast extract, 0.5%NaCl and 2% agar) at 37°C with the addition of zeocinto 25 μg/mL. P. pastoris strain KM71 H (MutS, Invitro-gen) was grown in Yeast extract peptone dextrose(YPD) medium (1% yeast extract, 2% peptone and 2%D-glucose) supplemented with 100 μg/mL of zeocin at28°C.

Cloning ligA and lipL32We previously identified a C-terminal fragment of LigA,LigANI, as a vaccine candidate [13]. Primers to amplifythe DNA sequences coding for the LigANI polypeptideand the full-length lipL32 gene were designed accordingthe genome sequence of L. interrogans serovar Copenha-geni strain Fiocruz L1-130 [GenBank: AE016823]. Theprimer sequences (EcoRI and KpnI sites are underlined)used in this study were: ligANI_F: 5’-CGGAATTCAA-TAATGTCTGATATTCTTACCGT, ligANI_R: 5’-TAGGTACCATGGCTCCGTTTTAATAGAG andlipL32_F: 5’-CGGAATTCTAGGTGGTCTGCCAA,lipL32_R: 5’-GGGGTACCACTTAGTCGCGTCA. ThePCR products were cloned in-frame into the pPICZaBvector (Invitrogen, Brazil). The identity of the insertswas determined by DNA sequencing using the DYE-namic ET Dye Terminator Cycle Sequencing Kit forMegaBACE DNA Analysis Systems - MegaBACE 500(GE Healthcare, Brazil). Recombinant plasmids contain-ing the LigANI coding sequence, pPIC-LigANI, andlipL32, pPIC-LipL32, were propagated in E. coli TOP10,and the plasmids isolated using the Perfectprep PlasmidMaxi kit (Eppendorf, USA). The plasmids were linear-ized with restriction enzyme PmeI (New England Bio-Labs, USA). The linear plasmid DNA was purified byphenol-chloroform extraction and DNA precipitation.P. pastoris competent cells were transformed by electro-poration (25 μF, 200 Ω, 2 kV) with 10 μg of linear plas-mid DNA.

Screening for expression of recombinant LigANI andLipL32Approximately 150 colonies of each plasmid constructwere plated onto Buffered methanol-complex medium(BMMY: 1% yeast extract, 2% peptone, 1.34% yeastnitrogen base, 0.00004% biotin, 0.5% methanol, 100 mMpotassium phosphate and 2% agar, pH 6.0). Following24, 48 and 72 h incubation at 28°C, expression of rLi-gANI and rLipL32 was induced with 1% methanol andevaluated after 96 h. Expression of the recombinant pro-teins was confirmed by colony immunoblotting [35].Briefly, a nitrocellulose membrane (Hybond ECL, GEHealthcare) was placed onto the surface of each petridish and in direct contact with the colonies for 3 h at28°C. Any adherent matter was removed from the mem-brane by washing with PBST (PBS, pH 7.4, 0.05% (v/v)Tween 20). After blocking (PBST, 5% non-fat driedmilk), the membrane was incubated for 1 h at roomtemperature with anti-6×His-peroxidase conjugate(Sigma-Aldrich, Brazil) at a dilution of 1:8,000 in PBS.After three washes (5 min each) positive colonies weredetected with 4-chloro-1-naphthol (Sigma-Aldrich).The presence of the PCR products in the recombinant

plasmids was also confirmed by colony PCR. Crudegenomic DNA extracts were prepared by boilingselected yeast recombinant clones in water. PCR wasperformed as described above, using the crude genomicDNA extracts as template. PCR products were analysedby horizontal gel electrophoresis and visualized withGelRed (Uniscience, Brazil).

Expression of LigANI and LipL32 proteins in P. pastorisKM71HA recombinant clone for each construct (rLigANI andrLipL32), positive for expression and colony PCR, wasselected and inoculated into a 1 L baffled flask contain-ing 200 mL BMGY broth (differs from BMMY in thatthe 1% methanol is replaced by 1% glycerol). The cul-tures were incubated at 28°C, with shaking (250 rpm),for approximately 16-18 h until an OD600 of 2 to 6 wasreached. The cells were harvested by centrifugation at3,000 × g for 5 min and the cell pellet resuspended inthe supernatant equivalent to 1/10 of the originalvolume (20 mL). The culture was place in a 100 mLbaffled flask and return to the incubator. Expression wasinduced by the addition of methanol to a final concen-tration of 0.5%. Samples (supernatant and cells) werecollected at the following time points: 0, 24, 48, 72, 96,120, 144, 168 and 196 h and stored at -80°C. The cellpellets were suspended in breaking buffer (50 mMsodium phosphate, 1 mM PMSF, 1 mM EDTA and 5%glycerol) and an equal volume of acid-washed glassbeads (0.5 mm Ø). The samples were vortexed for 30 sfollowed by incubation on ice for 30 s (8 cycles),

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

Page 5 of 7

centrifuged at 16,000 × g for 10 min at 4°C and thecleared supernatant stored at -80°C.The expression of the recombinant proteins were ana-

lysed by (12%) sodium dodecyl sulphate-polyacrylamidegel electrophoresis (SDS-PAGE) and visualised by stain-ing with Coomassie Blue or Western blotting (WB).Samples were suspended in loading buffer (2% SDS, 500mM Tris pH 7.6, 1% bromophenol blue, 50% glyceroland 1% 2-mercaptoethanol) and boiled for 10 minbefore separation by SDS-PAGE. For the WB assay theproteins were electro transferred to a nitrocellulosemembrane (Hybond ECL, GE Healthcare). After block-ing, PBS, 5% non-fat dried milk, overnight at 4°C andthree washes (5 min per wash) in PBST, the membraneswere incubated for 1 h with anti-LipL32 Mab (1:500 inPBS) or mouse anti-LigANI polyclonal (1:500 in PBS),followed by 3 washes (5 min per wash) in PBST. Therabbit anti-mouse IgG peroxidase conjugate (Sigma-Aldrich), diluted 1:6,000 in PBS, was added and incu-bated for 1 h. The membranes were washed 5× in PBSTand the reactions were developed with 4-chloro-1-naphthol (Sigma-Aldrich).LigANI and LipL32 were produced in large-scale using

the P. pastoris MutS secretory phenotype, under thesame conditions described above. Briefly, P. pastoris wasgrown in BMGY medium (2 L) to an OD600 of 2 to 6,harvested by centrifugation and suspended in 200 mLBMMY expression medium (1/10 of the original culturevolume). The expression of the recombinant proteinswas induced for 144 h by the addition of methanol to0.5%. The supernatant containing the secreted recombi-nant proteins was cleared by centrifugation, and storedat -80°C.

Purification and concentration of rLigANI and rLipL32Three different strategies were used to purify and con-centrate the secreted recombinant proteins. The firststrategy was based on ammonium sulphate precipitation:85% ammonium sulphate was added to the culturesupernatant at 4°C, to final concentrations of: 25, 35, 45,60, 70 and 80%. The precipitated proteins were collectedby centrifugation at 10,000 × g for 15 min at 4°C, sus-pended in PBS and dialyzed in the same buffer for 48 h.Microcon YM-30 Amicon Bioseparation filters (Milli-pore, USA), 30 kDa cut-off, were used to concentratethe recombinant proteins expressed in the supernatant,following the manufacturer’s protocol. Alternatively,proteins were concentrated by lyophilisation (EdwardsMicro Modulyo) over 28 h and suspended in PBS,resulting in a 10-fold concentration of the initial sample.The protein concentration in culture supernatants, con-centrates and purified protein samples were determinedusing the BCA Protein Assay Kit (Pierce, USA) withbovine serum albumin (BSA) as a the standard.

Deglycosylation of rLigANI and rLipL32Purified rLigANI and rLipL32 (1-20 μg) were incubatedwith 1× glycoprotein reaction buffer at 100°C for 10min to completely denature the glycoproteins. Deglyco-sylation was carried out at 37°C for 1 h with 5× G5(Endoglycosidase H) or 10× G7 (N-Glycosidase F) reac-tion buffer and 1-5 μl of the relevant enzyme (Endogly-cosidase H or N-Glycosidase F) according to themanufacturer’s instructions (New England BioLabs).

Antigenicity of rLigANI and rLipL32The ability of the recombinant proteins to interact spe-cifically with products of the immune response wasdetermined by WB using sera collected from leptospiro-sis patients and hyperimmune sera from infected rabbits.The use of patient sera for these experiments wasapproved by the Internal Review Board of the GonçaloMoniz Institute, Fiocruz-BA. A pool of convalescentsera from severe leptospirosis patients was used at adilution of 1:300 and an anti-human IgG peroxidaseconjugate at a 1:2,000 dilution. Rabbit anti-Leptospirahyperimmune sera, specific to L. interrogans serovarCanicola strain Tande, was used at a dilution of 1:500and an anti-rabbit IgG peroxidase conjugate at a 1:3,000dilution.

AcknowledgementsThis work was supported by the Brazilian National Research Council (CNPq),grant 475540/2008-5, the Research Support Foundation for the State ofBahia (FAPESB), grant PES-0092/2008 (to AJAM) and the Oswaldo CruzFoundation (to AJAM). DDH and KMF received scholarships from CNPq. Thefunders had no role in study design, data collection and analysis, decision topublish, or preparation of the manuscript.

Author details1Núcleo de Biotecnologia, Centro de Desenvolvimento Tecnológico,Universidade Federal de Pelotas, Pelotas, RS, Brazil. 2Laboratório de Patologiae Biologia Molecular, Instituto Gonçalo Moniz, Fiocruz-BA, Salvador, BA, Brazil.

Authors’ contributionsDDH participated in the study design, performed the experiments and inthe writing of the manuscript. TLO performed the experiments. FKSparticipated in the construction of the plasmids. KMF and CPH participatedin the experiments on protein antigenicity and CR participated in theprotein purification steps. AJAM participated in the data analysis and thewriting of the manuscript. OAD coordinated the study and participated inthe writing of the manuscript. All authors read and approved the finalmanuscript.

Competing interestsAJAM and OAD are inventors on a patent submission entitled: LigA and LigBproteins (Leptospiral Ig-like (Lig) domains) for vaccination and diagnosis(Patent nos. BRPI0505529 and WO 2007070996). The other authors declareno competing interests.

Received: 25 October 2010 Accepted: 6 December 2010Published: 6 December 2010

References1. Bharti AR, Nally JE, Ricaldi JN, Matthias MA, Diaz MM, Lovett MA, Levett PN,

Gilman RH, Willig MR, Gotuzzo E, et al: Leptospirosis: a zoonotic disease ofglobal importance. Lancet Infect Dis 2003, 3(12):757-771.

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

Page 6 of 7

2. Adler B, de la Pena Moctezuma A: Leptospira and leptospirosis. VetMicrobiol 2010, 140(3-4):287-296.

3. Faine SB, Adler B, Bolin C, Perolat P: Leptospira and leptospirosis.Melbourne: MediSci;, 2 1999.

4. Reis RB, Ribeiro GS, Felzemburgh RD, Santana FS, Mohr S, Melendez AX,Queiroz A, Santos AC, Ravines RR, Tassinari WS, et al: Impact ofenvironment and social gradient on leptospira infection in urban slums.PLoS Negl Trop Dis 2008, 2(4):e228.

5. McBride AJ, Athanazio DA, Reis MG, Ko AI: Leptospirosis. Curr Opin InfectDis 2005, 18(5):376-386.

6. Gouveia EL, Metcalfe J, de Carvalho AL, Aires TS, Villasboas-Bisneto JC,Queirroz A, Santos AC, Salgado K, Reis MG, Ko AI: Leptospirosis-associatedSevere Pulmonary Hemorrhagic Syndrome, Salvador, Brazil. Emerg InfectDis 2008, 14(3):505-508.

7. Segura ER, Ganoza CA, Campos K, Ricaldi JN, Torres S, Silva H, Cespedes MJ,Matthias MA, Swancutt MA, Lopez Linan R, et al: Clinical spectrum ofpulmonary involvement in leptospirosis in a region of endemicity, withquantification of leptospiral burden. Clin Infect Dis 2005, 40(3):343-351.

8. Haake DA, Mazel MK, McCoy AM, Milward F, Chao G, Matsunaga J,Wagar EA: Leptospiral outer membrane proteins OmpL1 and LipL41exhibit synergistic immunoprotection. Infect Immun 1999,67(12):6572-6582.

9. Yan W, Faisal SM, McDonough SP, Chang CF, Pan MJ, Akey B, Chang YF:Identification and characterization of OmpA-like proteins as novelvaccine candidates for Leptospirosis. Vaccine 2010, 28(11):2277-2283.

10. Wang Z, Jin L, Wegrzyn A: Leptospirosis vaccines. Microb Cell Fact 2007,6:39.

11. Koizumi N, Watanabe H: Leptospiral immunoglobulin-like proteins elicitprotective immunity. Vaccine 2004, 22(11-12):1545-1552.

12. Yan W, Faisal SM, McDonough SP, Divers TJ, Barr SC, Chang CF, Pan MJ,Chang YF: Immunogenicity and protective efficacy of recombinantLeptospira immunoglobulin-like protein B (rLigB) in a hamster challengemodel. Microbes Infect 2009, 11(2):230-237.

13. Silva EF, Medeiros MA, McBride AJ, Matsunaga J, Esteves GS, Ramos JG,Santos CS, Croda J, Homma A, Dellagostin OA, et al: The terminal portionof leptospiral immunoglobulin-like protein LigA confers protectiveimmunity against lethal infection in the hamster model of leptospirosis.Vaccine 2007, 25(33):6277-6286.

14. Palaniappan RU, McDonough SP, Divers TJ, Chen CS, Pan MJ, Matsumoto M,Chang YF: Immunoprotection of recombinant leptospiralimmunoglobulin-like protein A against Leptospira interrogans serovarPomona infection. Infect Immun 2006, 74(3):1745-1750.

15. Feng CY, Li QT, Zhang XY, Dong K, Hu BY, Guo XK: Immune strategiesusing single-component LipL32 and multi-component recombinantLipL32-41-OmpL1 vaccines against leptospira. Braz J Med Biol Res 2009,42(9):796-803.

16. Seixas FK, da Silva EF, Hartwig DD, Cerqueira GM, Amaral M, Fagundes MQ,Dossa RG, Dellagostin OA: Recombinant Mycobacterium bovis BCGexpressing the LipL32 antigen of Leptospira interrogans protectshamsters from challenge. Vaccine 2007, 26(1):88-95.

17. Branger C, Chatrenet B, Gauvrit A, Aviat F, Aubert A, Bach JM, Andre-Fontaine G: Protection against Leptospira interrogans sensu latochallenge by DNA immunization with the gene encoding hemolysin-associated protein 1. Infect Immun 2005, 73(7):4062-4069.

18. Sonrier C, Branger C, Michel V, Ruvoen-Clouet N, Ganiere JP, Andre-Fontaine G: Evidence of cross-protection within Leptospira interrogans inan experimental model. Vaccine 2000, 19(1):86-94.

19. Sorensen HP: Towards universal systems for recombinant geneexpression. Microb Cell Fact 2010, 9:27.

20. Cos O, Ramon R, Montesinos JL, Valero F: Operational strategies,monitoring and control of heterologous protein production in themethylotrophic yeast Pichia pastoris under different promoters: areview. Microb Cell Fact 2006, 5:17.

21. Cregg JM, Cereghino JL, Shi J, Higgins DR: Recombinant proteinexpression in Pichia pastoris. Mol Biotechnol 2000, 16(1):23-52.

22. Faisal SM, Yan W, Chen CS, Palaniappan RU, McDonough SP, Chang YF:Evaluation of protective immunity of Leptospira immunoglobulin likeprotein A (LigA) DNA vaccine against challenge in hamsters. Vaccine2008, 26(2):277-287.

23. Faisal SM, Yan W, McDonough SP, Chang YF: Leptospira immunoglobulin-like protein A variable region (LigAvar) incorporated in liposomes and

PLGA microspheres produces a robust immune response correlating toprotective immunity. Vaccine 2009, 27(3):378-387.

24. Faisal SM, Yan W, McDonough SP, Chang CF, Pan MJ, Chang YF:Leptosome-entrapped leptospiral antigens conferred significant higherlevels of protection than those entrapped with PC-liposomes in ahamster model. Vaccine 2009, 27(47):6537-6545.

25. Habarta A, Abreu PA, Olivera N, Hauk P, Cedola MT, Ferrer MF, Ho PL,Gomez RM: Increased Immunogenicity to LipL32 of Leptospirainterrogans when Expressed as a Fusion Protein with the Cholera ToxinB Subunit. Curr Microbiol 2010.

26. Ko AI, Goarant C, Picardeau M: Leptospira: the dawn of the moleculargenetics era for an emerging zoonotic pathogen. Nat Rev Microbiol 2009,7(10):736-747.

27. Matsunaga J, Barocchi MA, Croda J, Young TA, Sanchez Y, Siqueira I,Bolin CA, Reis MG, Riley LW, Haake DA, et al: Pathogenic Leptospiraspecies express surface-exposed proteins belonging to the bacterialimmunoglobulin superfamily. Mol Microbiol 2003, 49(4):929-945.

28. Palaniappan RU, Chang YF, Jusuf SS, Artiushin S, Timoney JF,McDonough SP, Barr SC, Divers TJ, Simpson KW, McDonough PL, et al:Cloning and molecular characterization of an immunogenic LigA proteinof Leptospira interrogans. Infect Immun 2002, 70(11):5924-5930.

29. Seixas FK, Fernandes CH, Hartwig DD, Conceicao FR, Aleixo JA,Dellagostin OA: Evaluation of different ways of presenting LipL32 to theimmune system with the aim of developing a recombinant vaccineagainst leptospirosis. Can J Microbiol 2007, 53(4):472-479.

30. Daly R, Hearn MT: Expression of heterologous proteins in Pichia pastoris:a useful experimental tool in protein engineering and production. J MolRecognit 2005, 18(2):119-138.

31. Montesino R, Garcia R, Quintero O, Cremata JA: Variation in N-linkedoligosaccharide structures on heterologous proteins secreted by themethylotrophic yeast Pichia pastoris. Protein Expr Purif 1998, 14(2):197-207.

32. Goochee CF, Monica T: Environmental effects on protein glycosylation.Biotechnology (NY) 1990, 8(5):421-427.

33. Jenkins N, Parekh RB, James DC: Getting the glycosylation right:implications for the biotechnology industry. Nat Biotechnol 1996,14(8):975-981.

34. Ko AI, Galvao Reis M, Ribeiro Dourado CM, Johnson WD, Riley LW: Urbanepidemic of severe leptospirosis in Brazil. Salvador Leptospirosis StudyGroup. Lancet 1999, 354(9181):820-825.

35. Sambrook J, Russell DW: Molecular Cloning: A Laboratory Manual. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory Press;, 3 2000.

doi:10.1186/1475-2859-9-98Cite this article as: Hartwig et al.: High yield expression of leptospirosisvaccine candidates LigA and LipL32 in the methylotrophic yeast Pichiapastoris. Microbial Cell Factories 2010 9:98.

Submit your next manuscript to BioMed Centraland take full advantage of:

• Convenient online submission

• Thorough peer review

• No space constraints or color figure charges

• Immediate publication on acceptance

• Inclusion in PubMed, CAS, Scopus and Google Scholar

• Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit

Hartwig et al. Microbial Cell Factories 2010, 9:98http://www.microbialcellfactories.com/content/9/1/98

Page 7 of 7