universidade federal de santa catarina centro de ciÊncias biolÓgicas programa de...
TRANSCRIPT
UNIVERSIDADE FEDERAL DE SANTA CATARINA
CENTRO DE CIÊNCIAS BIOLÓGICAS
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOQUÍMICA
Mark William Lopes
MODULAÇÃO DO RECEPTOR AMPA, MAPKS, AKT E
EXPRESSÃO DE TRANSPORTADORES DE GLUTAMATO E
RECEPTOR NMDA NO HIPOCAMPO E CÓRTEX DE RATOS
SUBMETIDOS AO MODELO DE EPILEPSIA INDUZIDO POR
PILOCARPINA
Dissertação apresentada ao Programa
de Pós-Graduação em Bioquímica do
Centro de Ciências Biológicas da
Universidade Federal de Santa
Catarina, como requisito parcial para
obtenção do Título de Mestre em
Bioquímica.
Orientador: Dr.Rodrigo Bainy Leal
Co-orientador: Dr. Roger Walz
FLORIANÓPOLIS
2012
ii
Catalogação na fonte elaborada pela biblioteca da
Universidade Federal de Santa Catarina
iii
AGRADECIMENTOS
Mais árduo que realizar este trabalho, é encontrar palavras certas para
agradecer às pessoas especiais que fazem parte da minha vida, e sem as
quais eu jamais teria chegado até aqui. Através destas páginas
simbólicas, deixo registrado meu profundo agradecimento:
A Deus, pela vida e por proporcionar-me diferentes caminhos, dando-
me sempre oportunidades de escolha e guiando-me através delas.
Aos meus pais, Rose e Pedro, pela contribuição na formação do meu
caráter, pelo amor incondicional, apoio, incentivo e dedicação da vida
toda.
À minha irmã Samantha por estar sempre ao meu lado, compartilhando
alegrias e batalhando junto nos momentos difíceis.
À minha irmã Sula e cunhado Djony, pela amizade, companhia e apoio
durante a realização desse trabalho.
À minha namorada, Djulia, pela cumplicidade, amor, carinho, paciência,
compreensão e incentivo durante toda esta trajetória.
À minha querida família (tios, tias, primos, primas) pela companhia,
carinho, apoio e atenção nesses anos de convivência.
A meu orientador prof. Dr. Rodrigo Bainy Leal por possibilitar a
execução deste trabalho, pela amizade, incentivo, pela confiança
depositada e pelos valiosos ensinamentos durante todo o período em que
trabalhamos juntos.
Ao meu co-orientador prof. Dr. Roger Walz pela orientação, amizade e
significativo aprendizado científico.
Ao Laboratório de Neuroquímica III-Transdução de Sinal no SNC, à
nossa grande amizade... Amanda, Ana Paula, Carol, Débora, Daniele,
Fabiano, Filipe, Mariana, Tanara... E por toda a colaboração essencial
no trabalho.
A todos os demais professores, funcionários e colegas do Programa de
Pós-Graduação em Bioquímica.
iv
À CAPES pelo apoio financeiro que possibilitou a execução desse
projeto.
A todas as pessoas que contribuíram no desenvolvimento desse trabalho,
as quais, direta ou indiretamente, participaram da minha formação como
profissional e ser humano.
Aos que acreditaram na minha capacidade, que torceram pela minha
vitória e que me ajudaram de alguma maneira para a conquista de mais
um sonho.
A todos vocês, fica a minha eterna gratidão.
v
RESUMO
Epilepsia é uma doença crônica caracterizada por ataques epilépticos
recorrentes. Cerca de 20-30% dos pacientes com epilepsia não obtém
controle satisfatório das crises mesmo com uso adequado de fármacos.
Em animais a administração de pilocarpina tem sido utilizada como
modelo experimental de epilepsia, reproduzindo em roedores as
principais características da epilepsia do lobo temporal mesial associada
à esclerose do hipocampo (ELTM-EH) em seres humanos. Nesse
modelo a administração de pilocarpina (Pilo-SE) induz o status
epilepticus, onde as crises podem perdurar algumas horas (período
agudo). A seguir o animal passa por um período com melhora e
remissão espontânea das crises (período latente/4-44 dias). Finalmente,
no período crônico (após 45 dias), os animais passam a apresentar crises
espontâneas recorrentes (2-4 crises/animal/semana). Os neurônios da
área epileptogênica apresentam peculiaridades em sua fisiologia que os
tornam propensos ao surgimento de descargas assíncronas. Sistemas de
sinalização inter e intracelular são fundamentais na modulação da
atividade sináptica e podem estar envolvidos na fisiopatologia da
epilepsia. Entre os alvos de importância podemos destacar: a) sistema
glutamatérgico, via receptores NMDA, AMPA e transportadores gliais
de glutamato (EAAT1 e 2); b) proteínas cinases como MAPKs (ERK,
JNK, p38MAPK
) e AKT. No presente estudo foi avaliado o perfil de
fosforilação de MAPKs, AKT e da subunidade GluR1 do receptor
AMPA (por western blotting) e o perfil de expressão dos transportadores
de glutamato EAAT1 e 2 e da subunidade NR1 do receptor NMDA (por
qRT-PCR) no hipocampo (Hip) e córtex (Ctx) de ratos adultos
submetidos ao modelo da pilocarpina. As estruturas foram retiradas 1h,
3h, 12h (período agudo), 5 dias (período latente) e 50 dias (período
crônico) após administração de Pilo-SE. Os principais resultados
incluem: 1) aumento da fosforilação da subunidade GluR1 do receptor
AMPA no sítio Ser831
no Hip e Ser845
no Ctx no período agudo e
diminuição de seu conteúdo total no período latente; 2) ativação de
ERK1 e p38MAPK
em ambas as estruturas 1 e 12h após o início do Pilo-
SE. A fosforilação da isoforma JNK2/3 (54kDa) diminuiu 3h após a
administração de Pilo-SE e na fase crônica no Hip e Ctx. A fosforilação
de AKT aumentou somente no Hip e durante o período latente. Em
relação ao perfil de expressão da subunidade NR1 do receptor NMDA e
os transportadores gliais de glutamato, encontramos uma diminuição na
expressão do mRNA da subunidade NR1 e transportadores EAAT1 e 2
no Ctx, no período latente. No Hip a expressão do transportador EAAT2
vi
diminuiu e a expressão da subunidade NR1 aumentou no período
crônico. Os resultados demonstram alterações na transdução de sinal,
expressão da subunidade NR1 e transportadores EAAT1 e 2 no Ctx e
Hip após administração de Pilo-SE de forma dependente da estrutura e
tempo. Estas alterações podem ser importantes para o estabelecimento
de modificações neurogliais relacionadas a formação de uma área
epileptogênica na ELTM-EH.
Palavras-chave: Epilepsia, Pilocarpina, Receptor AMPA e NMDA,
MAPKs, AKT.
vii
ABSTRACT
Epilepsy is a chronic disease characterized by recurrent seizures. About
20-30% of patients with epilepsy do not get satisfactory control of
seizures even with proper use of drugs. In animals, pilocarpine has been
used as an experimental model of epilepsy, reproducing in rodents the
main features of mesial temporal lobe epilepsy associated with
hippocampal sclerosis (MTLE-HS) in humans. In this model pilocarpine
(Pilo-SE) administration induces the status epilepticus with the seizures
occurring for several hours (acute period). Thereafter, the animal goes
through a period with progressive improvement and spontaneous
remission of seizures (latent period/4-44 days). Finally, in the chronic
period (after 45 days) the animals begin to display spontaneous recurrent
seizures (2-4 seizures/animal/week). The neurons in the epileptogenic
area display intrinsic peculiarities in their physiology that make them
proper to asynchronous discharges. Intercellular and intracellular
signaling pathways are critical for modulation of synaptic activity and
may be involved in the pathophysiology of epilepsy. Targets of
importance can be highlighted such as: a) the glutamatergic system via
AMPA, NMDA receptors and glial glutamate transporters (EAAT1 and
2); b) protein kinases such as MAPKs (ERK, p38MAPK
, JNK) and AKT.
In the present study it was evaluated the profile of phosphorylation of
MAPKs, AKT and AMPA receptor GluR1 subunit (by western blotting)
and the profile of expression of glial glutamate transporters and NMDA
receptor NR1 subunit (by qRT-PCR) in the hippocampus (Hip) and
cortex (Ctx) of adult rats submitted the pilocarpine model. The
structures were removed 1h, 3h, 12h (acute period), 5 days (latent
period) and 50 days (chronic period) after Pilo-SE administration. The
main results include: 1) increased phosphorylation of the GluR1 subunit
of AMPA receptor on the site Ser845
in the Ctx and on Ser831
in the Hip
in the acute period and decrease of the total content of the GluR1
subunit in the latent period; 2) activation of ERK1 and p38MAPK
in both
structures 1 and 12h after the onset of Pilo-SE. Phosphorylation of
isoform JNK2/3 (54kDa) decreased 3h after the onset Pilo-SE and in the
chronic phase in the Hip and Ctx. The AKT phosphorylation increased
only in the Hip during the latent period. Regarding the profile of
expression of NR1 subunit of the NMDA receptor and glial glutamate
transporters, we found a decrease in mRNA expression of NR1 subunit
and transporters EAAT1 and 2 in the Ctx, in the latent period. In the Hip
the expression of the transporter EAAT2 decreased while the expression
of the NR1 subunit increased, both in the chronic period. Our results
viii
show a temporal profile of changes in the activity of intracellular
signaling elements and expression of the NR1 subunit and transporters
EAAT1 and 2 in the pilocarpine model in a manner dependent of
structure. These changes may produce neuroglial modifications
associated with the establishment of a epileptogenic area in the MTLE-
HS.
Key words: Epilepsy, Pilocarpine, AMPA and NMDA receptor,
MAPKs, AKT.
ix
LISTA DE FIGURAS
LISTA DE FIGURAS DA DISSERTAÇÃO
Figura 1. Famílias moleculares dos receptores
glutamatérgicos.......................................................................................20
Figura 2. Regulação coordenada dos receptores glutamatérgicos AMPA
e NMDA nos fenômenos de LTP e LTD............................................... 22
Figura 3. Regulação da fosforilação e tráfego da subunidade GluR1 do
receptor AMPA nas sinapses durante LTP e LTD.................................24
Figura 4. Neurotransmissão excitatória glutamatérgica........................26
Figura 5. Cascata de sinalização das proteínas cinases ativadas por
mitógenos................................................................................................29
Figura 6. Esquema de tratamento dos animais e análise das amostras
obtidas.....................................................................................................33
Figura 7. Eletroforese, Eletrotransferência e Imunodetecção...............35
LISTA DE FIGURAS DO MANUSCRITO 1
Figura 1. Análise por Western Blotting da fosforilação da subunidade
GluR1 do receptor AMPA no hipocampo e córtex de ratos submetidos
ao modelo de epilepsia induzido por pilocarpina...................................53
Figura 2. Visão global da fosforilação dos diferentes sítios da
subunidade GluR1 do receptor AMPA no hipocampo e córtex de ratos
submetidos ao modelo de epilepsia induzido por
pilocarpina..............................................................................................54
Figura 3. Análise em tempo real por qPCR dos níveis de expressão do
mRNA dos transportadores de glias (EAATs) no hipocampo e córtex de
ratos submetidos ao modelo de epilepsia induzido por
pilocarpina..............................................................................................55
Figura 4. Análise em tempo real por qPCR dos níveis de expressão do
mRNA da subunidade NR1 do receptor NDMA no hipocampo e córtex
x
de ratos submetidos ao modelo de epilepsia induzido por
pilocarpina..............................................................................................56
Figura 5. Visão global dos níveis de expressão do mRNA dos
transportadores gliais (EAATs) e subunidade NR1 do receptor NMDA
no hipocampo e córtex de ratos submetidos ao modelo de epilepsia
induzido por pilocarpina.........................................................................57
LISTA DE FIGURAS DO MANUSCRITO 2
Figura 1. Esquema de tratamento dos animais e análise das amostras
obtidas.....................................................................................................81
Figura 2. Análise por Western Blotting da fosforilação/ativação das
proteínas ERK1/2 no hipocampo e córtex de ratos submetidos ao
modelo de epilepsia induzido por pilocarpina........................................82
Figura 3. Análise por Western Blotting da fosforilação/ativação da
proteína p38MAPK
no hipocampo e córtex de ratos submetidos ao modelo
de epilepsia induzido por pilocarpina.....................................................83
Figura 4. Análise por Western Blotting da fosforilação/ativação das
proteínas JNK1/2/3 no hipocampo e córtex de ratos submetidos ao
modelo de epilepsia induzido por pilocarpina........................................84
Figura 5. Análise por Western Blotting fosforilação/ativação da
proteína AKT no hipocampo e córtex de ratos submetidos ao modelo de
epilepsia induzido por pilocarpina..........................................................85
Figura 6. Visão global da fosforilação/ativação das MAPKs (ERK 1/2,
p38MAPK
e JNK 1/2/3) e AKT no hipocampo e córtex de ratos
submetidos ao modelo de epilepsia induzido por
pilocarpina............................................................................................. 86
xi
LISTA DE TABELAS
Tabela 1. Representação dos resultados estatisticamente significativos
da fosforilação da subunidade GluR1 de AMPA, MAPKs e AKT no
hipocampo e córtex de ratos submetidos ao modelo de epilepsia
induzido por pilocarpina.........................................................................87
Tabela 2. Representação dos resultados estatisticamente significativos
da expressão relativa do mRNA de EAAT1, EAAT2 e NR1 no
hipocampo e córtex de ratos submetidos ao modelo de epilepsia
induzido por pilocarpina.........................................................................88
xii
LISTA DE ABREVIATURAS E SIGLAS
AMPA: Ácido-amino-3-hidroxi-5-metil-4-isoxazolepropiônico
BNDF: Fator neurotrófico derivado do cérebro
BSA: Soro Albumina bovina
CaM: Cálcio calmodulina
CaMKII: Proteína cinase cálcio calmodulina-dependente II
cDNA: Ácido Desoxirribonucleico complementar
EAATs: Transportadores de aminoácidos excitatórios
EAF: Estímulos de alta frequência
EBF: Estímulos de baixa frequência
ELTM-EH: Epilepsia de lobo temporal mesial associada a esclerose do
hipocampo
ERK: Cinase regulada por sinal extracelular
GABA: Ácido γ-aminobutírico
GAPDH: Gliceraldeído 3 fosfato desidrogenase
GLAST: Transportador de glutamato-aspartato
GLT1: Transportador de glutamato 1
IPI: Insulto precipitante inicial
JNK: c-Jun cinase amino-terminal
KA: Ácido caínico
LTD: Despotenciação de longa duração
LTP: Potenciação de longa duração
M1: Receptores muscarínicos tipo 1
MAPKK: Cinase da MAP cinase
MAPKKK: Cinase da cinase das MAP cinases
MAPKs: Proteínas cinases ativadas por mitógenos
mRNA: Ácido Ribonucleico mensageiro
NMDA: N-metil-D-aspartato
NUPNEC: Núcleo de Pesquisas em Neurologia Experimental e Clínica
PI3K: Fosfatidilinositol 3 cinase
PILO-SE: Status epilepticus induzido por pilocarpina
PKA: Proteína cinase A
PKC: Proteína cinase C
PMSF: Fluoreto de sulfonilmetilfenil
PP1: Proteína fosfatase 1
PP2B: Proteína fosfatase 2B
qRT-PCR: Reação em cadeia da polimerase em tempo real quantitativo
RNA: Ácido Ribonucleico
SDS: Dodecil sulfato de sódio
SDS-PAGE: Eletroforese em gel de poliacrilamida contendo SDS
xiii
SE: Status epilepticus
SNC: Sistema Nervoso Central
TBS: Solução Salina Tamponada com Tris
TBS-T: Solução Salina Tamponada com Tris e Tween
UFSC: Universidade Federal de Santa Catarina
xiv
SUMÁRIO
RESUMO ........................................................................................................... v
ABSTRACT .................................................................................................... vii
LISTA DE FIGURAS .......................................................................................ix
LISTA DE TABELAS ......................................................................................xi
LISTA DE ABREVIATURAS E SIGLAS .................................................... xii
1.1 EPILEPSIA ................................................................................................. 17
1.1.1 A Epilepsia do lobo temporal mesial associada à esclerose do
hipocampo ........................................................................................................ 17
1.2 MODELO DA PILOCARPINA .................................................................. 18
1.3 TRANSMISSÃO GLUTAMATÉRGICA ................................................... 19
1.3.1 Potenciação e Despotenciação sináptica ................................................ 21
1.3.2 Regulação do receptor AMPA ............................................................... 23
1.3.3 Transportadores Gliais de Glutamato .................................................. 25
1.4 EPILEPTOGÊNESE E TRANSDUÇÃO DE SINAL ................................. 26
1.4.1 Via das MAPKs ....................................................................................... 27
1.4.2 AKT/PKB ................................................................................................ 29
2 JUSTIFICATIVA ......................................................................................... 30
3 OBJETIVOS ................................................................................................. 30
3.1 OBJETIVO GERAL .................................................................................... 30
3.1.1 Objetivos específicos ............................................................................... 31
4 MATERIAIS E MÉTODOS ........................................................................ 32
4.1 MODELO ANIMAL ................................................................................... 32
4.2 ESTUDOS NEUROQUÍMICOS ................................................................. 33
4.2.1 Preparação das amostras ....................................................................... 33
4.2.2 Eletroforese e Eletrotransferência......................................................... 34
4.2.3 Imunodetecção ........................................................................................ 34
4.3 ISOLAMENTO DO RNA TOTAL ............................................................. 36
4.3.1 qRT-PCR ................................................................................................. 36
4.4 ANÁLISE DOS RESULTADOS ................................................................ 37
5 RESULTADOS ............................................................................................. 37
xv
5.1 MANUSCRITO 1 ....................................................................................... 39
5.2 MANUSCRITO 2 ....................................................................................... 63
5.3 TABELAS ADICIONAIS .......................................................................... 87
6 DISCUSSÃO ................................................................................................ 89
7 CONCLUSÕES ............................................................................................ 95
8 PERSPECTIVAS ......................................................................................... 96
9 REFERÊNCIAS ........................................................................................... 97
17
1 INTRODUÇÃO
1.1 EPILEPSIA
Transtornos convulsivos são uma das condições neurológicas mais
comuns atingindo cerca de 50 milhões de pessoas em todo o mundo
(Sander, 2003). A epilepsia, uma doença crônica caracterizada por
ataques epilépticos recorrentes pode variar de acordo com a idade, sexo,
raça, tipo de síndrome epiléptica e condição socioeconômica (Engel &
Pedley, 1997, Glibin & Blumenfeld, 2010). Estima-se que a prevalência
de epilepsia na maior parte do mundo seja em torno de 4-10 por 1.000
(Beleza, 2009). Há poucos estudos epidemiológicos confiáveis sobre
epilepsia no Brasil, porém supondo que a prevalência de epilepsia no
Brasil fosse igual à descrita em Porto Alegre (16.5/1.000 de epilepsia
ativa) (Fernandes et al., 1992) e levando em conta que a população
Brasileira era de 190.732.694 (Censo Demográfico, IBGE 2010),
teríamos atualmente cerca de 3.200.000 pacientes epilépticos no país.
Estes dados colocam a epilepsia como um problema de saúde relevante
no país e no mundo, justificando claramente a necessidade de
investimentos na capacitação de recursos tanto na área de assistência
como também de pesquisa básica deste processo.
1.1.1 A Epilepsia do lobo temporal mesial associada à esclerose do
hipocampo
Em torno de 20 a 30% dos pacientes com epilepsia não obtém
controle satisfatório das crises mesmo com uso adequado de fármacos,
sendo estes candidatos à avaliação pré-cirúrgica (Beleza, 2009). Estima-
se que 70-80% das séries cirúrgicas de casos intratáveis
farmacologicamente sejam de epilepsia de lobo temporal mesial
associada à esclerose do hipocampo (ELTM-EH) (Engel, 1996). Esta
síndrome é frequentemente associada à história de um “insulto
precipitante inicial” (IPI) na infância, podendo este ser uma crise
epiléptica prolongada associada ou não a febre, ou outro insulto
neurológico (ex. traumatismo crânio-encefálico, meningite). Após um
período variável, em geral anos, surgem crises recorrentes as quais podem tornar-se intratáveis farmacologicamente. Histopatologicamente
observa-se uma perda neuronal severa de neurônios no hipocampo
associada à reorganização sináptica e brotamento de fibras musgosas no
giro denteado (Mathem & Babb, 1997). Entretanto, atualmente é bem
reconhecido que outras estruturas cerebrais além do hipocampo sofrerão
18
plasticidade neuronal e glial incluindo a amigdala, neocortex entre
outras regiões (Sperk et al., 2009). O tratamento cirúrgico da epilepsia
de lobo temporal é mundialmente reconhecido, (Wiebe et al., 2001) e
beneficia a longo prazo em torno de 70% dos pacientes com ELTM-EH.
Mesmo que a localização da área epileptogênica seja feita corretamente,
ainda assim em 20 a 40% dos casos o sucesso pode não ser completo,
permanecendo o paciente com manifestações menores (“auras” ou crises
raras) ou menos freqüentemente, sem nenhuma melhora. Tais achados
podem sugerir que para cada caso em particular existam “alterações
neuroquímicas, histopatológicas e de circuitos neurofisiológicos”
próximos e distantes da zona epileptogênica que contribuam para as
diferentes características clínico-neurofisiológicas de epileptogênese,
propagação das crises e possivelmente, resposta ao tratamento, seja este
cirúrgico ou farmacológico.
1.2 MODELO DA PILOCARPINA
A capacidade de reproduzir as doenças humanas em modelos
animais apresenta uma grande vantagem para a medicina moderna
experimental. O modelo da pilocarpina é altamente isomórfico com a
doença humana, e tem sido amplamente utilizado em laboratórios de
pesquisa por todo o mundo (Hamilton et al., 1997, Priel et al., 2002). A
pilocarpina parece induzir o estado epilético de uma forma depende da
ativação dos receptores muscarínicos M1, pois camundongos
“knockout” para o receptor M1 não desenvolvem crises em resposta a
pilocarpina (Turski et al., 1984). Experimentos em neurônios
hipocampais mantidos em cultura têm demonstrado que a pilocarpina,
por intermédio dos receptores muscarínicos, provoca um desequilíbrio
entre excitação e a transmissão inibitória resultando na geração do
estado epilético (Turski et al., 1983). Além disso, em estudos de
microdiálise in vivo a pilocarpina parece induzir a elevação dos níveis
de glutamato no hipocampo após o aparecimento de convulsões
(Smolders et al., 1997).
As crises convulsivas provocadas pela administração de pilocarpina
tornam-se rapidamente generalizadas e evoluem para o status epilepticus
(Pilo-SE) que pode perdurar por algumas horas (24horas) (período
agudo). O SE é seguido por um período latente ''sem crises" com
aparente normalização comportamental (4-44 dia após Pilo-SE). O
período crônico (após 45 dias) é caracterizado pela presença de crises
espontâneas e recorrentes (2-4/animal/semana) que podem perdurar por
até 15 meses. As crises em geral iniciam no hipocampo com propagação
19
para o córtex cerebral e manifestam-se clinicamente por movimentos
mastigatórios, piscamentos seguidos, movimentos clônicos da cabeça e
crise motora límbica. Histopatologicamente observa-se uma perda
neuronal no hipocampo, amígdala, tálamo, córtex piriforme, córtex
entorrinal, neocortex e substância negra. Após o quarto dia identificam-
se brotamentos supra granulares de fibras musgosas, que atingem a
máxima intensidade aos 100º dia. A perda celular no hipocampo é mais
significativa nas regiões CA1, CA3 e giro denteado (Mello et al., 1993).
Os achados são bastante consistentes com a histopatologia da esclerose
do hipocampo em humanos (Mathern et al., 1995, Mathem & Babb,
1997) conforme colocado anteriormente.
No modelo da pilocarpina, sabidamente os animais seguem um
padrão de desenvolvimento de subsequente potenciação (kindling) até o
surgimento das crises clínicas (Cavalheiro et al., 1991). Considerando a
possibilidade de participação do fenômeno de potenciação de longa
duração (LTP) no fenômeno de kindling e epileptogênese (Leite et al.,
2005), pode ser formulada a hipótese de que a evolução (surgimento)
das crises epilépticas no modelo da pilocarpina envolva o fenômeno de
LTP. Por outro lado, deve também ser considerado o fenômeno de
“despotenciação de longa duração” (do inglês long-term depression;
LTD), que corresponde a uma diminuição no potencial excitatório pós-
sináptico em decorrência da aplicação de estímulos de baixa freqüência
(Bear, 1996, 1999). As bases neuroquímicas envolvidas no processo
epiléptico são pouco entendidas até o momento.
1.3 TRANSMISSÃO GLUTAMATÉRGICA
O aminoácido glutamato é o principal neurotransmissor excitatório
no sistema nervoso central (SNC) de mamíferos (Attwell, 2000,
Tzschentke, 2002). Muitos estudos realizados ao longo dos últimos anos
têm comprovado o papel da transmissão glutamatérgica no
desenvolvimento neural, na plasticidade sináptica fisiológica
(fundamental nos processos de aprendizado e memória), bem como na
neuroplasticidade patológica (envolvendo reorganização sináptica e
morte celular) observados em processos como: isquemia, hipoglicemia,
epilepsia, doenças neurodegenerativas, dependência e tolerância a
drogas, dor neuropática, ansiedade e depressão (Meldrum, 2000,
Ottersen & Mathisen, 2000).
As ações do glutamato são mediadas por duas classes de
receptores: a) ionotrópicos, que formam os canais iônicos; b)
metabotrópicos, acoplados às proteínas G. Os receptores metabotrópicos
20
são subdivididos em 3 grupos e podem agir através da ativação da
fosfolipase C ou por modulação da enzima adenilato ciclase
(Obrenovitch, 1997). Os receptores ionotrópicos possuem propriedades
farmacológicas e fisiológicas que os subdividem em três populações
distintas farmacológica e funcionalmente: os ativados por N-metil-D-
aspartato (NMDA), os que respondem ao ácido caínico (KA), e os
sensíveis ao ácido-amino-3-hidroxi-5-metil-4-isoxazolepropiônico
(AMPA) (Michaelis, 1998). A figura 1 mostra as famílias moleculares
dos receptores glutamatérgicos.
Figura 1. Famílias moleculares dos receptores glutamatérgicos. As duas
divisões principais dos receptores glutamatérgicos compreendem três subgrupos
funcionalmente definidos (classes) do receptor. Estes são compostos de várias
subunidades individuais, cada uma codificada por um gene diferente. Adaptado
de Siegel e colaboradores (2006).
Aos receptores AMPA e cainato é atribuída a neurotransmissão
excitatória rápida e os canais formados por estes receptores são
permeáveis primariamente aos íons sódio (Na+) e potássio (K
+). Os
receptores NMDA consistem de um canal iônico central (permeável ao
Ca2+
) e diversos sítios de modulação pelos quais neurotransmissores e
drogas podem interagir e afetar a atividade do receptor (McBain et al.,
1994). Os receptores NMDA existem, primariamente, como complexos
tetraméricos formados por duas subunidades NR1 e duas subunidades
regulatórias NR2 ou NR3. Existem pelo menos oito variantes de splicing
da subunidade NR1, quatro genes para a subunidade NR2 (NR2A, 2B,
2C e 2D) e dois genes para as subunidades NR3 (NR3A e NR3B). A
combinação entre as subunidades determina as propriedades funcionais
21
e vias de sinalização moduladas pelos receptores NMDA (Sanderson &
Dell’aqua, 2011). No cérebro a composição NR1/NR2A ou NR1/NR2B
são as mais abundantes. O sítio de união para o glutamato encontra-se
na subunidade NR2 enquanto o sítio para os co-agonistas glicina e D-
serina encontram-se na subunidade NR1 (Sanacora et al., 2008).
No potencial de repouso, o canal do receptor NMDA é bloqueado
pelo íon magnésio. Durante a transmissão sináptica, a ativação dos
receptores NMDA requer a união de glutamato e seus co-agonistas em
combinação com a despolarização do potencial de membrana para
permitir a liberação do íon de magnésio para a abertura do canal (Cull-
Candy et al., 2001, Waxman et al., 2005). Portanto, os receptores
NMDA respondem mais lentamente ao glutamato, contribuindo com o
componente lento das correntes pós-sinápticas excitatórias e sendo
altamente permeáveis aos íons Ca2+
. Devido a essas propriedades, os
receptores NMDA são implicados como responsáveis pelos processos
que envolvem plasticidade, como aprendizado e memória. Além disso,
em situações patológicas em que o glutamato se acumula no espaço
extracelular os receptores NMDA são implicados na neurotoxicidade
glutamatérgica, conhecida como excitotoxicidade (Meldrum, 2000).
Alterações neuroquímicas, tais como o desequilíbrio entre a
neurotransmissão inibitória (γ-aminobutírico, GABA) e excitatória
(mediada pelo glutamato) foram identificados no tecido cerebral obtido
a partir de modelos animais e humanos tratados cirurgicamente para
ELTM-EH. No entanto, os eventos celulares e moleculares in vivo que
ocorrem durante o processo epileptogênico, ainda são pouco
compreendidos (Li et al., 2010).
1.3.1 Potenciação e Despotenciação sináptica
Estímulos pré-sinápticos de alta frequência (EAF) induzem a
potenciação de longa duração (LTP) dependente de receptores NMDA e
relacionadas a um aumento dos receptores AMPA no espaço sináptico.
A estimulação de baixa frequência (EBF) também dependente de
receptores NMDA, mas induz a despotenciação de longa duração (LTD)
que provocando uma diminuição da atividade e o número de receptores
AMPA nas sinapses (Sanderson & Dell’aqua, 2011).
A potenciação de longa duração (LTP) é uma modificação na
potencia sináptica decorrente da estimulação tetânica neuronal e envolve
a modulação de inúmeras proteínas sinalizadoras entre elas a ativação de
proteínas cinases como: proteína cinase A (PKA), proteína cinase C
(PKC), proteína cinase cálcio calmodulina-dependente II (CaMKII),
22
proteínas cinases ativadas por mitógenos (MAPKs) e
fosforilação/ativação de alvos como receptores AMPA e NMDA (Barco
et al., 2006). Esta modificação pode durar horas (indução in vitro) ou
dias (indução in vivo). O processo envolve estímulo excitatório através
de receptores glutamatérgicos (AMPA e NMDA), aumento nas
concentrações intracelulares de Ca2+
, estimulação de cinases, formação
de mensageiros retrógrados, fosforilação de substratos citoplasmáticos,
de membrana e nucleares, expressão gênica precoce e tardia culminando
com as modificações estruturais e funcionais de longa duração
(Izquierdo et al., 1997, Walz et al., 2002). Outro aspecto importante a
ser considerado é o fenômeno de “Despotenciação de Longa Duração”
(do inglês Long-Term Depression), que corresponde a uma diminuição
no potencial excitatório pós-sináptico em decorrência da aplicação de
estímulos de baixa frequência e que envolve uma série de elementos de
sinalização entre eles a ativação de proteínas fosfatases (Winder &
Sweatt, 2001). A figura 2 nos mostra a regulação coordenada dos
receptores AMPA e NMDA nos fenômenos de LTD e LTP.
Figura 2. Mecanismos de plasticidade pós-sináptica. A regulação do receptor
N-metil-D-aspartato (NMDAR) induzida pela potenciação de longa duração
(LTP) e a despotenciação de longa duração (LTD) em espinhas dendríticas.
LTD induz o encolhimento da coluna sináptica, desfosforilação do receptor
AMPA e remoção dos mesmos das espinhas dendríticas através de proteínas
com atividade fosfatase. LTP induz o crescimento da coluna, fosforilação do
receptor AMPA e recrutamento dos AMPAR nas espinhas através de proteínas
com atividade cinase. Adaptado de Sanderson e colaboradores (2011).
23
1.3.2 Regulação do receptor AMPA
O receptor AMPA é um tetrâmero, formado por subunidades
GluR1-4 (em várias combinações) permeando principalmente Na+ e
sendo responsável pela despolarização neuronal ao estímulo do
neurotransmissor excitatório glutamato (Santos et al., 2009). No
processo de LTP ocorre a despolarização do neurônio pós-sináptico,
liberação do magnésio do receptor NMDA que ativado pelo glutamato
permite um intenso influxo de Ca2+
(Cooke & Bliss, 2006). O íon cálcio
combinado a calmodulina (CaM) pode ativar a proteína cinase CaMKII.
Além disso, CaM pode ativar algumas isoformas de adelinato ciclase o
que induz aumento do cAMP com ativação de PKA. Essas cinases por
sua vez podem fosforilar o receptor AMPA, evento importante na fase
inicial da LTP (Carvalho et al., 2000, Meador, 2006).
Nesse sentido tem sido descrito que a subunidade GluR1 do
receptor AMPA pode ser fosforilada em 3 resíduos de serina localizados
na porção intracelular C-terminal: serina 818 (Ser818
) fosforilada por
PKC; serina 831 (Ser831
) fosforilada por PKC e/ou CaMKII; serina 845
(Ser845
) fosforilada por PKA (Din et al., 2010). A fosforilação da
subunidade GluR1 do receptor glutamatérgico AMPA é fundamental
para inserção e manutenção do receptor AMPA na membrana sináptica
bem como para aumento da sua condutância. No hipocampo a
fosforilação desses sítios parece ser importante para
indução/manutenção da LTP. Já a desfosforilação individual ou
combinada desses resíduos de fosfo-serina, pela proteína fosfatase 1
(PP1) e calcineurina, parece ser importante para a despotenciação
sináptica (LTD). Portanto, modificações no estado de fosforilação da
subunidade GluR1 de AMPA alteram dramaticamente a função do
receptor contribuindo para a expressão da LTP ou LTD. Desta forma
pode ser postulado que as alterações no estado de fosforilação dos
diversos sítios sobre AMPA poderiam “marcar” as sinapses que tenham
sido recentemente modificadas e assim representar um index da
ocorrência de LTP ou LTD (Walz et al., 2002, Whitlock et al., 2006). A
Figura 3 detalha a regulação da fosforilação e tráfego da subunidade
GluR1 do receptor AMPA nas sinapses durante a LTP e LTD.
24
Figura 3. Regulação da fosforilação e tráfego da subunidade GluR1 do receptor
AMPA nas sinapses durante a LTP e LTD. Durante a LTP, os receptores AMPA
podem ser diretamente secretados para a membrana extrasináptica e sinapse das
espinhas dendríticas, processo que envolve essencialmente proteínas com
atividade cinases. Já durante a LTD, a endocitose dos receptores AMPA
envolve a ativação de enzimas fosfatases. Adaptado de Sanderson e
colaboradores (2011).
Estas evidências colocam a fosforilação dos sítios de Ser831
e Ser845
da subunidade GluR1 de AMPA como evento chave para a inserção do
receptor na membrana plasmática e seu deslocamento até a região
sináptica (Oh et al., 2006). O aumento persistente da força da sinapse
também pode ocorrer de forma patológica na epileptogênese ou como
resultante do estado epiléptico, condição na qual o cérebro permanece
em estado constante de crise convulsiva (Chen & Wasterlain, 2006). O
desequilíbrio entre os mecanismos de controle inibitórios e excitatórios
responsáveis pela manutenção sustentada da crise envolve uma
diversidade de elementos sinápticos e de sinalização celular. Um destes
elementos pode ser a ativação persistente de PKA e consequente
aumento de fosforilação de Ser845
da subunidade GluR1 de AMPA
(Carvalho et al., 2000). Nesse sentido, Bracey e colaboradores
demonstraram uma forte relação entre o estado epiléptico, aumento na atividade de PKA e fosforilação em Ser
845 nos
primeiros minutos (10-
70min) após Pilo-SE, sugerindo um possível envolvimento desse
mecanismo com o estabelecimento de uma neuroplasticidade patológica
nesse caso (Bracey et al., 2009), porém a modulação do receptor AMPA
25
no período latente e crônico permanece sendo uma incógnita neste
modelo animal.
1.3.3 Transportadores Gliais de Glutamato
O glutamato liberado na fenda sináptica é recaptado por
transportadores específicos. Atualmente, cinco subtipos de
transportadores de glutamato foram caracterizados. Dentre os
transportadores destacam-se os expressos predominantemente em
astrócitos e incluem: 1) transportador glutamato-aspartato (glutamate-
aspartate trasnporter; GLAST em roedores) e seu equivalente em
humanos transportador de aminoácido excitatórios (excitatory amino
acid transportes; EAAT1); 2) transportador de glutamato 1 (glutamate
transporter 1; GLT1 em roedores) e EAAT2 em humanos. GLAST é o
principal transportador presente durante o desenvolvimento do SNC
(Furuta et al., 1997), enquanto o GLT1 é responsável por 90% de todo o
transporte nos tecidos adultos (Tanaka et al., 1997). Estes dois
transportadores são quantitativamente os principais transportadores de
glutamato, sendo responsáveis pela maior parte da sua remoção da fenda
sináptica (figura 4).
Eles desempenham um papel crítico na manutenção de baixas
concentrações extracelulares de glutamato, protegendo os neurônios de
uma lesão excitotóxica (Lee & Pow 2010). Tem sido demonstrado que a
perturbação da atividade dos transportadores de glutamato parece estar
envolvido em distúrbios neurológicos, tais como epileptogênese
(Rakhade & Loeb 2008). A redução na recaptação de glutamato pelos
EAATs poderia explicar a hiperexcitabilidade neuronal em focos
epilépticos (Rothstein et al., 1996, Tanaka et al., 1997, Sepkuty et al.,
2002). Estudos recentes vêm demonstrando que o bloqueio da
recaptação de glutamato provoca um aumento da excitabilidade da rede
local, resultando em atividade epileptiforme espontânea (Campbell &
Hablitz 2004).
26
Figura 4. Neurotransmissão excitatória glutamatérgica. Íons Na
+ induzem a
despolarização da membrana e liberação de glutamato das vesículas, que se liga
a receptores e abre canais iônicos. O glutamato é recaptado através de seus
transportadores e degradado em glutamina pela ação da enzima glutamina
sintetase. A glutamina é transportada da célula glial para o neurônio onde é
convertida novamente em glutamato pela ação da enzima glutaminase.
Adaptado de Rodrigo e Felipo (2007).
1.4 EPILEPTOGÊNESE E TRANSDUÇÃO DE SINAL
Recentes estudos demonstraram que neurônios do hipocampo de
animais com epilepsia de lobo temporal induzida por pilocarpina
apresentam peculiaridades em sua fisiologia intrínseca (possivelmente
dependente de canais iônicos e receptores) e/ou no circuito neural ao
qual pertencem que os tornam propensos ao surgimento de atividade
27
epileptiforme (Sanabria et al., 2001, Scorza et al., 2009). É provável que
essas modificações sejam dependentes da modificação de mecanismos
de transdução de sinal e potenciação sináptica (Walz et al., 2003, Bracey
et al., 2009).
Já é conhecido o importante papel fisiológico de diferentes
sistemas de neurotransmissores, especialmente o glutamatérgico
envolvendo os receptores AMPA e NMDA e o sistema gabaérgico nos
processos de neuroplasticidade especialmente no hipocampo e córtex,
(Walz et al., 1999, Walz et al., 2002, Sperck et al., 2009, McKiNNEY,
2010). Além disso, a importância de uma série de proteínas cinases (ex.
PKA, PKC, CaMKII e MAPKs), proteínas fosfatases (ex. PP1,
calcineurina/PP2B) e do fator neurotrófico derivado do cérebro (BNDF)
tem sido bem documentadas (Winder & Sweatt, 2001, Barco et al.,
2006, Flavell & Greenberg, 2008). Em conjunto essas proteínas
participam de complexas vias de sinalização modulando a excitabilidade
neuronal e expressão gênica e desta forma sendo a base neuroquímica de
modificações funcionais e estruturais de longa duração envolvidas em
fenômenos de neuroplasticidade como a LTP e LTD e o próprio
aprendizado e memória.
Embora a sequência e combinações de eventos celulares
provavelmente não sejam totalmente superponíveis, é bastante plausível
que o processo epileptogênico envolva alterações de parte da maquinaria
neuroquímica/celular utilizada para eventos fisiológicos, ou mesmo a
potenciação sináptica (Leite et al., 2005, Meador, 2007). A literatura
carece de estudos que demonstre a modulação de proteínas cinases (ex.
MAPKs e AKT) sabidamente envolvidas nesta patologia, mas que ainda
não foram analisadas nas diferentes fases do modelo de pilocarpina.
1.4.1 Via das MAPKs
As proteínas cinases ativadas por mitógenos (MAPKs) compõem
um grupo de serina-treonina cinases cuja função e regulação têm sido
conservadas ao longo da evolução desde organismos unicelulares como
leveduras a organismos complexos como homem (Nebreda & Porras,
2000, Johnson & Lapadat, 2002). As MAPKs conduzem, amplificam e
integram sinais originados de uma diversidade de estímulos
extracelulares na superfície da célula. Entre estes sinais estão fatores de
crescimento, toxinas, citocinas ou estresse ambiental (Tibbles &
Woodgett, 1999). O resultado disto inclui a execução de respostas
celulares como proliferação, diferenciação, desenvolvimento,
inflamação e apoptose (Dong & Bode, 2003).
28
Nos mamíferos, as MAPKs são agrupadas em pelo menos quatro
famílias com base na similaridade das sequências de aminoácidos,
mecanismos de regulação por proteínas colocadas acima na via de
sinalização e mecanismos de ativação (Robinson & Cobb, 1997). Estas
famílias compreendem as proteínas cinases 1 e 2 reguladas por sinal
extracelular (ERK 1/2), uma das famílias de MAPKs mais estudadas no
SNC; e as proteínas cinases ativadas por estresse (SAPKs) que incluem
as c-Jun amino terminal cinases (JNKs), composta pelas isoformas JNK
1/2/3; p38MAPK
composta pelas isoformas p38α, p38β, p38γ, p38δ
(Cargnello & Roux, 2011). Todas as MAPKs são ativadas por dupla
fosforilação em resíduos de treonina e tirosina (Yang et.al., 2003).
A cascata de sinalização das MAPKs (figura 5) é composta por 3
cinases a qual se inicia pela chamada cinase da cinase da MAP cinase
(MAPKKK). Esta, por sua vez, ativa uma segunda cinase, a MAPKK
(cinase da MAP cinase) através de resíduos de serina e treonina. A
ativação desta é responsável pela subsequente fosforilação de MAPKs
em resíduos de treonina e tirosina (Robinson & Cobb, 1997, Cargnello
& Roux, 2011).
Os receptores glutamatérgicos também são conhecidos por estarem
acoplados a ativação de MAPKs no hipocampo e no córtex cerebral
(Sweatt, 2001). Estudos recentes vêm demonstrando aumento na
atividade de ERK e p38MAPK
imediatamente após a inserção das crises
epilépticas em diferentes modelos animais, (Baraban et al., 1993,
Berkeley et al., 2002). Jiang e colaboradores (2005) observaram que as
crises agudas podem levar a uma rápida ativação da ERK e p38MAPK
na
área CA3 do hipocampo, a região do cérebro mais suscetível aos efeitos
letais do status epilepticus (Jiang et al., 2005).
29
Figura 5. Cascata de sinalização das proteínas cinases ativadas por mitógenos.
MAPKs medeiam a sinalização intracelular iniciada por fatores extracelulares
ou intracelulares. Todas as vias operam em forma de cascata. Adaptado de
www.cellsignaling.com. Acesso em: 11/01/2012.
1.4.2 AKT/PKB
A via PI3-cinase/AKT é implicada em sobrevivência neuronal.
Estudos demonstram que inibidores seletivos de PI3-cinase podem
causar morte de células granulares do cerebelo. Portanto, AKT pode
fosforilar e ativar proteínas implicadas na sobrevivência celular
(Crossthwaite et al., 2002). Proteínas pró-apoptóticos como Bad,
membros da família dos fatores de transcrição “forkhead” como FOXO são inibidos pela fosforilação AKT-dependente, enquanto o fator de
transcrição NFκB envolvido na expressão de proteínas anti-apoptóticas é
ativado pela AKT. Adicionalmente, tem sido descrito uma ação
inibitória pela AKT sobre JNK, um dos membros da família das
MAPKs. Este também seria uma ação no sentido de pró-sobrevivência
30
nas células, pois normalmente a ativação prolongada de algumas
isoformas de JNK pode estar associada à produção de apoptose (Brazil
et al., 2004, Hanada et al., 2004).
As vias de sobrevivência celular também podem ser ativadas no
processo epiléptico (Goto et al., 2010). Acredita-se que a
excitotoxicidade glutamatérgica (Costa et al., 2004) que acontece no
tecido com atividade epileptogênica possa ser contrabalançada por
diversos mecanismos neuroprotetores, incluindo a ativação da via
PI3K/AKT (Gary et al., 2003), prevenindo assim da morte neuronal em
resposta as descargas anormais. Nesse sentido Kim e colaboradores
(2002) demostraram que a ativação de AKT impediu a morte celular
induzida por doses neurotóxicas de ácido caínico (Kim et al., 2002).
2 JUSTIFICATIVA
Epilepsia é uma doença bastante prevalente cuja repercussão
financeira e social é muito significativa para a população brasileira e
mundial. O estudo dos aspectos neuroquímicos relacionados à epilepsia
em um modelo animal, propostos neste projeto, permitirá o
desenvolvimento do tema por envolver a determinação de alguns
mecanismos moleculares envolvidos na neuroplasticidade e que podem
participar da fisiopatologia da epilepsia. Portanto, o entendimento das
bases neuroquímicas envolvidas no processo de epileptogênese será de
fundamental importância no desenvolvimento de novas estratégias de
tratamento de pacientes com quadro de epilepsia. Nesse sentido,
considerando o possível envolvimento dos mecanismos de potenciação
sináptica do tipo LTP e LTD na epileptogênese (Leite et al., 2005) o
presente trabalho visou investigar a modulação dos receptores AMPA,
proteínas MAPKs (ERK1/2, p38MAPK
, JNK1/2/3 ), AKT e expressão dos
transportadores gliais de glutamato (EAAT1 e EAAT2) e subunidade
NR1 do receptor NMDA no hipocampo e córtex em diferentes fases do
modelo de pilocarpina de ELTM-EH.
3 OBJETIVOS
3.1 OBJETIVO GERAL
Estudar os marcadores de potenciação e despotenciação sináptica e
mecanismos de transdução de sinal no hipocampo e córtex nas
diferentes fases do modelo de pilocarpina de ELTM-EH.
31
3.1.1 Objetivos específicos
- Determinar o conteúdo total e o nível de fosforilação dos sítios Ser831
e
Ser845
da subunidade GluR1 do receptor AMPA no hipocampo e córtex
nas diferentes fases do modelo da pilocarpina em ratos.
- Determinar os níveis de mRNA da subunidade NR1 do receptor
NMDA por qRT-PCR no hipocampo e córtex nas diferentes fases do
modelo da pilocarpina em ratos.
- Determinar os níveis de mRNA dos transportadores gliais EAAT1 e 2
por qRT-PCR no hipocampo e córtex nas diferentes fases do modelo da
pilocarpina em ratos.
- Determinar o conteúdo total e o nível de fosforilação de MAPKs
(ERK1/2, JNK1/2/3 e p38MAPK
) no hipocampo e córtex nas diferentes
fases do modelo da pilocarpina em ratos.
- Determinar o conteúdo total e o nível de fosforilação da AKT no
hipocampo e córtex nas diferentes fases do modelo da pilocarpina em
ratos.
- Adicionalmente, verificar se há correlação dessas alterações com a
intensidade ou frequência no aparecimento das crises epilépticas dos
ratos pós-administração de pilocarpina.
32
4 MATERIAIS E MÉTODOS
4.1 MODELO ANIMAL
Foram utilizados ratos Wistar machos, adultos (pesando 250-300g).
Os ratos foram mantidos em grupos de três a quatro por caixa, em uma
sala com ar condicionado (22-25oC) ciclo 12h claro/escuro, com água e
comida disponíveis ad libitum. Eles foram tratados, manipulados e
sacrificados de acordo com os ‘‘Principles of Laboratory Animal Care’’
(NIH publication no. 80-23, revisada em 1996) aprovado pelo Comitê de
Ética do Uso de Animais da Universidade Federal de Santa Catarina
(CEUA/UFSC; www.ceua.ufsc.br). Todos os esforços foram feitos para
minimizar o sofrimento e número de animais utilizados. A indução do
modelo experimental foi realizada em colaboração com o Núcleo de
Pesquisas em Neurologia Experimental e Clínica (NUPNEC) da UFSC,
coordenado pelo Prof. Dr. Roger Walz. Os procedimentos foram
realizados de acordo com a metodologia previamente publicada
(Cavalheiro et al., 1991, Mello et al., 1993). Os animais receberam uma
dose intraperitoneal de pilocarpina (280mg/kg, i.p.). Para minimizar os
efeitos colinérgicos periféricos e a mortalidade, foi utilizado metil
nitrato de escopolamina (1 mg/kg, i.p.) 30 minutos antes da
administração da pilocarpina e diazepam (5 mg/kg, i.p.) 2 horas após o
início das crises. Os animais foram sacrificados 1, 3 e 12 horas (período
agudo) após inserção do status epilepticus, 5 dias (período latente) e 50
dias (período crônico) para realização dos estudos neuroquímicos. Como
grupo controle foram utilizados animais que receberam salina e igual
volume de escopolamina e diazepam. Os animais controles foram
sacrificados nos mesmos tempos descritos anteriormente. Foram
utilizados 12 animais/grupo.
O tratamento dos animais e obtenção das amostras para execução
dos testes bioquímicos estão representados na figura 6. Grupo de
animais diferentes foram utilizados para as metodologias de PCR em
tempo real quantitativo (qRT-PCR) e Western Blotting.
Resumidamente, o hipocampo e córtex de grupos controle e tratados
foram dissecados para avaliar a expressão do mRNA de
EAAT1/GLAST, EAAT2/GLT1 e NR1 por qRT-PCR (n=4 por grupo).
O nível de expressão e fosforilação da subunidade GluR1, MAPKs
(ERK 1/2, p38MAPK
, JNK 1/2/3) e AKT foi avaliado por Western
blotting (n=8 por grupo).
33
Figura 6. Ratos Wistar, machos (90 dias pós-natal) foram coletados da colônia
de reprodução da Universidade Federal de Santa Catarina (UFSC). Os animais
receberam uma dose única intraperitoneal de pilocarpina (280 mg/kg).
Hipocampo e córtex dos grupos controle e tratados foram dissecados para
avaliar expressão do mRNA de EAAT1, EAAT2 e NR1 por qRT-PCR (n=4 por
grupo). O nível de expressão e fosforilação da subunidade GluR1, MAPKs
(ERK 1/2, p38MAPK
, JNK 1/2/3) e AKT avaliados por Western blotting (n=8 por
grupo). Abreviaturas: (Pilo) pilocarpina, (IP) intraperitoneal, (PN) pós-natal.
4.2 ESTUDOS NEUROQUÍMICOS
Para avaliação da atividade das MAPKs, AKT e modulação da
fosforilação da subunidade GluR1 Ser831
e Ser845
western blotting foi
realizado como descrito por (Leal et al., 2002, Cordova et al., 2004,
Posser et al., 2007). As amostras foram agrupadas à medida que obtidas,
e analisadas em grupos de experimentos separados.
4.2.1 Preparação das amostras
Hipocampo e córtex de animais submetidos ao modelo de
pilocarpina foram dissecados (4°C) em cutting solution (sacarose 110
mM, Nacl 60 mM, KCl 3 mM, KH2PO4 1,25 mM, CaCl2 0,5 mM,
Mg2SO4 7 mM, glicose 5 mM, HEPES 25 mM pH 7,4) e colocadas em
nitrogênio líquido e armazenadas a -80oC até o uso. As amostras foram
preparadas como descrito por (Oliveira et al., 2008). Resumidamente, as
amostras foram homogeneizadas mecanicamente em 400µL do tampão
de homogeneização (Tris 50 mM pH 7,0, EDTA 1 mm, NaF 100 mm,
PMSF 0,1 mM, Na3VO4 2 mM, Triton X-100 1%, glicerol 10% e
34
Cocktail inibidor de proteases). Os lisados foram centrifugados (10.000
x g por 10 min, a 4oC) para eliminar os restos celulares, e o
sobrenadantes diluídos 1/1 (v/v) em solução (Tris 100 mM pH 6,8,
EDTA 4mM, SDS 8%) e aquecidos a 100oC por 5 min. A dosagem de
proteínas foi determinada com o método descrito em Peterson (1977). A
seguir foram adicionados nas amostras “tampão de diluição” (40%
glicerol, 100 mM Tris, de azul de bromofenol, pH 6,8) 25:100 (v/v) e β-
mercaptoetanol (concentração final 8%).
4.2.2 Eletroforese e Eletrotransferência
As proteínas foram isoladas através de SDS-PAGE (eletroforese
em gel de poliacrilamida contendo dodecil sulfato de sódio/SDS)
utilizando gel de separação de acrilamida com concentração de 10% e
gel de entrada 4%. A eletroforese foi realizada com corrente fixa de 40
mA e voltagem máxima de 150 mV durante aproximadamente 2 horas.
Após a corrida, os géis foram submetidos ao processo de
eletrotransferência e transferidos para membranas de nitrocelulose
usando um sistema semi-dry (1,2 mA/cm2; 1,5 h) como descrito por
Bjerrum e Heegaard (1988). Para verificar a eficiência processo de
transferência, os géis foram corados com Coomassie blue e as
membranas com Ponceau S. A figura 7 mostra resumidamente todo este
processo aqui descrito.
4.2.3 Imunodetecção
As membranas foram bloqueadas com 5% de leite desnatado em
TBS (Tris 10 mM, NaCl 150 mM pH 7,5) por 1 hora e após sucessivas
lavagens com TBS-T (Tris 10 mM, NaCl 150 mM, Tween-20 0,1%, pH
7,5) incubadas “overnight” (4ºC) com os anticorpos específicos para as
formas fosforiladas e totais das seguintes proteínas: ERK1/2, p38MAPK
,
JNK1/2/3, AKT e GluR1. Os anticorpos foram diluídos em TBS-T
contendo BSA 2% nas diluições: 1:1000 (anti-fosfo-JNK1/2/3, anti-
fosfo-p38MAPK
, anti-fosfo-AKT e anti-total-AKT, fosfo-GluR1 anti-
Ser831
e Ser845
, anti-total-GluR1), 1: 2000 (anti-fosfo-ERK1/2), 1:5000
(anti-total-JNK1/2), 1:10000 (anti-total-p38MAPK
) e 1:40000 (anti-total-
ERK1/2). Para a detecção dos complexos imunes, as membranas foram
incubadas por 1 hora com anticorpo secundário anti-rabbit ou mouse
(ligado à peroxidase) e reveladas em filme autoradiográico após a
emissão de quimioluminescência induzida por reagentes adicionados a
membrana de nitrocelulose, de acordo com as recomendações do
35
fabricante. As membranas foram incubadas com o anticorpo anti-β-
actina (1:2000) para verificar se a mesma quantidade de proteínas teriam
sido aplicadas no gel. O nível de fosforilação das MAPKs, AKT e da
subunidade GluR1 foi determinado pela razão entre a D.O da banda
fosforilada e a D.O da banda total (Calloni et al., 2005, Posser et al .,
2007). As bandas foram quantificadas utilizando o software Scion Image
®.
Os anticorpos anti-GluR1 total, anti-fosfo-GluR1-Ser831
e anti-
fosfo-GluR1-Ser845
detectam uma única banda de aproximadamente
100Kda, enquanto o anticorpo contra as formas totais e fosforiladas de
ERK1/2 detecta duas bandas, uma de aproximadamente 44kDa e a
segunda com cerca de 42kDa, respectivamente para as isoformas ERK1
e ERK2. Anti-p38MAPK
forma total e fosforilada detecta uma única
banda de aproximadamente 38kDa, enquanto anti-JNK1/2/3 forma total
e fosforilada detecta duas bandas, uma de aproximadamente 54kDa
(JNK2/3) e a segunda com aproximadamente 46kDa (JNK1). Anti-AKT
total e anti-fosfo-AKT-Ser473
detecta uma única banda de
aproximadamente 60kDa enquanto o anticorpo anti-β-actina detecta uma
única banda de aproximadamente 45kDa.
Figura 7. Eletroforese, Eletrotransferência e Imunodetecção.
36
4.3 ISOLAMENTO DO RNA TOTAL
Os níveis de mRNA de EAAT1, EAAT2 e NR1 foram medidos a
partir dos grupos animais mencionados anteriormente. Os animais foram
sacrificados por decapitação, o cérebro dissecado e o hipocampo e
córtex rapidamente colocados em nitrogênio líquido e armazenados a -
80oC até o uso. Posteriormente as amostras foram descongeladas e
homogeneizadas em 1 ml (córtex) e 500μl (hipocampo) de TRIzol e o
RNA total extraído de acordo com as instruções do fabricante. Os
métodos de isolamento de RNA foram desenvolvidos por Chomczynski
& Sacchi (1987).
4.3.1 qRT-PCR
Um micrograma de RNA total foi utilizado para a síntese de cDNA
e análise da expressão gênica por PCR em tempo real quantitativo (qRT-
PCR). A transcrição reversa foi realizada na presença de 2μl de dNTPs 5
mM, 1μl do primer Oligo, SuperScript®III RT (200U/μl). As condições
de reação foram: 65oC por 5 min, arrefecimento a 20ºC por 1 min, 50°C
por 60 min e 70oC por 15 min.
O produto da reação foi amplificado por qRT-PCR no
termociclador Realplex 4S, utilizando o kit de reação SYBRGreen. As
condições de termociclagem foram 95oC por 10 min, seguida de 40
ciclos de 95oC por 15s, 55
oC por 15s, 60ºC por 20s. Este procedimento
foi seguido por curva de fusão a 95°C por 15s, 55°C por 15s e aumento
gradual da temperatura por 20 min terminando com 95°C por 15s. Os
experimentos foram realizados em quadruplica para cada ponto de
dados. A abundância de mRNAs de EAAT1, EAAT2 e NR1 foi
quantificado em valores relativos, em comparação com uma referência
interna, a gliceraldeído-3-fosfato desidrogenase (GAPDH), cuja
abundância se acredita não mudar entre condições experimentais
diferenciadas. Os primers utilizados para qRT-PCR foram os seguintes:
EAAT1 (ratos) (Gen-Bank™ número de acesso NM 148938), frente de
primer 5'-CTCGTCACAGGAATGGCGGCC-3' primer reverso 5'-
TGCCCTTTCCGGGGTGGATGA -3'; EAAT2 (ratos) (Gen-Bank™
número de acesso NM 0113932), frente do primer 5'-
CCGTGATGATAGGCACCGTG-3' primer reverso 5'-
CTCCAGCAGCGTCCATTCAA-3'; NR1 (ratos) (Gen-BankTM
número
de acesso NM 0081692), frente de primer 5'-
TGGTAGAGCAGAGCCCGACCC-3' primer reverso 5'-
CCCCGGTGCTCGTGTCTTTGG-3 '; GAPDH (ratos) (Gen-Bank™
37
número de acesso NM 017008) frente do primer 5'-
GGGGGCTCTCTGCTCCTCCC-3' primer reverso 5'-
CGGCCAAATCCGTTCACACCG-3'. Dois microlitros da reação de RT
foi utilizada para o qRT-PCR.
Valores quantitativos para transcrição do mRNA de EAAT1,
EAAT2, NR1 e GAPDH foram obtidos a partir do número de ciclos
limites, onde o aumento do sinal associado a um crescimento
exponencial dos produtos de PCR começam a ser detectados. Curvas de
fusão foram geradas no final de cada corrida para garantir a
uniformidade do produto. Os níveis dos genes alvo foram normalizados
com base na expressão de GAPDH como controle endógeno de RNA.
Valores ΔCt das amostras foram determinados subtraindo-se os valores
médios de Ct dos genes alvo a partir do valor médio de Ct do controle
interno GAPDH. ΔΔCt foi determinado subtraindo-se os valores médios
de ΔCt dos grupos tratados pelos valores médios de ΔCt do grupo
controle. Como é raro usar ΔΔCt como dados relativos devido a sua
característica logarítmica, o parâmetro 2-ΔΔCt
foi usado para expressar os
dados de expressão relativa (Livak & Schmittgen, 2001).
4.4 ANÁLISE DOS RESULTADOS
A fosforilação e expressão da subunidade GluR1, MAPKs e AKT e
os níveis de mRNA dos transportadores EAAT1, EAAT2 e da
subunidade NR1 durante diferentes períodos do modelo da pilocarpina
foram comparados utilizando Student’s t test. Dados foram apresentados
como média ± S.E.M; p<0.05 foi considerado estatisticamente
significativo.
5 RESULTADOS
O presente trabalho resultou na confecção de dois manuscritos já
submetidos à publicação em periódicos científicos e estão listados
abaixo:
Manuscrito 1: Time-dependent modulation of AMPA receptor
phosphorylation and mRNA expression of NMDA receptor NR1 subunit
and glial glutamate transporters in rat hippocampus and cortex in the
pilocarpine model of epilepsy. Submetido ao periódico “Epilepsia”.
38
Manuscrito 2: Time-dependent modulation of MAPKs and AKT
phosphorylation in rat hippocampus and cortex in the pilocarpine model
of epilepsy. Submetido ao periódico “Neurochemical Research”.
Observamos que além dos manuscritos são apresentadas nesta sessão
tabelas adicionais.
39
5.1 MANUSCRITO 1
Time-dependent modulation of AMPA receptor phosphorylation
and mRNA expression of NMDA receptor NR1 subunit and glial
glutamate transporters in rat hippocampus and cortex in the
pilocarpine model of epilepsy
Mark William Lopes
1, Flávia Mahatma Schneider Soares
2, Nelson de
Mello2, Jean Costa Nunes
2, Aurilene Gomes Cajado
3, Daniel de Brito
3,
Fabiano Mendes de Cordova1,4
, Rodrigo Maranguape Cunha da Silva3,
Roger Walz2,5
, Rodrigo Bainy Leal1,5
1
Departamento de Bioquímica, Centro de Ciências Biológicas,
Universidade Federal de Santa Catarina, Florianópolis, SC, Brazil 2 Centro de Neurociências Aplicadas (CeNAp), HU, Universidade
Federal de Santa Catarina, Florianópolis, SC, Brazil 3
Centro de Ciências Agrárias e Biológicas, Universidade Estadual Vale do Acaraú, Fortaleza, CE, Brazil 4
Escola de Medicina Veterinária e Zootecnia, Universidade Federal do
Tocantins, Araguaína, TO, Brazil. 5 Departamento de Clínica Médica, Hospital Universitário (HU), Centro
de Ciências da Saúde, Universidade Federal de Santa Catarina, Florianópolis, SC, Brazil
Corresponding author:
Rodrigo Bainy Leal
Universidade Federal de Santa Catarina
Centro de Ciências Biológicas
Florianópolis, SC, Brazil - 88040-900
Telephone number: 55 48 37215045
E-mail: [email protected]
Key words: Epilepsy, Pilocarpine, Signal Transduction, AMPA and
NMDA receptors.
Number of text pages: 21 pages
Number of words: 4547 words
Number and proposed size of figures: 5 figures; 2 pages
Conflict of Interest statement: None of the authors has any conflict of
interest to disclose.
40
ABSTRACT
Purpose: Glutamatergic system has been implicated with
neuroplasticity events related to epileptogenesis. The pilocarpine model
in rodents reproduces the main features of mesial temporal lobe epilepsy
related to hippocampus sclerosis (MTLE-HS) in humans.
Methods: We analyze the phosphorylation profile of AMPA receptor
GluR1 subunit by western blotting, and expression of glial glutamate
transporters and NMDA receptor NR1 subunit (NR1-NMDA) by qRT-
PCR in the hippocampus (HIP) and cortex (Ctx) of male adult wistar
rats in different periods, after pilocarpine induced status epilepticus
(Pilo-SE) and compared with control animals. Biochemical analysis
were done in the HIP and Ctx at 1h, 3h, 12h (acute period), 5 days
(latent period) and 50 days (chronic period) after Pilo-SE onset.
Key findings: There was increased phosphorylation of the site GluR1-
Ser845
in the Ctx and GluR1-Ser831
in the HIP at different times of the
acute period. The total content GluR1 remain unchanged in all groups
except in the latent period in which GluR1 level was lower than
controls. There was a down regulation of mRNA expression of NR1-
NMDA and EAAT1 and 2 in the Ctx, in the latent period. In the HIP the
EAAT2 mRNA expression decreased while NR1-NMDA mRNA
enhanced in the chronic period.
Significance: Our finding demonstrates a time and structure-dependent
changes in the expression of NR1-NMDA receptor and EAAT1/EAAT2
transporters in the Ctx and HIP after the Pilo-SE. These neuronal and
glial modifications may be associated with epileptogenesis or seizure
threshold in MTLE-HS.
41
1. Introduction
Epilepsies are one of the most common neurological conditions
reaching about 50 million people worldwide (Sander, 2003). Twenty to
thirty percent of the epilepsies are medically intractable and mesial
temporal lobe epilepsy related to hippocampal sclerosis (MTLE-HS) is
the most common form of surgically remediable epileptic syndrome
(Babb, 1999).
Systemic administration of pilocarpine in rodents reproduces
the main features of human MTLE-HS (Cavalheiro, et al. 1991;
Hollmann, et al.1991). Pilocarpine induces limbic seizures that become
secondarily generalized evolving to status epilepticus (Pilo-SE) that
lasts several hours (acute period). The SE is followed by a latent
‘‘seizure-free” period and by a chronic period characterized by the
presence of spontaneous recurrent seizures (Cavalheiro, et al. 1991;
Mello et al. 1993; Cavalheiro, et al. 1994). Hippocampal changes
following SE include an increase in glutamate in the synaptic cleaft
(Costa, et al. 2004), cell loss, gliosis and mossy fiber sprouting (Mello,
et al. 1993). Neurochemical changes such as imbalance between
inhibitory (γ-aminobutyric acid; GABA) and excitatory (glutamate-
mediated) neurotransmission (in favor of the latter) have been identified
in brain tissue obtained from animal models and humans treated
surgically for MTLE-HS. However, the cellular and molecular events in
vivo that occur during the time course of epileptogenic process as well in
the chronic period are still poorly understood (Houser, et al. 2008; Li, et
al. 2010).
Postsynaptic responses to glutamate involve activation of
ionotropic glutamate receptors such as N-methyl-D-aspartate (NMDA)
and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid
(AMPA) receptors (Jerusalinsky, et al. 1992) that play a crucial role in
the neuroplasticity related to excitability in the neocortical and limbic
structures. NMDA and AMPA are in fact integrated in a complex
signaling network that also involve the activity of a variety of protein
kinases such as cAMP-dependent protein kinase (PKA), (Bernabeu, et
al. 1997) Ca2+
-calmodulin-dependent protein kinases II (CaMKII),
(Cammarota, et al. 1998) protein kinase C (PKC) (Bernabeu, et al. 1995)
and mitogen-activated protein kinases (MAPKs) (Walz, et al. 2000).
Therefore, alterations of these signaling systems may change the
synaptic plasticity and may be associated with physiologic and
pathologic processes including epileptogenesis (Sanderson &
Dell’Acqua, 2011).
42
High-frequency presynaptic stimulation (HFS) induces
NMDAR-dependent long-term potentiation (LTP) by increasing
synaptic AMPAR number and activity, whereas low-frequency
stimulation (LFS) induces NMDAR-dependent long-term depression
(LTD) by decreasing AMPAR activity and number. During NMDAR-
induced LTP, brief but strong elevations in postsynaptic Ca2+
promote
phosphorylation-regulated insertion of AMPARs containing GluR1 into
extrasynaptic and perisynaptic plasma membrane sites (Sanderson &
Dell’Acqua, 2011). The mechanism may involve a PKA dependent
phosphorylation of Ser845
on GluR1 subunit of AMPAR which induces
its insertion on plasma membrane in the extrasynaptic site followed by
Ser831
GluR1 phosphorylation by CaMKII or PKC that drive the
receptor to synaptic site (Esteban, et al. 2003; Sanderson & Dell’Acqua,
2011). In contrast, NMDAR-induced LTD is triggered by prolonged but
low-level Ca2+
elevations that promote GluR1 Ser845
dephosphorylation
decreasing synaptic AMPAR activity and number (Lee, et al. 1998;
Banke, et al. 2000). Modulation of synaptic strength may be involved
with epileptogenesis (Leite, et al. 2005) as well associated to
compensatory mechanism occurring in distant regions of the
epileptogenic zone.
Finally, it is important to consider that glutamate released at
synaptic cleaft is captured by excitatory amino acid transporters
(EAATs) proteins (Beart & O’Shea, 2007). These transporters are
expressed differentially throughout the central nervous system (CNS),
but EAAT1/GLAST and EAAT2/GLT-1 are normally expressed by
astrocytes. They are considered to play a critical role in the maintenance
of low extracellular concentrations of glutamate, which protects
neurones from excitotoxic injury (Lee & Pow, 2010). It has been
demonstrated that disturbance of glutamate transporters activity appears
to be involved in neurological disorders such as epileptogenesis
(Rakhade & Loeb, 2008).
Here we investigated the phosphorylation levels of Ser831
and
Ser845
on GluR1 subunit of AMPA receptors, and mRNA expression of
glial glutamate transporters (EAAT1 and EAAT2) and NR1 subunit in
hippocampus and cortex of rats at different periods of the pilocarpine
model.
2. Materials and Methods
2.1 Chemicals
43
HEPES, Triton X-100, SDS, acrylamide, bis-acrylamide, were
obtained from GE Healthcare Life Science. Glycine, Tris, TEMED, β
mercaptoethanol were obtained from Amresco Life Science. Bovine
serum albumin (BSA) was from Inlab. Immobilon nitrocellulose and
goat anti-rabbit IgG HRP was from the Millipore. Ammonium persulfate
(APS) and rabbit anti-phospho-GluR1 Ser831
and Ser845
antibodies were
purchased from the Sigma Chemical Company. LumiGLO reagent
(luminol chemiluminescent substrate) was obtained from Cell Signaling
Technology. Mouse anti-GluR1, anti-β actin as well goat anti-mouse
IgG HRP (horseradish peroxidase) conjugated antibodies were obtained
from Santa Cruz Biotechnology. All other reagents were of analytical
grade.
2.2 Animal procedures
Adult male wistar rats (90 days old) from the Federal University
of Santa Catarina (UFSC) breeding colony were maintained in groups of
four per cage, room temperature between 22-25oC on a 12-h light/dark
cycle with water and food available ad libitum. All experimental
procedures were approved by the UFSC Ethics Committee for Animal
Experimentation. Pilo-SE induction was performed as described
previously (Cavalheiro, et al. 1991; Mello, et al. 1991; Bonan, et al.
2000). A subcutaneously administration of 1 mg/kg of scopolamine
methylnitrate (Sigma Chemical, dissolved in saline 0.9%) 30 min before
pilocarpine administration to reduce the peripheral cholinergic effects.
Animals received a single intraperitoneal dose of pilocarpine (280
mg/kg, Sigma Chemical, dissolved in saline 0.9%), and most of them
became hypoactive evolving to generalized convulsions and limbic SE
usually 40–80 min after the injection. Two hours after the seizure onset
animals received diazepam (5mg/kg) to decrease the mortality rate.
Assisted feeding and hydration were carried out during the recovery
period to improve general clinical state and to reduce mortality. In this
model, after a silent period of 14 days (ranging from 4–44 days), all
animals developed spontaneous seizures (2–15 per month),
characterizing the chronic period. Pilocarpine were injected in 80
animals, the mortality rate was 20% (n = 16) and 4 animals (5 percent)
did not evolve to SE. Only animals that evolve to SE (n = 60, 75
percent) were used in the biochemical analysis.
Survivors animals were divided in five groups: a) acute groups
which were euthanized 1h (Group Acute 1h) after status epilepticus (SE)
onset (n = 12); b) 3h (Group Acute 3h) after SE onset (n = 12) and c)
44
12h (Group Acute 12h) after SE onset (n = 12); d) latent group that
were euthanized 5 days (Group Latent 5 days) after SE onset (n = 12), a
period which the seizure were not observed; e) chronic group which the
animals were euthanized 50 days (Group Chronic 50 days) after SE
induction (n = 12). The animals from the latent group were behaviorally
evaluated for 6 hours per day (8 a.m. to 2 p.m.) between days 3 to 5 and
no clinically visible seizure were documented. The control animals
were sacrificed 1h, 3h, 12h, 5 and 50 days (n = 12 per group), after
scopolamine, diazepam and saline injection except the animals from the
Group Acute 1h and their respective controls who did not received
diazepam. Hippocampus and cortex were dissected from different
animals of control and experimental groups. Analysis of the
EAAT1/GLAST, EAAT2/GLT1 and NR1 mRNA expression was
performed by quantitative RT-PCR (n = 4 animals per group). The total
level of AMPA receptor GluR1 subunit and phosphorylation on the sites
Serine831
(GluR1-Ser831
) and Serine845
(GluR1-Ser845
) were analyzed by
Western blotting (n = 8 animals per group).
2.3 Western blot analysis
For quantification of phosphorylation on the sites GluR1-Ser831
and Ser845
of AMPA receptor GluR1 subunit, western blot analysis was
performed as previously described by (Leal, et al. 2002; Cordova, et al.
2004; Posser, et al. 2007; Figueiredo, et al. 2011). Animals were
euthanized by decapitation, brains were excised from the skull and
hippocampus and cortex were dissected (4°C) into “cutting solution”
(sucrose 110 mM, NaCl 60 mM, KCl 3 mM, KH2PO4 1.25 mM, CaCl2
0.5 mM, Mg2SO4 7 mM, glucose 5 mM; HEPES 25 mM pH 7.4), and
placed in liquid nitrogen and then stored at -80oC until use. Samples
were prepared as previously described by (Oliveira, et al. 2008). Briefly,
samples were mechanically homogenized in 400 µl of Tris 50 mM pH
7.0, EDTA 1 mM, NaF 100 mM, PMSF 0.1 mM, Na3VO4 2 mM, Triton
X-100 1%, glycerol 10%, Sigma Protease Inhibitor Cocktail (P2714)
and then incubated for 10 min in ice. Lysates were centrifuged (10,000 x
g for 10 min, at 4oC) to eliminate cellular debris. The supernatants were
diluted 1/1 (v/v) in Tris 100 mM pH 6.8, EDTA 4 mM, SDS 8% and
boiled for 5 min. Thereafter, sample dilution (40% glicerol, 100 mM
Tris, bromophenol blue, pH 6.8) in the ratio 25:100 (v/v) and β
mercaptoethanol (final concentration 8%) were added on the samples.
Protein content was estimated by the method described by Peterson
(1977). The same amount of protein (70 µg per lane) for each sample
45
was electrophoresed in 10% SDS–PAGE minigels and transferred to
nitrocellulose membranes using a semidry blotting apparatus (1.2
mA/cm2; 1.5 h). To verify transfer efficiency process, gels were stained
with Coomassie blue and membranes with Ponceau S.
The membranes were blocked with 5% skim milk in TBS (Tris
10 mM, NaCl 150 mM, pH 7.5). GluR1 phosphorylated and total forms
were detected after overnight incubation with specific antibodies diluted
in TBS-T containing BSA 2% in the dilution of 1:1000 (anti-phospho-
GluR1 Ser831
, anti-phospho-GluR1 Ser845
and anti-total-GluR1).
Moreover, the membranes were incubated for 1h at room temperature
with horse radish peroxidase (HRP)-conjugated anti-rabbit or anti-
mouse secondary antibodies for detection of phosphorylated sites or
total form of GluR1, respectively. The reactions developed by
chemioluminescence substrate (LumiGLO). All blocking and incubation
steps were followed by three times washing (5 min) with TBS-T (Tris
10 mM, NaCl 150 mM, Tween-20 0.1%, pH 7.5). All membranes were
incubated with mouse anti-β-actin (1:2000) antibody to verify that equal
amounts of proteins were loaded on the gel. The phosphorylation level
of GluR1 was determined as a ratio of OD of phosphorylated band/OD
of total band (Calloni, et al. 2005; Posser, et al. 2007). The bands were
quantified using the Scion Image® software.
The antibodies against GluR1, GluR1-Ser831
and -Ser845
detected a single band of approximately 100Kda, anti-β-actin antibody
detected a single band of approximately 45 kDa.
2.4 Total RNA isolation
For determination of mRNA levels of EAAT1, EAAT2 and
NR1 animals were euthanized by decapitation, brains were excised from
the skull and hippocampus and cortex were quickly dissected and placed
in liquid nitrogen and then stored at -80oC until use. Thawed tissues
were homogenized in 1 ml (cortex) and 500µl (hippocampus) of TRIzol
reagent (Invitrogen) and total RNA was extracted accordingly to the
manufacturer’s instructions and the methods of RNA isolation
developed by (Chomczynski & Sacchi, 1987).
2.5 Quantitative Real-Time RT-PCR
One microgram of total RNA was used for cDNA synthesis and
Real-Time PCR gene expression analysis. Then, the reverse
transcription (RT) was carried out in a 20µl reaction in the presence of 2
46
µL of dNTPs 5 mM, and 1 µL of primer Oligo, SuperScript® III RT
(Invitrogen) (200U/µL). The reactions conditions were: 65oC for 5 min,
cools 20ºC for 1 min, 50oC for 60 min and 70
oC for 15 min.
Reaction product was amplified by Real-Time PCR on the
thermocycler RealPlex 4S (Eppendorf) using the SYBRGreen core
reaction kit (Applied Biosystems). The thermal cycling conditions were
95oC for 10 min, followed by 40 cycles at 95
oC for 15s, 55
oC for 15s,
60ºC for 20s. This procedure was followed by melting curve at 95°C for
15s, 55°C for 15s and the gradual increase of temperature for 20 min
ending with 95°C for 15s. Experiments were performed in
quadruplicates for each data point. Abundance of EAAT1, EAAT2 and
NR1 mRNAs was quantified as relative values compared with an
internal reference, GAPDH, whose abundance was believed not to
change between the varying experimental conditions. Primers used for
Real-Time PCR are as follows: rat EAAT1 (Gen-Bank™ accession
number NM 148938), forward primer 5’-
CTCGTCACAGGAATGGCGGCC-3’ and reverse primer 5’-
TGCCCTTTCCGGGGTGGATGA -3’; rat EAAT2 (Gen-Bank™
accession number NM 0113932 ), forward primer 5’-
CCGTGATGATAGGCACCGTG-3’ and reverse primer 5’-
CTCCAGCAGCGTCCATTCAA-3’; rat NR1 (GenBank™ accession
number NM 0081692), forward primer 5’-
TGGTAGAGCAGAGCCCGACCC-3’ and reverse primer 5’-
CCCCGGTGCTCGTGTCTTTGG-3’; rat GAPDH (GenBank™
accession number NM 017008) forward primer 5’-
GGGGGCTCTCTGCTCCTCCC- 3’ and reverse primer 5’-
CGGCCAAATCCGTTCACACCG-3’. Two microliter of RT reaction
was used for Real-Time PCR.
Quantitative values for EAAT1, EAAT2, NR1 and GAPDH
mRNA transcription were obtained from the threshold cycle number,
where the increase in the signal associated with an exponential growth
of PCR products begins to be detected. Melting curves were generated at
the end of every run to ensure product uniformity. The levels of target
gene were normalized on the basis of GAPDH expression as an
endogenous RNA control. ΔCt values of the samples were determined
by subtracting the average Ct values of target genes mRNA from the
average Ct value of the internal control GAPDH. ΔΔCt was determined
by subtracting the average ΔCt values of group treated from the average
ΔCt values of group control. As it is uncommon to use ΔΔCt as a
relative data due to this logarithmic characteristic, the 2-ΔΔCt
parameter
47
was used to express the relative expression data (Livak & Schmittgen,
2001).
2.6 Statistical analysis
Phosphorylation and expression of GluR1, levels of EAAT1,
EAAT2 and NR1 during different experimental model periods were
compared using Student’s t-test. Data are presented as mean ± S.E.M.; p
< 0.05 was considered to be statistically significant.
3. Results
3.1 Phosphorylation levels of AMPA receptor GluR1 subunit, in the
hippocampus and cortex after Pilo-SE induction
The evaluation of GluR1 subunit of AMPA receptor in the
hippocampus showed a significant increase (p<0.05) in GluR1–Ser831
phosphorylation at 1h (14.46 ± 2.82%) and 12h (14.00 ± 3.78%) after
SE onset in comparison to the control group (Figure 1B). The GluR1–
Ser831
phosphorylation levels return to baseline in the latent and chronic
periods. In contrast, the GluR1-Ser845
phosphorylation decreased (16.23
± 5.94%, p<0.05) at 3h after SE onset, return to the baseline at 12h and
5 days, and decreased in the chronic period (17.74 ± 3.67% p<0.01)
(Figure 1C). No significant changes were detected in the amount of total
form of GluR1.
In comparison to hippocampus, the profile of GluR1 subunit
phosphorylation of AMPA receptor was differently modulated in the
cortex after the Pilo-SE onset. The GluR1-Ser831
phosphorylation
decreased (16.21 ± 6.75% p<0.05) 3h after Pilo-SE onset, returning to
baseline in the other periods (Figure 1F). The GluR1-Ser845
phosphorylation increased significantly (63.32 ± 2.72% p<0.01) at 1h
after Pilo-SE onset, returning to the controls levels between 3h and 5
days (Figure 1G). In the chronic period there was a decrease (17.74 ±
3.67%, p<0.05) of GluR1-Ser845
phosphorylation (Figure 1G). The total
AMPA receptor GluR1 subunit level remain unchanged in the acute and
chronic periods but showed a significant decrease (20.74 ± 4.04%
p<0.01) in the latent period (Figure 1H).
Figure 2 depicts the modulation profile of AMPA receptor
GluR1 subunit phosphorylation and content in the hippocampus and
cortex in different times after the Pilo-SE.
48
3.2 EAAT1, EAAT2 and NR1 mRNA expression in the
hippocampus and cortex after Pilo-SE induction
No significant changes were detected in the of EAAT1 mRNA
expression (Figure 3A) in hippocampus after the Pilo-SE. However,
when compared to the control group, the EAAT2 mRNA expression
decreased 91% (Figure 3B) in the chronic period. In contrast, in the
same period the NR1 subunit of NMDA receptor mRNA expression
increased 5 times in comparison to the respective controls (Figure 4A).
The evaluation of glutamate transporters (EAAT1, EAAT2)
expression in the cortex showed a downregulation of both EAAT1
(60%) (Figure 3C) and EAAT2 (80%) mRNA (Figure 3D) in the latent
period. Similarly, NR1 subunit of NMDA receptor mRNA decreased
80% (Figure 4B) in the same period.
Figure 5 depicts the profile of mRNA expression of EAAT1,
EAAT2 and NR1 subunit of NMDA receptor in hippocampus and cortex
at different times after the Pilo-SE onset. Overall, it is interesting to
highlight that in the chronic period occurred an increased expression of
hippocampal NR1 subunit paralleled by a decreasing of the glutamate
transporter EAAT2 (Fig 5A).
4. Discussion
Our results shows a time and region dependent pattern of
GluR1-Ser831
and Ser845
phosphorylation state of AMPA receptors as
well NR1, EAAT1 and 2 mRNA expression at different periods of the
pilocarpine model of MTLE-HS.
The site GluR1-Ser845
had an increase in phosphorylation in the
cortex 1 h after SE onset. This data agree with previous study by Bracey
and colleagues (2009) which demonstrated an SE-dependent increase of
PKA activity and phosphorylation of GluR1-Ser845
in the cortex 20, 40
and 70 min post-first discrete seizure (Bracey, et al. 2009). In this
direction it has been shown that application of cAMP analogues
increased neuronal excitability (Boulton, et al. 1993) and may induces
kindling (Yokoyama, et al. 1989). Therefore, the increase of
phosphorylation of the Ser845
on GluR1 subunit of the AMPA receptor
in the cortex observed in our study may be due PKA activation.
Differently, phosphorylation of GluR1-Ser831
in the cortex was not
changed in the same period. However, it is well demonstrated that Ser831
is phosphorylated by PKC and CaMKII suggesting that although these
enzymes are closely involved in the LTP (Sanderson & Dell’Acqua,
49
2011) in the hippocampus, they may not participate in the GluR1-Ser831
site phosphorylation in the cortex 1h after the Pilo-SE onset. Regarding
the subsequent periods analyzed it was observed a decrease of both
Ser831
at 3h and Ser845
at 50 days after the onset of seizures. The main
information of these results is that the phosphorylation of the main sites
(Ser831
and Ser845
) on the GluR1 subunit of AMPA receptor, measured
in the total cortex, are not sustained in the course of establishment of
spontaneous seizures in the pilocarpine model. Moreover, it is apparent
in the cortex a profile that include an initial increase of Ser845
phosphorylation, probably due to PKA activation, followed by a rapid
return to basal level or a later decrease of phosphorylation. Another
point relevant observed was a significant decrease of GluR1 total
content in the latent period (five days after pilocarpine administration).
Therefore, the lower availability of GluR1 subunit may contribute with
this phenomenon observed in the course of pilocarpine model.
Regarding the hippocampus it was found an increase in
phosphorylation of Ser831
1h and 12h post-first seizure. These results
suggest PKC and CaMKII activation in the hippocampus in response to
pilocarpine, since this site is a well-known substrate for both kinases
(Sanderson & Dell’Acqua, 2011). Differently, Ser845
phosphorylation
level was not changed after 1h. This result agree with Bracey and
colleagues (2009) that did not observe variations of both PKA activity
and Ser845
phosphorylation in the hippocampus 10-70 min after post-
first discrete seizure induced by pilocarpine (Bracey, et al. 2009).
Moreover, our data indicate that Ser845
phosphorylation can decrease at
3h and 50 days after pilocarpine induced SE. Therefore, the
phosphorylation profile of GluR1 subunit of AMPA receptor in response
to pilocarpine treatment is different in the hippocampus and cortex. In
first 1h is possible to postulate an activation of PKA at cortex and
PKC/CaMKII in the hippocampus. This aspect is probably specific for
the pilocarpine model since Rakhade and colleagues (2008)
demonstrated a significant increase of PKA, PKC and CaMKII activity
as well as the phosphorylation of GluR1-Ser845
and GluR1-Ser831
at 1h
after hypoxia-induced seizures in hippocampal slices (Rakhade, et al.
2008). Therefore, this evidence strengthens the idea that the increase in
phosphorylation of site Ser845
in the cortex and Ser831
in the
hippocampus are due to an activation of different sets of protein kinases
forward to SE-induced in the epilepsy model used in our work.
The functional implications for all these findings are complex.
It is well known that postsynaptic AMPA-type glutamate receptors
(AMPARs) mediate most fast excitatory synaptic transmission and are
50
crucial for many physiological aspects of brain function involving
neuroplasticity, including learning, memory and cognition. The number,
synaptic localization and subunit composition of synaptic AMPARs are
tightly regulated by synaptic activity (Henley, et al. 2011). AMPAR
channel activity may be increased during LTP through PKA
phosphorylation of Ser845
that induces membrane insertion and increase
channel-open probability. Moreover, phosphorylation of Ser831
by
CaMKII/PKC induces a synaptic localization of the receptor and
increase single-channel conductance (Esteban, et al. 2003; Lee, et al.
2003; Boehm, et al. 2006). Furthermore, it is interesting to note that
NMDAR-induced LTD is triggered by prolonged but low-level Ca2+
elevations that promote protein phosphatase activation and subsequent
GluR1 Ser845
dephosphorylation and decreased synaptic AMPAR
activity and number (Lee, et al. 1998; Banke, et al. 2000). In the chronic
period of the model we had dephosphorylation of GluR1-Ser845
in cortex
and hippocampus, interestingly the reduction of phosphorylation occurs
in periods when the animal present crises. This aspect is not addressed
in the present study, however, it is important to note that different
populations of neurons are present in the hippocampus and cortex.
Therefore, one possibility is that the dephosphorylation might occur
mainly in GABAergic neurons thus leaving the animal susceptive to
seizures onset.
Regarding the expression profile of NR1 subunit of NMDA
receptor and the glial glutamate transporters (EAAT1 and EAAT2), it
was observed a downregulation of mRNA expression of NR1 subunit of
NMDA receptor in the cortex, in the latent period which the seizures are
no longer detected. Curiously, a down regulation of glial glutamate
transporters EAAT1 and EAAT2 mRNA was also found in this period.
However, if we consider the paralleled decrease of both NR1 subunit of
NMDA receptor and GluR1 subunit of AMPA receptor in the same
period, it is possible suppose that in the latent period there is a
weakening of cortical excitatory synapses due to downregulation of
crucial glutamate receptors subunits.
In the hippocampus EAAT2 mRNA expression decreased in the
chronic period, when compared to control group, phase in which the
animal present spontaneous seizures. Paralleled to this aspect, an
upregulation (5 times) of NR1 subunit of NMDA receptor mRNA was
also found in the chronic period. These results support the idea that the
decrease in uptake of excitatory neurotransmitter glutamate from the
synaptic cleft together with an increased expression of NR1 subunit of
51
NMDA receptor may contribute to seizures occurrence observed in the
chronic period (Rakhade & Loeb, 2008).
It is possible that a reduction in the glutamate reuptake due to
lower EAATs expression observed in the hippocampus but not in the
cortex could explain the differences in the hyperexcitability at the
epileptogenic zone (hippocampus) in comparison to distant cortical
regions. In fact, studies in rodent models suggest a causal effect of
EAAT down-regulation in epileptogenesis (Rothstein, et al. 1996;
Tanaka, et al. 1997; Septuky, et al. 2002). Consistently, blocking
glutamate uptake leads to elevated extracellular glutamate levels and
increased local network excitability, resulting in a decreased threshold
for evoking epileptiform activity as well as spontaneous epileptiform
discharges in rat neocortex (Campbell & Hablitz, 2004). Di Maio and
colleagues (2011) also show that primary hippocampal neurons and
animals treated with pilocarpine presented an upregulation in NMDA
receptor subunit NR1 and NR2B (Di Maio, et al. 2011).
In the present study we applied an approach in which relative
small biochemical changes in the level of protein phosphorylation,
protein content or mRNA were detected. However, the measurements
were performed in the whole cortex and hippocampus and it was not
characterized the sub-regions or cell type (like neurons or astrocytes) in
which the changes occurred. In fact, although the subunit NR1 of
NMDA and the phosphorylated sites of subunit GluR1 of AMPA are
largely expressed in neurons, they may also be expressed in glial cells
especially after insults (Gottlieb & Matute, 1997; Fan, et al. 1999;
Seifert, et al. 2003). Concerning the glutamate transporters EAAT1 and
2 they are predominantly expressed by astrocytes (Lee & Pow, 2010),
but neuronal death and astrogliosis may change their expression.
Therefore, an approach like immunohistochemistry for sub-region and
cell characterization, with reference to the proteins which the activity or
expression profile was altered, will be required in future studies.
Altogether, the present findings concerning the profile of
expression and post-translational modification of synaptic signaling
elements demonstrated that complex changes in the glutamatergic
system, triggered by Pilo-SE, take place in hippocampus and neocortex.
Comprehension of these modifications may help to understand the
mechanisms of epileptogenesis and modulation of seizure threshold.
52
Aknowledgment: Work supported by Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq), Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Projeto
CAPES/PROCAD, Fundação de Apoio à Pesquisa Cientifica e
Tecnológica do Estado de Santa Catarina (FAPESC-PRONEX: Núcleo
de Excelência em Neurociências Aplicadas de Santa Catarina -
NENASC).
‘We confirm that we have read the Journal’s position on issues involved
in ethical publication and affirm that this report is consistent with those
guidelines.’
53
Figure 1. Western Blot analysis of phosphorylated GluR1 subunit in the
hippocampus (A-D) and cortex (E-H) of rats submitted to the pilocarpine model
of epilepsy. The panel (A) shows a representative blot of hippocampal
immunoreactivity of phospho-GluR1–Ser831
, phospho-GluR1–Ser845
, total-
GluR1 and β-actin (used as load control). The panels (B-D) show the
hippocampal quantification of phospho-GluR1-Ser831
(B), phospho-GluR1-
Ser845
(C) and the total levels of GluR1 (D). The panel (E) shows a
representative blot of cortical immunoreactivity of phospho-GluR1–Ser831
,
phospho-GluR1–Ser845
, total-GluR1 and β-actin (used as load control). The
panels (F-H) show the cortical quantification of phospho-GluR1-Ser831
(F),
phospho-GluR1-Ser845
(G) and the total levels of GluR1 (H). The
phosphorylation level of each site was determined by computer-assisted
densitometry as a ratio of the O.D. of the phosphorylated band over the O.D. of
the total band and the data are expressed as percentage of the control. The
values are presented as mean ± S.E.M derived from 8 independent experiments.
Abbreviations: (Ct) control group; (Ac) acute 1h, 3h, 12h SE group; (Lt) latent
group; (Chr) chronic group. *p<0.05, **p<0.01.
54
Figure 2. The phosphorylation of AMPA receptor GluR1 subunit in the
hippocampus (A) and cortex (B) of rats submitted to the pilocarpine model of
epilepsy. Curves were drawn to fit the data points plotted in figure 2 (GluR1).
Raw data for each graph (INTOD P/T) were normalized to the respective
maximal value, expressed as activation level (y-axis) and reported in a time
scale (x-axis). The panels (A) hippocampus and (B) cortex show: grey lines,
GluR1-Ser831
phosphorylation; red lines, GluR1-Ser845
phosphorylation; orange
lines, GluR1 immunocontent. Filled square are used to evidentiate the points
statistically different from control (p<0.05). Abbreviations: (Ct) control group;
(Ac) acute 1h, 3h, 12h SE group; (Lt) latent group; (Chr) chronic group.
55
Figure 3. Real-Time RT-PCR assay analysis of EAATs mRNA expression
levels in the hippocampus (A-B) and cortex (C-D) of rats submitted to the
pilocarpine model of epilepsy. The panels (A-B) show the hippocampal relative
quantification of EAAT1 (A) and EAAT2 (B). The panels (C-D) show the
cortical relative quantification of EAAT1 (A) and EAAT2 (B). All data
represent a relative quantification to GAPDH expression level of each sample.
The values are presented as mean ± S.E.M derived from 4 independent
experiments. Abbreviations: (Ct) control group; (Ac) acute 1h, 3h, 12h SE
group; (Lt) latent group; (Chr) chronic group. *p<0.05, **p<0.01.
56
Figure 4. Real-Time RT-PCR assay analysis of NR1 mRNA expression levels
in the hippocampus (A) and cortex (B) of rats submitted to the pilocarpine
model of epilepsy. The panel (A) shows the hippocampal relative quantification
of NR1. The panel (B) shows the cortical relative quantification of NR1. All
data represent a relative quantification to GAPDH expression level of each
sample. The values are presented as mean ± S.E.M derived from 4 independent
experiments. Abbreviations: (Ct) control group; (Ac) acute 1h, 3h, 12h SE
group; (Lt) latent group; (Chr) chronic group. *p<0.05.
57
Figure 5. The EAATs and NR1 mRNA expression levels in the hippocampus
(A) and cortex (B) of rats submitted to the pilocarpine model of epilepsy.
Curves were drawn to fit the data points plotted in figure 3 (EAAT1/2), figure 4
(NR1). All data represent a relative quantification to GAPDH expression level
of each sample, were normalized to the respective maximal value, expressed as
expression level (y-axis) and reported in a time scale (x-axis). The panels (A)
hippocampus and (B) cortex show: grey lines, EAAT1 expression; red lines,
EAAT2 expression; orange lines, NR1 expression. Filled square are used to
indicate the points statistically different from control (p<0.05). Abbreviations:
(Ct) control group; (Ac) acute 1h, 3h, 12h SE group; (Lt) latent group; (Chr)
chronic group.
58
References
Babb TL. (1999) Synaptic reorganizations in human and rat
hippocampal epilepsy. Adv Neurol 79:763-779.
Banke TG, Bowie D, Lee H, Huganir RL, Schousboe A, Traynelis SF.
(2000) Control of GluR1 AMPA receptor function by cAMP-
dependent protein kinase. J Neurosci 20:89-102.
Beart PM, O'Shea RD. (2007) Transporters for L-glutamate: an update
on their molecular pharmacology and pathological involvement.
Br J Pharmacol 150:5-17.
Bernabeu R, Bevilaqua L, Ardenghi P, Bromberg E, Schmitz P,
Bianchin M, Izquierdo I, Medina JH. (1997) Involvement of
hippocampal cAMP/cAMP-dependent protein kinase signaling
pathways in a late memory consolidation phase of aversively
motivated learning in rats. Proc Natl Acad Sci U S A 94:7041-
7046.
Bernabeu R, Izquierdo I, Cammarota M, Jerusalinsky D, Medina JH.
(1995) Learning-specific, time-dependent increase in
[3H]phorbol dibutyrate binding to protein kinase C in selected
regions of the rat brain. Brain Res 685:163-168.
Boehm J, Kang MG, Johnson RC, Esteban J, Huganir RL, Malinow R.
(2006) Synaptic incorporation of AMPA receptors during LTP
is controlled by a PKC phosphorylation site on GluR1. Neuron
51:213-225.
Bonan CD, Walz R, Pereira GS, Worm PV, Battastini AM, Cavalheiro
EA, Izquierdo I, Sarkis JJ. (2000) Changes in synaptosomal
ectonucleotidase activities in two rat models of temporal lobe
epilepsy. Epilepsy Res 39:229-238.
Boulton CL, McCrohan CR, O'Shaughnessy CT. (1993) Cyclic AMP
analogues increase excitability and enhance epileptiform activity
in rat neocortex in vitro. Eur J Pharmacol 236:131-136.
Bracey JM, Kurz JE, Low B, Churn SB. (2009) Prolonged seizure
activity leads to increased Protein Kinase A activation in the rat
pilocarpine model of status epilepticus. Brain Res 1283:167-
176.
Calloni GW, Penno CA, Cordova FM, Trentin AG, Neto VM, Leal RB.
(2005) Congenital hypothyroidism alters the phosphorylation of
ERK1/2 and p38MAPK in the hippocampus of neonatal rats.
Brain Res Dev Brain Res 154:141-145.
59
Cammarota M, Bernabeu R, Levi De Stein M, Izquierdo I, Medina JH.
(1998) Learning-specific, time-dependent increases in
hippocampal Ca2+/calmodulin-dependent protein kinase II
activity and AMPA GluR1 subunit immunoreactivity. Eur J
Neurosci 10:2669-2676.
Campbell SL, Hablitz JJ. (2004) Glutamate transporters regulate
excitability in local networks in rat neocortex. Neuroscience
127:625-635.
Cavalheiro EA, Fernandes MJ, Turski L, Naffah-Mazzacoratti MG.
(1994) Spontaneous recurrent seizures in rats: amino acid and
monoamine determination in the hippocampus. Epilepsia 35:1-
11.
Cavalheiro EA, Leite JP, Bortolotto ZA, Turski WA, Ikonomidou C,
Turski L. (1991) Long-term effects of pilocarpine in rats:
structural damage of the brain triggers kindling and spontaneous
recurrent seizures. Epilepsia 32:778-782.
Chomczynski P, Sacchi N. (1987) Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem 162:156-159.
Cordova FM, Rodrigues AL, Giacomelli MB, Oliveira CS, Posser T,
Dunkley PR, Leal RB. (2004) Lead stimulates ERK1/2 and
p38MAPK phosphorylation in the hippocampus of immature
rats. Brain Res 998:65-72.
Costa MS, Rocha JB, Perosa SR, Cavalheiro EA, Naffah-Mazzacoratti
Mda G. (2004) Pilocarpine-induced status epilepticus increases
glutamate release in rat hippocampal synaptosomes. Neurosci
Lett 356:41-44.
Di Maio R, Mastroberardino PG, Hu X, Montero L, Greenamyre JT.
(2011) Pilocapine alters NMDA receptor expression and
function in hippocampal neurons: NADPH oxidase and ERK1/2
mechanisms. Neurobiol Dis 42:482-495.
Esteban JA, Shi SH, Wilson C, Nuriya M, Huganir RL, Malinow R.
(2003) PKA phosphorylation of AMPA receptor subunits
controls synaptic trafficking underlying plasticity. Nat Neurosci 6:136-143.
Fan D, Grooms SY, Araneda RC, Johnson AB, Dobrenis K, Kessler JA,
Zukin RS. (1999) AMPA receptor protein expression and
function in astrocytes cultured from hippocampus. J Neurosci
Res 57:557-571.
Figueiredo CP, Antunes VL, Moreira EL, de Mello N, Medeiros R, Di
Giunta G, Lobao-Soares B, Linhares M, Lin K, Mazzuco TL,
60
Prediger RD, Walz R. (2011) Glucose-dependent insulinotropic
peptide receptor expression in the hippocampus and neocortex
of mesial temporal lobe epilepsy patients and rats undergoing
pilocarpine induced status epilepticus. Peptides 32:781-789.
Gottlieb M, Matute C. (1997) Expression of ionotropic glutamate
receptor subunits in glial cells of the hippocampal CA1 area
following transient forebrain ischemia. J Cereb Blood Flow
Metab 17:290-300.
Henley JM, Barker EA, Glebov OO. (2011) Routes, destinations and
delays: recent advances in AMPA receptor trafficking. Trends
Neurosci 34:258-268.
Hollmann M, Hartley M, Heinemann S. (1991) Ca2+ permeability of
KA-AMPA--gated glutamate receptor channels depends on
subunit composition. Science 252:851-853.
Houser CR, Huang CS, Peng Z. (2008) Dynamic seizure-related changes
in extracellular signal-regulated kinase activation in a mouse
model of temporal lobe epilepsy. Neuroscience 156:222-237.
Jerusalinsky D, Ferreira MB, Walz R, Da Silva RC, Bianchin M,
Ruschel AC, Zanatta MS, Medina JH, Izquierdo I. (1992)
Amnesia by post-training infusion of glutamate receptor
antagonists into the amygdala, hippocampus, and entorhinal
cortex. Behav Neural Biol 58:76-80.
Leal RB, Cordova FM, Herd L, Bobrovskaya L, Dunkley PR. (2002)
Lead-stimulated p38MAPK-dependent Hsp27 phosphorylation.
Toxicol Appl Pharmacol 178:44-51.
Lee A, Pow DV. (2010) Astrocytes: Glutamate transport and alternate
splicing of transporters. Int J Biochem Cell Biol 42:1901-1906.
Lee HK, Kameyama K, Huganir RL, Bear MF. (1998) NMDA induces
long-term synaptic depression and dephosphorylation of the
GluR1 subunit of AMPA receptors in hippocampus. Neuron
21:1151-1162.
Lee HK, Takamiya K, Han JS, Man H, Kim CH, Rumbaugh G, Yu S,
Ding L, He C, Petralia RS, Wenthold RJ, Gallagher M, Huganir
RL. (2003) Phosphorylation of the AMPA receptor GluR1
subunit is required for synaptic plasticity and retention of spatial
memory. Cell 112:631-643.
Leite JP, Neder L, Arisi GM, Carlotti CG, Jr., Assirati JA, Moreira JE.
(2005) Plasticity, synaptic strength, and epilepsy: what can we
learn from ultrastructural data? Epilepsia 46 Suppl 5:134-141.
61
Li Y, Peng Z, Xiao B, Houser CR. (2010) Activation of ERK by
spontaneous seizures in neural progenitors of the dentate gyrus
in a mouse model of epilepsy. Exp Neurol 224:133-145.
Livak KJ, Schmittgen TD. (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta
C(T)) Method. Methods 25:402-408.
Mello LE, Cavalheiro EA, Tan AM, Kupfer WR, Pretorius JK, Babb
TL, Finch DM. (1993) Circuit mechanisms of seizures in the
pilocarpine model of chronic epilepsy: cell loss and mossy fiber
sprouting. Epilepsia 34:985-995.
Oliveira CS, Rigon AP, Leal RB, Rossi FM. (2008) The activation of
ERK1/2 and p38 mitogen-activated protein kinases is
dynamically regulated in the developing rat visual system. Int J
Dev Neurosci 26:355-362.
Peterson GL. (1977) A simplification of the protein assay method of
Lowry et al. which is more generally applicable. Anal Biochem
83:346-356.
Posser T, de Aguiar CB, Garcez RC, Rossi FM, Oliveira CS, Trentin
AG, Neto VM, Leal RB. (2007) Exposure of C6 glioma cells to
Pb(II) increases the phosphorylation of p38(MAPK) and
JNK1/2 but not of ERK1/2. Arch Toxicol 81:407-414.
Rakhade SN, Loeb JA. (2008) Focal reduction of neuronal glutamate
transporters in human neocortical epilepsy. Epilepsia 49:226-
236.
Rakhade SN, Zhou C, Aujla PK, Fishman R, Sucher NJ, Jensen FE.
(2008) Early alterations of AMPA receptors mediate synaptic
potentiation induced by neonatal seizures. J Neurosci 28:7979-
7990.
Rothstein JD, Dykes-Hoberg M, Pardo CA, Bristol LA, Jin L, Kuncl
RW, Kanai Y, Hediger MA, Wang Y, Schielke JP, Welty DF.
(1996) Knockout of glutamate transporters reveals a major role
for astroglial transport in excitotoxicity and clearance of
glutamate. Neuron 16:675-686.
Sander JW. (2003) The epidemiology of epilepsy revisited. Curr Opin Neurol 16:165-170.
Sanderson JL, Dell'Acqua ML. (2011) AKAP signaling complexes in
regulation of excitatory synaptic plasticity. Neuroscientist 17:321-336.
Seifert G, Weber M, Schramm J, Steinhauser C. (2003) Changes in
splice variant expression and subunit assembly of AMPA
62
receptors during maturation of hippocampal astrocytes. Mol
Cell Neurosci 22:248-258.
Sepkuty JP, Cohen AS, Eccles C, Rafiq A, Behar K, Ganel R, Coulter
DA, Rothstein JD. (2002) A neuronal glutamate transporter
contributes to neurotransmitter GABA synthesis and epilepsy. J
Neurosci 22:6372-6379.
Tanaka K, Watase K, Manabe T, Yamada K, Watanabe M, Takahashi
K, Iwama H, Nishikawa T, Ichihara N, Kikuchi T, Okuyama S,
Kawashima N, Hori S, Takimoto M, Wada K. (1997) Epilepsy
and exacerbation of brain injury in mice lacking the glutamate
transporter GLT-1. Science 276:1699-1702.
Walz R, Roesler R, Quevedo J, Sant'Anna MK, Madruga M, Rodrigues
C, Gottfried C, Medina JH, Izquierdo I. (2000) Time-dependent
impairment of inhibitory avoidance retention in rats by
posttraining infusion of a mitogen-activated protein kinase
kinase inhibitor into cortical and limbic structures. Neurobiol Learn Mem 73:11-20.
Yokoyama N, Mori N, Kumashiro H. (1989) Chemical kindling induced
by cAMP and transfer to electrical kindling. Brain Res 492:158-
162.
63
5.2 MANUSCRITO 2
Time-dependent modulation of mitogen activated protein kinases
and AKT in rat hippocampus and cortex in the pilocarpine model of
epilepsy
Mark William Lopes
1, Flávia Mahatma Schneider Soares
2, Nelson de
Mello2, Jean Costa Nunes
2, Fabiano Mendes de Cordova
1,3, Roger
Walz2,4
, Rodrigo Bainy Leal1
1
Departamento de Bioquímica, Centro de Ciências Biológicas, Universidade Federal de Santa Catarina, Florianópolis, SC, Brazil 2 Centro de Neurociências Aplicadas (CeNAp), HU, Universidade
Federal de Santa Catarina, Florianópolis, SC, Brazil 3
Escola de Medicina Veterinária e Zootecnia, Universidade Federal do
Tocantins, Araguaína, TO, Brazil. 4 Departamento de Clínica Médica, Hospital Universitário (HU), Centro
de Ciências da Saúde, Universidade Federal de Santa Catarina,
Florianópolis, SC, Brazil
Corresponding author:
Rodrigo Bainy Leal
Universidade Federal de Santa Catarina
Centro de Ciências Biológicas
Departamento de Bioquímica
Campus Universitário
Florianópolis, SC, Brazil - 88040-900
Telephone number: 55 48 37215045
Fax number: 55 48 37219672
E-mail: [email protected]
64
ABSTRACT
The epileptogenesis may involve a variety of signaling events that
culminate with synaptic reorganization. Mitogen-activated protein
kinases (MAPKs) and AKT may be activated by diverse stimulus
including neurotransmitter and growth factors and are involved in
synaptic plasticity in the hippocampus and cerebral cortex. The
pilocarpine model in rodents reproduces the main features of mesial
temporal lobe epilepsy related to hippocampus sclerosis (MTLE-HS) in
humans. We analyze the phosphorylation profile of MAPKs (ERK 1/2,
p38MAPK
, JNK1/2/3) and AKT by western blotting in the hippocampus
(Hip) and cortex (Ctx) of male adult wistar rats in different periods, after
pilocarpine induced status epilepticus (Pilo-SE) and compared with
control animals. Biochemical analysis were done in the Hip and Ctx at
1h, 3h, 12h (acute period), 5 days (latent period) and 50 days (chronic
period) after Pilo-SE onset. Hence, the main findings include increased
phosphorylation of ERK1 and p38MAPK
in the Hip and Ctx 1h and 12h
after the Pilo-SE onset. The JNK2/3 isoform (54kDa) phosphorylation
was decreased at 3h after the Pilo-SE onset and in the chronic period in
the Hip and Ctx. The AKT phosphorylation increased only in the Hip
during the latent period. Our findings demonstrate that in a time and
structure dependent manner different sets of proteins kinases are
modulated in response to pilocarpine. These signaling changes may be
related to modifications in the intrinsic neuronal physiology and
epileptogenic synaptic network that appears in the MTLE-HS.
Key words: Epilepsy, Pilocarpine, Hippocampus, Cortex, MAPKs,
AKT.
65
1. Introduction
Epilepsies are one of the most common neurological conditions
reaching about 50 million people worldwide [1]. Focal epilepsies are
characterized by spontaneous recurrent seizures triggered by abnormal
hyperescitable and hypersincronic electrical activity in limbic or cortical
regions [2,3]. Temporal lobe epilepsy [4] is the most common form of
focal epilepsy, affecting around 20% of all patients with epilepsy.
Twenty to thirty percent of the epilepsies are medically intractable and
mesial temporal lobe epilepsy related to hippocampal sclerosis (MTLE-
HS) is the most common form of surgically remediable epileptic
syndrome [5].
Systemic administration of pilocarpine in rodents reproduces
the main features of human MTLE-HS [4,6]. Pilocarpine induces limbic
seizures that become secondarily generalized evolving to status
epilepticus (Pilo-SE) that lasts several hours (acute period). The SE is
followed by a latent ‘‘seizure-free” period and by a chronic period
characterized by the presence of spontaneous recurrent seizures [6-8].
Hippocampal changes following SE include an increase in glutamate in
the synaptic cleaft [9], cell loss, gliosis and mossy fiber sprouting [8].
Neurochemical changes such as imbalance between inhibitory (γ-
aminobutyric acid; GABA) and excitatory (glutamate-mediated)
neurotransmission (in favor of the latter) have been identified in brain
tissue obtained from animal models and humans treated surgically for
MTLE-HS. However, the cellular and molecular events in vivo that
occur during epileptogenic process as well in the chronic period are still
poorly understood [10,11].
Mitogen-activated protein kinases (MAPKs) are a group of
serine-threonine kinases whose function and regulation have been
conserved throughout evolution from unicellular organisms like yeast to
complex organisms such as humans [12,13]. The MAPKs amplify and
integrate signals originating from a variety of extracellular stimuli and
may regulate cell differentiation, survival, cell death and synaptic
potentiation [14]. In the hippocampus and cerebral cortex activation of
MAPK pathway may occur in response to glutamate, through activation
of N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-
methyl-4-isoxazolepropionic acid (AMPA) receptors [15,16], growth
factors and cytokines [14]. Moreover, activation of other kinases such as
cAMP-dependent protein kinase (PKA) [17], Ca2+
-calmodulin-
dependent protein kinases II (CaMKII) [18], protein kinase C (PKC)
[19] can also modulate MAPKs [20]. All these signaling systems are
66
involved in synaptic plasticity and changes may be associated with
physiologic and pathologic processes including epileptogenesis [21].
The best known MAPKs include the extracellular signal-
regulated kinases 1 and 2 (ERK1/2), c-Jun amino-terminal kinases 1 to 3
(JNK1/2/3) and p38MAPK
(α, β, γ and δ) [22]. These enzymes are
serine/threonine kinases that become functional upon phosphorylation at
both a threonine and a tyrosine residue by an upstream MAPK [23,24].
Previous studies have demonstrated increase in ERK and p38MAPK
activity immediately following seizure induction in different animal
models, including Pilo-SE [25-32]. However, there are no systematic
studies demonstrating the profile of modulation for each MAPK
considering the various phases of the pilocarpine model.
The PI3K/AKT pathway is implicated in neuronal survival and
neuroplasticity. Studies with selective inhibitors of PI3-kinase can cause
death of cerebellar granule cells [33]. In addition, AKT can
phosphorylate and activate proteins involved in cell survival [34].
Inhibition of pro-apoptotic mediators such as Bad, family members of
transcription factors forkhead as FOXO and NFκB activation are
examples of targets modulated by AKT. It is known that cell survival
pathways may be also activated during Pilo-SE [35] and is possible that
glutamate excitotoxicity [9,36,37] related to Pilo-SE might be
counteracted by neuroprotective mechanisms that include AKT
activation [38].
Epileptogenesis is a complex process that may involve synaptic
reorganization and cell death. Since MAPKs and AKT are well known
enzymes capable to regulate neuroplasticity and cell survival, the main
aim of the present study was investigate the level and modulation of
ERK1/2, p38MAPK
, JNK1/2/3 and AKT in the hippocampus and cortex
of rats at different periods in the pilocarpine model.
2. Materials and Methods
2.1 Chemicals
HEPES, Triton X-100, SDS, acrylamide, bis-acrylamide, were
obtained from GE Healthcare Life Science. Glycine, Tris, TEMED, β
mercaptoethanol were obtained from Amresco Life Science. Bovine
serum albumin (BSA) was from Inlab. Immobilon nitrocellulose and
goat anti-rabbit IgG HRP (horseradish peroxidase) was from the
Millipore. Ammonium persulfate (APS), rabbit anti-total-ERK1/2, anti-
total-JNK1/2, anti-phospho-AKT, anti-phospho and anti-total-p38MAPK
67
were purchased from the Sigma Chemical Company. Rabbit anti-
phospho-ERK1/2, anti-phospho-JNK1/2/3, anti-total-AKT antibodies,
LumiGLO reagent (luminol chemiluminescent substrate) were obtained
from Cell Signaling Technology. Mouse anti-β actin as well goat anti-
mouse IgG HRP conjugated antibodies were obtained from Santa Cruz
Biotechnology. All other reagents were of analytical grade.
2.2 Animal procedures
Adult male wistar rats (90 days old) from the Federal University
of Santa Catarina (UFSC) breeding colony were maintained in groups of
four per cage, room temperature between 22-25oC on a 12-h light/dark
cycle with water and food available ad libitum. All experimental
procedures were approved by the UFSC Ethics Committee of Animal
Experiments. Pilo-SE induction was performed as described previously
[6,8,39]. A subcutaneously administration of 1 mg/kg of scopolamine
methylnitrate (Sigma Chemical, dissolved in saline 0.9%) 30 min before
pilocarpine administration to reduce the peripheral cholinergic effects.
Animals received a single intraperitoneal dose of pilocarpine (280
mg/kg, Sigma Chemical, dissolved in saline 0.9%), and most of them
became hypoactive evolving to generalized convulsions and limbic SE
usually 40-80 min after the injection. Two hours after the seizure onset
animals received diazepam (5mg/kg) to decrease the mortality rate.
Assisted feeding and hydration were carried out during the recovery
period to improve general clinical state and to reduce mortality. In this
model, after a silent period of 14 days (ranging from 4–44 days), all
animals developed spontaneous seizures (2–15 per month),
characterizing the chronic period. Pilocarpine were injected in 60
animals, the mortality rate was 25% (n = 15) and 5 animals (8 percent)
did not evolve to SE. Only animals that evolve to SE (n = 40, 67
percent) were used in the biochemical analyses.
Survivors animals were divided in five groups: a) acute groups
which were euthanized 1 h (Group Acute 1h) after status epilepticus
(SE) onset (n = 8); b) 3 h (Group Acute 3h) after SE onset (n = 8) and c)
12 h (Group Acute 12h) after SE onset (n = 8); d) latent group that were
euthanized 5 days (Group Latent 5 days) after SE onset (n = 8), a period
which the seizure were not observed; e) chronic group which the
animals were euthanized 50 days (Group Chronic 50 days) after SE
induction (n = 8). The animals from the latent group were behaviorally
evaluated for 6 hours per day (8 a.m. to 2 p.m.) between days 3 to 5 and
no clinically visible seizure were documented. The control animals
68
were sacrificed 1h, 3h, 12h, 5 and 50 days (n = 8 per group), after
scopolamine, diazepam and saline injection except the animals from the
Group Acute 1h and their respective controls who did not received
diazepam. The experimental procedures are depicted in figure 1.
Hippocampus and cortex dissected from different animals of control and
experimental groups (n = 8 animals per group) for proteins analysis. The
level of activation of MAPKs (ERK 1/2, p38MAPK
, JNK 1/2/3) and AKT
were analyzed by western blotting.
2.3 Western blot analysis
For quantification of MAPKs and AKT activation Western blot
analysis was performed as previously described by [40-42]. Animals
were euthanized by decapitation, brains were excised from the skull and
hippocampus and cortex were dissected (4°C) into “cutting solution”
(sucrose 110 mM, NaCl 60 mM, KCl 3 mM, KH2PO4 1.25 mM, CaCl2
0.5 mM, Mg2SO4 7 mM, glucose 5 mM; HEPES 25 mM pH 7.4), and
placed in liquid nitrogen and then stored at -80oC until use. Samples
were prepared as previously described by Oliveira and colleagues
(2008) [43]. Briefly, samples were mechanically homogenized in 400 µl
of Tris 50 mM pH 7.0, EDTA 1 mM, NaF 100 mM, PMSF 0.1 mM,
Na3VO4 2 mM, Triton X-100 1%, glycerol 10%, Sigma Protease
Inhibitor Cocktail (P2714) and then incubated for 10 min in ice. Lysates
were centrifuged (10,000 x g for 10 min, at 4oC) to eliminate cellular
debris. The supernatants were diluted 1/1 (v/v) in Tris 100 mM pH 6.8,
EDTA 4 mM, SDS 8% and boiled for 5 min. Thereafter, sample dilution
(40% glicerol, 100 mM Tris, bromophenol blue, pH 6.8) in the ratio
25:100 (v/v) and β mercaptoethanol (final concentration 8%) were
added on the samples. Protein content was estimated by the method
described by Peterson (1977) [44]. The same amount of protein (70 µg
per lane) for each sample was electrophoresed in 10% SDS–PAGE
minigels and transferred to nitrocellulose membranes using a semidry
blotting apparatus (1.2 mA/cm2; 1.5 h). To verify transfer efficiency
process, gels were stained with Coomassie blue and membranes with
Ponceau S.
The membranes were blocked with 5% skim milk in TBS (Tris
10 mM, NaCl 150 mM, pH 7.5). MAPKs, AKT phosphorylated and
total forms were detected after overnight incubation with specific
antibodies diluted in TBS-T containing BSA 2% in the dilutions of
1:1000 (anti-phospho-JNK1/2/3, anti-phospho-p38MAPK
, anti-phospho-
AKT and anti-total-AKT), 1:2000 (anti-phospho-ERK1/2), 1:5000 (anti-
69
total-JNK1/2) 1:10000 (anti-total-p38MAPK
) and 1:40000 (anti-total-
ERK1/2). Moreover, the membranes were incubated for 1h at room
temperature with horse radish peroxidase (HRP)-conjugated anti-rabbit
for detection of phosphorylated and total forms of each MAPK and
AKT. The reactions developed by chemioluminescence substrate
(LumiGLO). All blocking and incubation steps were followed by three
times washing (5 min) with TBS-T (Tris 10 mM, NaCl 150 mM,
Tween-20 0.1%, pH 7.5). All membranes were incubated with mouse
anti-β-actin (1:2000) antibody to verify that equal amounts of proteins
were loaded on the gel. The phosphorylation level of MAPKs and AKT
were determined as a ratio of OD of phosphorylated band/OD of total
band [42,45]. The bands were quantified using the Scion Image®
software.
The antibody against ERK1/2 detected two bands, one at
approximately 44 kDa and the second at approximately 42 kDa,
corresponding respectively to the two ERK isoforms, ERK1 and ERK2.
Anti-p38MAPK
detected a single band of approximately 38 kDa, anti-JNK
1/2/3 detected two bands, one at approximately 54 kDa and the second
at approximately 46 kDa, corresponding respectively to the three JNK
isoforms, JNK2/3 and JNK1, anti-AKT detected a single band of
approximately 60 kDa. The anti-β-actin antibody detected a single band
of approximately 45 kDa.
2.4 Statistical analysis
Phosphorylation of MAPKs, AKT during different experimental
model periods were compared using Student’s t-test. Data are presented
as mean ± S.E.M.; p < 0.05 was considered to be statistically significant.
3. Results
3.1 Phosphorylation levels of MAPKs and AKT in the hippocampus
after Pilo-SE induction
The phosphorylation of ERK1 increased in acute period, 1h
(17.29 ± 1.80%, p<0.01) and 12h (7.89 ± 1.64%, p<0.05) after SE onset
(Figure 2B). The increased ERK1 phosphorylation disappears during
latent and chronic periods. The ERK2 phosphorylation did not change in
any of the analyzed periods (Figure 2C).
The phosphorylation of p38MAPK
increased only 1h after SE
onset (10.54 ± 1.66%, p<0.05) (Figure 3B) and remained unchanged at
70
all other periods analyzed. The JNK2/3 (54 kDa) phosphorylation
decrease 3h after SE onset (11.18 ± 3.53%, p<0.05) and in the chronic
period (18.08 ± 7.09%, p<0.05) (Figure 4C). The phosphorylation of
JNK1 (46 kDa) was not altered in any of the periods analyzed (Figure
4B).
The Ser473
phosphorylation on AKT (activated form of AKT)
increase in the latent period (13.64 ± 3.25%, p<0.05) (Figure 5B).
3.2 Phosphorylation levels of MAPKs and AKT in the cortex after
Pilo-SE induction
Regarding the modulation of ERK in the cortex it was observed
a similar profile of activation than hippocampus. The ERK1
phosphorylation increased 1h (12.83 ± 2.14%, p<0.01) and 12h (8.60 ±
2.36%, p<0.01) after Pilo-SE onset (Figure 2E), while ERK2
phosphorylation increased (7.39 ± 2.41%, p<0.05) only in the acute
period at 1h (Figure 2F). The phosphorylation profile of p38MAPK
in the
cortex was changed only in the acute period of pilocarpine model. The
p38MAPK
phosphorylation increased (25.61 ± 4.55%, p<0.01) 1h after the
Pilo-SE onset (Figure 3D). Moreover, p38MAPK
phosphorylation
decreased (16.21 ± 6.75%, p<0.01) at 3h (Figure 3D), followed by an
increase (14.23 ± 3.03%, p<0.05) at 12h (Figure 3D) after the Pilo-SE
onset.
The phosphorylation of JNK2/3 decreases in the cortex 3h
(13.48 ± 3.17%, p<0.01) (Figure 4F), 5 days (13.00 ± 2.51%, p<0.01)
(Figure 4F) and in the chronic period (17.70 ± 6.89%, p<0.05) (Figure
4F). The phosphorylation of JNK1 (Figure 4E) and AKT (Figure 5D)
was not altered in any of analyzed periods.
Figure 6 depicts the modulation profile of all analyzed proteins
(MAPKs, AKT,) in the hippocampus and cortex in different times after
the Pilo-SE.
4. Discussion
Our results show for the first time a complete profile of MAPKs
and AKT activation in different areas and phases of the pilocarpine
model. MAPKs are a family of serine-threonine kinases that mediate
intracellular signaling associated with a variety of cellular activities
including cell proliferation, differentiation, cell survival and death and
synaptic plasticity [14,46,47]. In the present study phosphorylation of
ERK1 in the hippocampus and cortex increased in relation the control in
71
acute period, 1h and 12h post-first discrete seizure. These findings are
consistent with the work of Garrido and colleagues (1998) [26] that
show dynamic changes of ERK pathway following several types of
seizure activity. Moreover, ERK is strongly activated in neurons
following severe chemically-induced seizures [27]. The evaluation of
ERK1/2 signaling pathway was of particular interest because of its role
in several forms of synaptic and neuronal plasticity [24,48].
Phosphorylation of ERK and thus activation of the ERK cascade are
essential for LTP, and it has been involved in several forms of
hippocampal-dependent learning and memory and regulation of
neuronal excitability [49,50]. Activity-dependent plasticity are likely to
be involved in epilepsy and previous studies have demonstrated strong
increases of ERK activation immediately following pilocarpine or
kainate-induced status epilepticus [25-27], as well as seizures evoked by
electroconvulsive shock [28,29], bicuculline [30], and perforant path
stimulation [31].
Jiang and colleagues (2005) [32] observed that acute seizures
lead to a rapid activation of ERK and p38MAPK
in the hippocampal CA3
area, the brain region most susceptible to the lethal effects of epileptic
status. Pretreatment with the ERK inhibitor PD98059 and the p38MAPK
inhibitor SB203580 selectively reduces seizure elicited activation of
ERK and p38MAPK
, respectively, and significantly reduces priming
seizure-induced protection of CA3 neurons. Our results show for the
first time in literature that the phosphorylation of p38MAPK
in the
hippocampus and cortex increased in relation the control in acute period
in the pilocarpine model suggesting that p38MAPK
may be involved in the
epileptogenesis. In accord with this possibility it was shown that
inhibition of ERK and p38MAPK
activation results in a significant
reduction of seizure-induced neuronal degeneration in the rat
hippocampus [51,52], suggesting that excessive phosphorylation of
ERK and p38MAPK
could lead to irreversible neuronal degeneration.
Accumulated evidence has demonstrated that sustained epileptic status
in both humans and animals produces marked neuronal degeneration in
the hippocampus and several other regions [53-55], which prominently
intensifies chronic seizures and results in adverse long-term behavioral
and cognitive consequences [56].
Moreover, our results show for the first time that the
phosphorylation of 54 kDa JNK isoforms (JNK2/3) decreased 3h post-
first discrete seizure and in the chronic period of the model. Notably,
JNKs are a subfamily of MAP kinases mediators of apoptosis and
neurodegeneration but also actively involved in neuroplasticity and
72
regeneration. Mammalian JNKs are encoded by three distinct genes
(JNK1, JNK2, and JNK3), giving rise to at least 10 different splice
variants (isoforms). All variants share an epitope that needs to be dually
phosphorylated for JNK activation (phospho-JNK). In the hippocampus,
JNK1 is mainly expressed as a 46 kDa band, while JNK2 is mainly
expressed as a 54 kDa band. JNK3 is expressed as both isoforms: 46 and
54 kDa [57]. JNK isoforms exhibit various differences concerning the
response to stimulus, specificity toward substrates and regulation by
upstream kinases [57,58]. It is interesting to observe that JNK1 (46 kDa)
was more active in the basal state. Conversely, in some insults, such as
ischemia, the isoforms activated correspond to the 54 kDa band
indicating JNK2 and/or JNK3 involved in this process [57,59,60].
Regarding the decrease in phosphorylation of JNK 2/3 at 3h
could be associated with diazepam (5mg/kg) administration 2h after SE
onset, fact that justify a maximum excitation in the periods of 1 to 2h
[61]. However, this possibility is minimized because the same
treatments were applied to the respective control groups used for
comparison at different periods investigated in the model.
Analysis of AKT phosphorylation shows that this enzyme was
activated only in the hippocampus and in the latent period. Apparently,
this process may be related to a response mechanism to seizure-induced
cellular damage from acute period, in an attempt to diminish lesion.
Similar results were found by Kim and colleagues (2002) [62] which
AKT activation prevented excitotoxic cell death induced by kainic acid.
Moreover, Henshall and colleagues (2002) [63] observed that inhibition
of phosphatidylinositol 3-kinase, the upstream enzyme that activate
AKT, exacerbated cortical apoptosis after seizures induced by kainic
acid while uninjured cortex exhibited increased phosphorylation of
AKT. Furthermore, Lee and colleagues (2006) [64] showed that
administration of melatonin one hour before intracerebroventricular
(ICV) injection of kainic acid is capable to decrease death of pyramidal
neurons from region CA3 of the hippocampus, also via AKT activation.
In the present study we applied an approach in which relative
small biochemical changes in the level of protein phosphorylation and
protein content were detected. However, the measurements were
performed in the whole cortex and hippocampus and it was not
characterized the sub-regions or cell type (like neurons or astrocytes) in
which the changes occurred. The pathway of activation of MAPKs and
AKT may occur in different cell types in the central nervous system
(CNS) [65,66]. Therefore, an approach such as immunohistochemistry
73
for analyses of alterations of protein profile in specific sub-region and
cell types will be required in future studies.
Altogether it is possible to postulate that SE may trigger
activation of distinct protein kinase signaling pathways that in turn may
alter gene expression and produce long-lasting neuronal disturbance.
Pilocarpine initially stimulates muscarinic cholinergic receptors, causing
subsequent stimulation of glutamatergic pathways and the activation of
AMPA and NMDA glutamate receptors, which might trigger the MAPK
phosphorylation [30,67]. Data from our study showed a profile of a
diversity of signaling pathways in response to pilocarpine. The main
finds include increased phosphorylation of ERK and p38MAPK
in acute
period and AKT activation of latent period. The activation of ERK and
p38MAPK
could lead to irreversible neuronal degeneration and/or
synaptic changes in acute period. The AKT signaling pathway could
contribute on the establishment of cell survival mechanisms. Finally,
activation of ERK, p38MAPK
and AKT may be intimately involved with
the onset of seizures leading to be possible therapeutic candidates for
epilepsy treatment.
Aknowledgment: Work supported by Conselho Nacional de
Desenvolvimento Científico e Tecnológico (CNPq), Coordenação de
Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Projeto
CAPES/PROCAD, Fundação de Apoio à Pesquisa Cientifica e
Tecnológica do Estado de Santa Catarina (FAPESC-PRONEX), (Núcleo
de Excelência em Neurociências Aplicadas de Santa Catarina -
NENASC). Universidade Federal de Santa Catarina (UFSC).
Conflict of Interest statement: The authors declare that they have no
conflict of interest.
74
References
1. Sander JW (2003) The epidemiology of epilepsy revisited. Curr Opin
Neurol 16 (2):165-170.
2. Dichter MA (1994) Emerging insights into mechanisms of epilepsy:
implications for new antiepileptic drug development. Epilepsia
35 Suppl 4:S51-57
3. Duncan JS, Sander JW, Sisodiya SM, Walker MC (2006) Adult
epilepsy. Lancet 367 (9516):1087-1100.
4. Hollmann M, Hartley M, Heinemann S (1991) Ca2+ permeability of
KA-AMPA--gated glutamate receptor channels depends on
subunit composition. Science 252 (5007):851-853
5. Babb TL (1999) Synaptic reorganizations in human and rat
hippocampal epilepsy. Adv Neurol 79:763-779
6. Cavalheiro EA, Leite JP, Bortolotto ZA, Turski WA, Ikonomidou C,
Turski L (1991) Long-term effects of pilocarpine in rats:
structural damage of the brain triggers kindling and spontaneous
recurrent seizures. Epilepsia 32 (6):778-782
7. Cavalheiro EA, Fernandes MJ, Turski L, Naffah-Mazzacoratti MG
(1994) Spontaneous recurrent seizures in rats: amino acid and
monoamine determination in the hippocampus. Epilepsia 35
(1):1-11
8. Mello LE, Cavalheiro EA, Tan AM, Kupfer WR, Pretorius JK, Babb
TL, Finch DM (1993) Circuit mechanisms of seizures in the
pilocarpine model of chronic epilepsy: cell loss and mossy fiber
sprouting. Epilepsia 34 (6):985-995
9. Costa MS, Rocha JB, Perosa SR, Cavalheiro EA, Naffah-
Mazzacoratti Mda G (2004) Pilocarpine-induced status
epilepticus increases glutamate release in rat hippocampal
synaptosomes. Neurosci Lett 356 (1):41-44.
10. Houser CR, Huang CS, Peng Z (2008) Dynamic seizure-related
changes in extracellular signal-regulated kinase activation in a
mouse model of temporal lobe epilepsy. Neuroscience 156
(1):222-237.
11. Li Y, Peng Z, Xiao B, Houser CR (2010) Activation of ERK by
spontaneous seizures in neural progenitors of the dentate gyrus
in a mouse model of epilepsy. Exp Neurol 224 (1):133-145.
12. Nebreda AR, Porras A (2000) p38 MAP kinases: beyond the stress
response. Trends Biochem Sci 25 (6):257-260.
75
13. Johnson GL, Lapadat R (2002) Mitogen-activated protein kinase
pathways mediated by ERK, JNK, and p38 protein kinases.
Science 298 (5600):1911-1912.
14. Kim EK, Choi EJ (2010) Pathological roles of MAPK signaling
pathways in human diseases. Biochim Biophys Acta 1802
(4):396-405.
15. Jerusalinsky D, Ferreira MB, Walz R, Da Silva RC, Bianchin M,
Ruschel AC, Zanatta MS, Medina JH, Izquierdo I (1992)
Amnesia by post-training infusion of glutamate receptor
antagonists into the amygdala, hippocampus, and entorhinal
cortex. Behav Neural Biol 58 (1):76-80
16. Sweatt JD (2001) The neuronal MAP kinase cascade: a biochemical
signal integration system subserving synaptic plasticity and
memory. J Neurochem 76 (1):1-10
17. Bernabeu R, Bevilaqua L, Ardenghi P, Bromberg E, Schmitz P,
Bianchin M, Izquierdo I, Medina JH (1997) Involvement of
hippocampal cAMP/cAMP-dependent protein kinase signaling
pathways in a late memory consolidation phase of aversively
motivated learning in rats. Proc Natl Acad Sci U S A 94
(13):7041-7046
18. Cammarota M, Bernabeu R, Levi De Stein M, Izquierdo I, Medina
JH (1998) Learning-specific, time-dependent increases in
hippocampal Ca2+/calmodulin-dependent protein kinase II
activity and AMPA GluR1 subunit immunoreactivity. Eur J
Neurosci 10 (8):2669-2676
19. Bernabeu R, Izquierdo I, Cammarota M, Jerusalinsky D, Medina JH
(1995) Learning-specific, time-dependent increase in
[3H]phorbol dibutyrate binding to protein kinase C in selected
regions of the rat brain. Brain Res 685 (1-2):163-168.
20. Walz R, Roesler R, Quevedo J, Sant'Anna MK, Madruga M,
Rodrigues C, Gottfried C, Medina JH, Izquierdo I (2000) Time-
dependent impairment of inhibitory avoidance retention in rats
by posttraining infusion of a mitogen-activated protein kinase
kinase inhibitor into cortical and limbic structures. Neurobiol
Learn Mem 73 (1):11-20.
21. Sanderson JL, Dell'Acqua ML (2011) AKAP signaling complexes in
regulation of excitatory synaptic plasticity. Neuroscientist 17
(3):321-336.
22. Cargnello M, Roux PP (2011) Activation and function of the
MAPKs and their substrates, the MAPK-activated protein
kinases. Microbiol Mol Biol Rev 75
76
23. Chen Z, Gibson TB, Robinson F, Silvestro L, Pearson G, Xu B,
Wright A, Vanderbilt C, Cobb MH (2001) MAP kinases. Chem
Rev 101 (8):2449-2476.
24. Thomas GM, Huganir RL (2004) MAPK cascade signalling and
synaptic plasticity. Nat Rev Neurosci 5 (3):173-183.
25. Kim YS, Hong KS, Seong YS, Park JB, Kuroda S, Kishi K,
Kaibuchi K, Takai Y (1994) Phosphorylation and activation of
mitogen-activated protein kinase by kainic acid-induced seizure
in rat hippocampus. Biochem Biophys Res Commun 202
(2):1163-1168.
26. Garrido YC, Sanabria ER, Funke MG, Cavalheiro EA, Naffah-
Mazzacoratti MG (1998) Mitogen-activated protein kinase is
increased in the limbic structures of the rat brain during the
early stages of status epilepticus. Brain Res Bull 47 (3):223-
229.
27. Berkeley JL, Decker MJ, Levey AI (2002) The role of muscarinic
acetylcholine receptor-mediated activation of extracellular
signal-regulated kinase 1/2 in pilocarpine-induced seizures. J
Neurochem 82 (1):192-201
28. Baraban JM, Fiore RS, Sanghera JS, Paddon HB, Pelech SL (1993)
Identification of p42 mitogen-activated protein kinase as a
tyrosine kinase substrate activated by maximal
electroconvulsive shock in hippocampus. J Neurochem 60
(1):330-336
29. Bhat RV, Engber TM, Finn JP, Koury EJ, Contreras PC, Miller MS,
Dionne CA, Walton KM (1998) Region-specific targets of
p42/p44MAPK signaling in rat brain. J Neurochem 70 (2):558-
571
30. Gass P, Kiessling M, Bading H (1993) Regionally selective
stimulation of mitogen activated protein (MAP) kinase tyrosine
phosphorylation after generalized seizures in the rat brain.
Neurosci Lett 162 (1-2):39-42
31. Brisman JL, Rees Cosgrove G, Cole AJ (2002) Phosphorylation of
P42/P44 MAP kinase and DNA fragmentation in the rat
perforant pathway stimulation model of limbic epilepsy. Brain
Res 933 (1):50-59.
32. Jiang W, Van Cleemput J, Sheerin AH, Ji SP, Zhang Y, Saucier DM,
Corcoran ME, Zhang X (2005) Involvement of extracellular
regulated kinase and p38 kinase in hippocampal seizure
tolerance. J Neurosci Res 81 (4):581-588.
77
33. Miller TM, Tansey MG, Johnson EM, Jr., Creedon DJ (1997)
Inhibition of phosphatidylinositol 3-kinase activity blocks
depolarization- and insulin-like growth factor I-mediated
survival of cerebellar granule cells. J Biol Chem 272 (15):9847-
9853
34. Crossthwaite AJ, Hasan S, Williams RJ (2002) Hydrogen peroxide-
mediated phosphorylation of ERK1/2, Akt/PKB and JNK in
cortical neurones: dependence on Ca(2+) and PI3-kinase. J
Neurochem 80 (1):24-35
35. Goto EM, Silva Mde P, Perosa SR, Arganaraz GA, Pesquero JB,
Cavalheiro EA, Naffah-Mazzacoratti MG, Teixeira VP, Silva
JA, Jr. (2010) Akt pathway activation and increased
neuropeptide Y mRNA expression in the rat hippocampus:
implications for seizure blockade. Neuropeptides 44 (2):169-
176.
36. Oxbury JM, Whitty CW (1971) Causes and consequences of status
epilepticus in adults. A study of 86 cases. Brain 94 (4):733-744
37. Millan MH, Chapman AG, Meldrum BS (1993) Extracellular amino
acid levels in hippocampus during pilocarpine-induced seizures.
Epilepsy Res 14 (2):139-148.
38. Gary DS, Milhavet O, Camandola S, Mattson MP (2003) Essential
role for integrin linked kinase in Akt-mediated integrin survival
signaling in hippocampal neurons. J Neurochem 84 (4):878-
890.
39. Bonan CD, Walz R, Pereira GS, Worm PV, Battastini AM,
Cavalheiro EA, Izquierdo I, Sarkis JJ (2000) Changes in
synaptosomal ectonucleotidase activities in two rat models of
temporal lobe epilepsy. Epilepsy Res 39 (3):229-238.
40. Leal RB, Cordova FM, Herd L, Bobrovskaya L, Dunkley PR (2002)
Lead-stimulated p38MAPK-dependent Hsp27 phosphorylation.
Toxicol Appl Pharmacol 178 (1):44-51.
41. Cordova FM, Rodrigues AL, Giacomelli MB, Oliveira CS, Posser T,
Dunkley PR, Leal RB (2004) Lead stimulates ERK1/2 and
p38MAPK phosphorylation in the hippocampus of immature
rats. Brain Res 998 (1):65-72.
42. Posser T, de Aguiar CB, Garcez RC, Rossi FM, Oliveira CS, Trentin
AG, Neto VM, Leal RB (2007) Exposure of C6 glioma cells to
Pb(II) increases the phosphorylation of p38(MAPK) and
JNK1/2 but not of ERK1/2. Arch Toxicol 81 (6):407-414.
43. Oliveira CS, Rigon AP, Leal RB, Rossi FM (2008) The activation of
ERK1/2 and p38 mitogen-activated protein kinases is
78
dynamically regulated in the developing rat visual system. Int J
Dev Neurosci 26 (3-4):355-362.
44. Peterson GL (1977) A simplification of the protein assay method of
Lowry et al. which is more generally applicable. Anal Biochem
83 (2):346-356
45. Calloni GW, Penno CA, Cordova FM, Trentin AG, Neto VM, Leal
RB (2005) Congenital hypothyroidism alters the
phosphorylation of ERK1/2 and p38MAPK in the hippocampus
of neonatal rats. Brain Res Dev Brain Res 154 (1):141-145.
46. McCubrey JA, Lahair MM, Franklin RA (2006) Reactive oxygen
species-induced activation of the MAP kinase signaling
pathways. Antioxid Redox Signal 8 (9-10):1775-1789.
47. Dhillon AS, Hagan S, Rath O, Kolch W (2007) MAP kinase
signalling pathways in cancer. Oncogene 26 (22):3279-3290.
48. Sweatt JD (2004) Mitogen-activated protein kinases in synaptic
plasticity and memory. Curr Opin Neurobiol 14 (3):311-317.
49. Dudek SM, Fields RD (2001) Mitogen-activated protein
kinase/extracellular signal-regulated kinase activation in
somatodendritic compartments: roles of action potentials,
frequency, and mode of calcium entry. J Neurosci 21
(2):RC122.
50. Selcher JC, Weeber EJ, Christian J, Nekrasova T, Landreth GE,
Sweatt JD (2003) A role for ERK MAP kinase in physiologic
temporal integration in hippocampal area CA1. Learn Mem 10
(1):26-39.
51. Murray B, Alessandrini A, Cole AJ, Yee AG, Furshpan EJ (1998)
Inhibition of the p44/42 MAP kinase pathway protects
hippocampal neurons in a cell-culture model of seizure activity.
Proc Natl Acad Sci U S A 95 (20):11975-11980
52. Kim SW, Yu YM, Piao CS, Kim JB, Lee JK (2004) Inhibition of
delayed induction of p38 mitogen-activated protein kinase
attenuates kainic acid-induced neuronal loss in the
hippocampus. Brain Res 1007 (1-2):188-191.
53. Lothman EW, Bertram EH, 3rd (1993) Epileptogenic effects of
status epilepticus. Epilepsia 34 Suppl 1:S59-70
54. Wasterlain CG, Fujikawa DG, Penix L, Sankar R (1993)
Pathophysiological mechanisms of brain damage from status
epilepticus. Epilepsia 34 Suppl 1:S37-53
55. Hopkins KJ, Wang G, Schmued LC (2000) Temporal progression of
kainic acid induced neuronal and myelin degeneration in the rat
forebrain. Brain Res 864 (1):69-80.
79
56. Sutula TP, Hagen J, Pitkanen A (2003) Do epileptic seizures damage
the brain? Curr Opin Neurol 16 (2):189-195.
57. Brecht S, Kirchhof R, Chromik A, Willesen M, Nicolaus T, Raivich
G, Wessig J, Waetzig V, Goetz M, Claussen M, Pearse D, Kuan
CY, Vaudano E, Behrens A, Wagner E, Flavell RA, Davis RJ,
Herdegen T (2005) Specific pathophysiological functions of
JNK isoforms in the brain. Eur J Neurosci 21 (2):363-377.
58. Zhao Y, Herdegen T (2009) Cerebral ischemia provokes a profound
exchange of activated JNK isoforms in brain mitochondria. Mol
Cell Neurosci 41 (2):186-195.
59. Russi MA, Vandresen-Filho S, Rieger DK, Costa AP, Lopes MW,
Cunha RM, Teixeira EH, Nascimento KS, Cavada BS, Tasca
CI, Leal RB (2012) ConBr, a lectin from Canavalia brasiliensis
seeds, protects against quinolinic acid-induced seizures in mice.
Neurochem Res 37 (2):288-297.
60. Waetzig V, Zhao Y, Herdegen T (2006) The bright side of JNKs-
Multitalented mediators in neuronal sprouting, brain
development and nerve fiber regeneration. Prog Neurobiol 80
(2):84-97.
61. Curia G, Longo D, Biagini G, Jones RS, Avoli M (2008) The
pilocarpine model of temporal lobe epilepsy. J Neurosci
Methods 172 (2):143-157.
62. Kim AH, Yano H, Cho H, Meyer D, Monks B, Margolis B,
Birnbaum MJ, Chao MV (2002) Akt1 regulates a JNK scaffold
during excitotoxic apoptosis. Neuron 35 (4):697-709.
63. Henshall DC, Araki T, Schindler CK, Lan JQ, Tiekoter KL, Taki W,
Simon RP (2002) Activation of Bcl-2-associated death protein
and counter-response of Akt within cell populations during
seizure-induced neuronal death. J Neurosci 22 (19):8458-8465.
64. Lee SH, Chun W, Kong PJ, Han JA, Cho BP, Kwon OY, Lee HJ,
Kim SS (2006) Sustained activation of Akt by melatonin
contributes to the protection against kainic acid-induced
neuronal death in hippocampus. J Pineal Res 40 (1):79-85.
65. Neary JT, Kang Y, Shi YF (2004) Signaling from nucleotide
receptors to protein kinase cascades in astrocytes. Neurochem
Res 29 (11):2037-2042
66. Kaminska B, Gozdz A, Zawadzka M, Ellert-Miklaszewska A, Lipko
M (2009) MAPK signal transduction underlying brain
inflammation and gliosis as therapeutic target. Anat Rec
(Hoboken) 292 (12):1902-1913.
80
67. Bading H, Greenberg ME (1991) Stimulation of protein tyrosine
phosphorylation by NMDA receptor activation. Science 253
(5022):912-914
81
Fig. 1. Wistar rats of both sexes of (90 days post-natal) were collected from the
Federal University of Santa Catarina (UFSC) breeding colony. Animals
received a single intraperitoneal dose of pilocarpine (280 mg/kg). Hippocampus
and cortex from control and experimental groups were dissected in order to
evaluate phosphorylation of signaling pathways (activation of MAPKs (ERK
1/2, p38MAPK
, JNK 1/2/3) and AKT by Western blotting (n=8 per group). The
animals were divided in various groups, comprising: a) acute groups which
were euthanized 1h after status epilepticus (SE) onset; b) 3h after SE onset and
c) 12h after SE onset; d) latent group that were euthanized 5 days after SE
onset; e) chronic group which the animals were euthanized 50 days after SE
induction. Control groups were composed by animals sacrificed 1h, 3h, 12h, 5
and 50 days (n = 12 per group), after saline injection. Abbreviations: (Pilo)
pilocarpine, (I.P) intraperitoneal, (PN) post-natal.
82
Fig. 2. Western Blot analysis of phosphorylated ERK1/2 in the hippocampus
(A-C) and cortex (D-F) of rats submitted to the pilocarpine model of epilepsy.
The panel (A) shows a representative blot of hippocampal immunoreactivity of
the phospho-ERK1/2, total-ERK1/2 and anti-β actin (used as load control).
Hippocampal quantification of phospho-ERK1 (B) and phospho-ERK2 (C) are
shown. The panel (D) shows a representative blot of cortical immunoreactivity
of the phospho-ERK1/2, total-ERK1/2 and anti-β actin. Cortical quantification
of phospho-ERK1 (E) and phospho-ERK2 (F) are shown. The phosphorylation
level of each protein was determined by computer-assisted densitometry as a
ratio of the O.D. of the phosphorylated band over the O.D. of the total band and
the data are expressed as percentage of the control. The values are presented as
mean ± S.E.M derived from 8 independent experiments. Abbreviations: (Ct)
control group; (Ac) acute 1h, 3h, 12h SE group; (Lt) latent group; (Chr) chronic
group. *p<0.05, **p<0.01.
83
Fig. 3. Western Blot analysis of phosphorylated p38MAPK
in the hippocampus
(A-B) and cortex (C-D) of rats submitted to the pilocarpine model of epilepsy.
The panel (A) shows a representative blot of hippocampal immunoreactivity of
the phospho-p38MAPK
, total-p38MAPK
and anti-β actin (used as load control). The
panel (B) shows the hippocampal quantification of phospho-p38MAPK
. The panel
(C) shows a representative blot of cortical immunoreactivity of the phospho-
p38MAPK
, total-p38MAPK
and anti-β actin. The panel (D) shows the cortical
quantification of phospho-p38MAPK
.The phosphorylation level of each protein
was determined by computer-assisted densitometry as a ratio of the O.D. of the
phosphorylated band over the O.D. of the total band and the data are expressed
as percentage of the control. The values are presented as mean ± S.E.M derived
from 8 independent experiments. Abbreviations: (Ct) control group; (Ac) acute
1h, 3h, 12h SE group; (Lt) latent group; (Chr) chronic group. *p<0.05,
**p<0.01.
84
Fig. 4. Western Blot analysis of phosphorylated JNK1/2/3 in the hippocampus
(A-C) and cortex (D-F) of rats submitted to the pilocarpine model of epilepsy.
The panel (A) shows a representative blot of hippocampal immunoreactivity of
the phospho-JNK1/2/3, total-JNK1/2/3 and anti-β actin (used as load control).
Hippocampal quantification of phospho-JNK1 (B) and phospho-JNK2/3 (C) are
shown. The panel (D) shows a representative blot of cortical immunoreactivity
of the phospho-JNK1/2/3, total-JNK1/2/3 and anti-β actin. Cortical
quantification of phospho-JNK1 (E) and phospho-JNK2/3 (F) are shown. The
phosphorylation level of each protein was determined by computer-assisted
densitometry as a ratio of the O.D. of the phosphorylated band over the O.D. of
the total band and the data are expressed as percentage of the control. The
values are presented as mean ± S.E.M derived from 8 independent experiments.
Abbreviations: (Ct) control group; (Ac) acute 1h, 3h, 12h SE group; (Lt) latent
group; (Chr) chronic group. *p<0.05, **p<0.01.
85
Fig. 5. Western Blot analysis of phosphorylated AKT in the hippocampus (A-B)
and cortex (C-D) of rats submitted to the pilocarpine model of epilepsy. The
panel (A) shows a representative blot of hippocampal immunoreactivity of the
phospho-AKT, total-AKT and anti-β actin (used as load control). The panel (B)
shows the hippocampal quantification of phospho-AKT. The panel (C) shows a
representative blot of cortical immunoreactivity of the phospho-AKT, total-
AKT and anti-β actin. The panel (D) shows the cortical quantification of
phospho-AKT. The phosphorylation level of each protein was determined by
computer-assisted densitometry as a ratio of the O.D. of the phosphorylated
band over the O.D. of the total band and the data are expressed as percentage of
the control. The values are presented as mean ± S.E.M derived from 8
independent experiments. Abbreviations: (Ct) control group; (Ac) acute 1h, 3h,
12h SE group; (Lt) latent group; (Chr) chronic group. *p<0.05.
86
Fig. 6. The activation of MAPKs, AKT in the hippocampus (A) and cortex (B)
of rats submitted to the pilocarpine model of epilepsy. Curves were drawn to fit
the data points plotted in figure 2 (p-ERK), figure 3 (p-p38MAPK
), figure 4 (p-
JNK), figure 5 (p-AKT). Raw data for each graph (INTOD P/T) were
normalized to the respective maximal value, expressed as activation level (y-
axis) and reported in a time scale (x-axis). The panels (A) hippocampus and (B)
cortex show: grey lines, ERK1 phosphorylation; red lines, p38MAPK
phosphorylation; orange lines, JNK2/3 phosphorylation; green lines, AKT
phosphorylation. Filled square are used to evidentiate the points statistically
different from control (p<0.05). Abbreviations: (Ct) control group; (Ac) acute
1h, 3h, 12h SE group; (Lt) latent group; (Chr) chronic group.
87
5.3 TABELAS ADICIONAIS
As tabelas a seguir fazem uma representação de todos os resultados
estatisticamente significativos para modulação da fosforilação da
subunidade GluR1 de AMPA, MAPKs e AKT, além dos dados
referentes a expressão relativa do mRNA de EAAT1, EAAT2 e NR1 no
hipocampo e córtex de ratos submetidos ao modelo de epilepsia
induzido por pilocarpina.
88
89
6 DISCUSSÃO
Nossos resultados mostram pela primeira vez o perfil de
fosforilação da subunidade GluR1 do receptor AMPA, MAPKs, AKT e
a expressão dos níveis dos transportadores gliais de glutamato e
subunidade NR1 do receptor NMDA em diversas fases do modelo da
pilocarpina e focando duas regiões córtex e hipocampo.
Os resultados mostraram que a fosforilação do sítio GluR1-Ser845
aumentou no córtex 1h após o início do status epilepticus (SE). Estes
dados estão de acordo com o estudo anterior de Bracey e colaboradores
(2009) que demonstraram um aumento SE-dependente da atividade de
PKA e fosforilação de GluR1-Ser845
no córtex 20, 40 e 70 min após
produção das crises convulsivas (Bracey et al., 2009). Além disso,
diversos modelos animais sugerem um possível papel da PKA no
desenvolvimento e manutenção de atividade convulsiva. Neste sentido,
já foi demonstrado que a aplicação de análogos de AMPc aumentam a
excitabilidade neuronal (Boulton et al., 1993) e pode induzir kindling
(Yokoyama et al., 1989). Portanto, o aumento da fosforilação em Ser845
na subunidade GluR1 do receptor AMPA no córtex, observada em nosso
estudo, pode ser devido a ativação da PKA. A fosforilação de GluR1-
Ser831
no córtex não foi alterada no mesmo período. No entanto, é bem
demonstrado que Ser831
é fosforilada por PKC e/ou CaMKII, evento
intimamente envolvido na LTP (Sanderson & Dell'Acqua, 2011).
Quanto aos períodos subsequentes analisados observou-se uma
diminuição na fosforilação de Ser831
em 3h e Ser845
50 dias após a
primeira convulsão (período crônico). As principais informações desses
resultados sugerem que a fosforilação dos sítios (Ser831
e Ser845
) da
subunidade GluR1 medidas no córtex total, não são sustentadas no curso
da geração de crises espontâneas no modelo de pilocarpina. Além disso,
é aparente no córtex um perfil que inclui um aumento inicial da
fosforilação de Ser845
, provavelmente devido à ativação de PKA,
seguido por um rápido retorno ao nível basal ou uma diminuição de
fosforilação. Outro ponto relevante observado foi a diminuição
significativa no conteúdo total da proteína GluR1 no período latente
(cinco dias após a administração de pilocarpina). Desta forma a menor
disponibilidade da subunidade GluR1 poderia estar contribuindo com o
fenômeno de aparente normalização comportamental encontrado neste
período do modelo da pilocarpina.
No hipocampo houve um aumento na fosforilação de GluR1-Ser831
1 e 12 h após a primeira convulsão. Estes resultados sugerem ativação
de PKC e CaMKII no hipocampo em resposta a pilocarpina, uma vez
90
que este sítio é um substrato bem conhecido para ambas as cinases
(Sanderson & Dell'Acqua, 2011). Diferentemente, o nível de
fosforilação da Ser845
não foi alterado após 1h. Este resultado está de
acordo com o estudo de Bracey e colaboradores (2009) que não
observaram variações de ambas (ativação de PKA e aumento na
fosforilação de Ser845
) no hipocampo 10-70 min após a primeira crise
convulsiva induzida por pilocarpina (Bracey et al., 2009). Além disso,
nossos dados indicam que a fosforilação de Ser845
pode diminuir no
período de 3h (período agudo) e 50 dias (período crônico) após SE
pilocarpina-induzido. Portanto, o perfil de fosforilação da subunidade
GluR1 do receptor AMPA em resposta ao tratamento com pilocarpina é
diferente no hipocampo e córtex. No tempo de 1h é possível postular
uma ativação de PKA no córtex e PKC/CaMKII no hipocampo. Este
aspecto é provavelmente específico para o modelo de pilocarpina pois
Rakhade e colaboradores (2008) já demonstraram um aumento
significativo da atividade PKA, PKC e CaMKII, bem como aumento na
fosforilação de GluR1-Ser831
e Ser845
em fatias de hipocampo 1h após
crises convulsivas serem induzidas por hipóxia (Rakhade et al., 2008).
Portanto, esta evidência reforça o conceito de que o aumento na
fosforilação do sítio Ser845
no córtex e do sítio Ser831
no hipocampo
ocorre devido a uma ativação de diferentes proteínas cinases frente ao
SE induzido no modelo de epilepsia utilizado em nosso trabalho.
As implicações funcionais de todas essas observações são
complexas. Sabe-se que os receptores pós-sinápticos de glutamato do
tipo AMPA (AMPARs) medeiam a transmissão sináptica excitatória
rápida e são cruciais para muitos aspectos fisiológicos da função
cerebral, envolvendo a neuroplasticidade incluindo aprendizagem,
memória e cognição. O número, localização sináptica e composição do
receptor AMPA são regulados pela atividade sináptica (Henle et al.,
2011). A atividade do canal dos receptores AMPA pode ser aumentada
durante a LTP através da fosforilação de Ser845
por PKA que induz a
inserção na membrana e aumento da probabilidade de abertura do canal.
Além disso, a fosforilação de Ser831
por CaMKII/PKC induz uma
localização sináptica e pode aumentar a condutância do canal (Esteban
et al., 2003, Lee et al., 2003, Boehm et al., 2006). É interessante notar
que o fenômeno de LTD é induzido via receptores NMDA, entretanto
dependente de uma pequena elevação nos níveis Ca2+
que promovem a
ativação de proteínas fosfatases e subsequente desfosforilação dos sítios
GluR1-Ser831
e Ser845
reduzindo o número e atividade dos receptores
AMPA na sinapse (Lee et al., 1998, Banke et al., 2000). No período
crônico do modelo encontramos desfosforilação de GluR1-Ser845
no
91
córtex e hipocampo, curiosamente a redução da fosforilação ocorre em
períodos nos quais os animais apresentam crises. Considerando que
diferentes populações de neurônios estão presentes no hipocampo e
córtex, uma possibilidade a ser considerada é que a desfosforilação do
sítio Ser845
possa estar ocorrendo principalmente em neurônios
GABAérgicos, fazendo com que os mesmos estejam “down” regulados,
contribuindo assim para uma maior susceptibilidade à crises epilépticas.
O ácido y-aminobutírico (GABA) é um neurotransmissor muito
abundante no SNC. Este neurotransmissor é fundamental em diversos
processos cerebrais, estando envolvidos em processos como cognição,
atividade motora e ciclo cicardiano. O desbalanço neste sistema
neurotransmissor tem sido relacionado com diversas patologias e o
processo epileptogênico (Olsen & Betz, 2006). Entretanto, esse aspecto
não é abordado no presente estudo.
Em relação à diminuição da fosforilação da subunidade GluR1 do
receptor AMPA e outras proteínas, tais como a JNK 2/3 em 3h, poderia
ser cogitado uma associação com a administração de diazepam (5mg/kg)
2h após o início do SE, o qual é administrado para conter em parte a
excitação máxima dos períodos de 1 a 2h que provocam altas taxas de
mortalidade no modelo animal (Curia et al., 2008). No entanto, esta
possibilidade é descartada tendo em vista que os mesmos tratamentos
foram aplicados aos respectivos grupos controles utilizados para a
comparação entre os diferentes períodos investigados no modelo.
As MAPKs fazem parte de uma família de serina-treonina cinases
que medeiam a sinalização intracelular e estão associadas com uma
variedade de atividades celulares incluindo proliferação, diferenciação,
sobrevivência celular, morte celular e plasticidade sináptica (McCubrey
et al., 2006, Dhillon et al., 2007, Kim & Choi, 2010). Nossos resultados
mostram que a fosforilação de ERK1 no hipocampo e no córtex
aumentou em relação ao controle no período agudo, 1 e 12h após a
primeira crise convulsiva discreta. Estes achados são consistentes com o
trabalho de Garrido e colaboradores (1998) que mostram mudanças
dinâmicas na ativação de ERK seguida da atividade convulsiva (Garrido
et al., 1998). Além disso, ERK é fortemente ativada em neurônios que
tiveram crises convulsivas induzidas quimicamente (Berkeley et al.,
2002). A avaliação da via de sinalização ERK1/2 foi de particular
interesse devido ao seu papel em várias formas de neuroplasticidade
(Sweatt 2004, Thomas & Huganir, 2004). A ativação da cascata que
culmina com a fosforilação e ativação de ERKs são essenciais para a
ocorrência de LTP e está envolvida em várias formas de aprendizado,
memória e regulação da excitabilidade neuronal hipocampo-dependente
92
(Dudek & Campos, 2001, Selcher et al., 2003). Estudos anteriores
demonstraram significativo aumento da fosforilação de ERK
imediatamente após o estado de mal epiléptico induzido pela pilocarpina
ou cainato (Kim et al., 1994, Garrido et al., 1998, Berkeley et al., 2002)
bem como nas crises convulsivas provocadas por choque
eletroconvulsivo (Baraban et al., 1993, Bhat et al., 1998) e estimulação
da via perforante (Brisman et al., 2002).
Jiang e colaboradores (2005) observaram que as crises agudas
podem levar a uma rápida ativação de ERK e p38MAPK
na área CA3 do
hipocampo, região do cérebro mais suscetível aos efeitos letais do status
epilepticus. O pré-tratamento com os inibidores seletivos de ERK
(PD98059) e p38MAPK
(SB203580) reduzem a ativação dessas enzimas e
dessa forma as previnem crises convulsivas (Jiang et al., 2005). Nossos
resultados mostram, pela primeira vez na literatura que a fosforilação de
p38MAPK
aumentou no hipocampo e córtex em relação ao grupo controle
no período agudo do modelo da pilocarpina, sugerindo que p38MAPK
poderia estar modulando algumas das alterações de excitabilidade e/ou
morte neuronal obsevadas no modelo da pilocarpina. De acordo com
esta possibilidade, já foi demonstrado que a inibição de ERK e p38MAPK
resulta em uma redução significativa da degeneração neuronal induzida
por convulsões no hipocampo de ratos (Murray et al., 1998, Kim et al.,
2004) sugerindo que a fosforilação excessiva de ERK e p38MAPK
podem
levar a danos celulares. Evidências acumuladas também demonstram
que o estado epiléptico sustentado em humanos e animais produzem
degeneração neuronal no hipocampo e várias outras regiões (Lothman &
Bertram, 1993, Hopkins et al., 2000), que se intensifica nas crises
convulsivas crônicas e os resultados adversos a longo prazo podem
provocar prejuízos comportamentais e cognitivas (Sutula et al., 2003).
Além disso, nossos resultados mostram pela primeira vez na
literatura que a fosforilação das isoformas de JNK de 54kDa (JNK2/3)
diminuíram 3h após inserção do SE e na fase crônica do modelo (50
dias). A diminuição de fosforilação da JNK2/3 ocorreu no mesmo
período em que houve queda de fosforilação dos sítios Ser831
e Ser845
da
subunidade GluR1 do AMPA. Recentemente, foi mostrado uma possível
modulação da fosforilação da subunidade GluR1 por JNKs (Ahn &
Choe, 2009). No entanto, em nosso modelo o estímulo de Ser831
e Ser845
(1h) não foi acompanhado pela ativação JNK2/3. As diferentes
isoformas de JNKs fazem parte de uma subfamília de MAP cinases
mediadoras de processos como apoptose e neurodegeneração, mas
também estão ativamente envolvidas na neuroplasticidade e
regeneração. JNKs em mamíferos são codificadas por três genes
93
distintos (JNK1, JNK2 e JNK3), dando origem a cerca de 10 variantes
diferentes (isoformas). Todas as isoformas compartilham um epítopo
que precisa ser duplamente fosforilado para que ocorra a ativação de
JNK (fosfo-JNK). No hipocampo de ratos, JNK1 é expressa
principalmente como uma banda de 46kDa, enquanto JNK2 é
principalmente expressa como uma banda de 54kDa. JNK3 é expressa
como bandas de 46 e 54kDa. As isoformas de JNK apresentam
diferentes respostas frente ao estímulo, especificidade para substratos e
regulação pelas cinases “upstream” (Brecht et al., 2005, Zhao &
Herdegen 2009). É interessante observar que JNK1 (46kDa) geralmente
é mais ativa no estado basal. Por outro lado, em alguns insultos, como
isquemia, as isoformas ativadas correspondem à faixa de 54kDa,
indicando JNK2 e/ou JNK3 envolvidas neste processo (Brecht et al.,
2005, Waetzig et al., 2006, Russi et al., 2012).
A análise da fosforilação de AKT mostra que esta enzima foi
ativada apenas no hipocampo e no período latente. Aparentemente, este
processo pode estar relacionado a um mecanismo de resposta aos danos
celulares induzidos pelo processo convulsivo no período agudo, sendo
assim uma tentativa de diminuir a intensidade da lesão. Resultados
semelhantes foram encontrados por Kim e colaboradores (2002) que
mostram que a ativação de AKT impediu a morte celular induzida por
ácido caínico (Kim et al., 2002). Além disso, Henshall e colaboradores
(2002) observaram que a administração de um inibidor de PI3K
(LY294002), exacerba a apoptose cortical após convulsões induzidas
por ácido caínico (Henshall et al., 2002). Lee e colaboradores (2006)
mostraram que a administração de melatonina uma hora antes da injeção
intracerebroventricular (ICV) de ácido caínico é capaz de diminuir a
morte de neurônios piramidais na região CA3 do hipocampo, também
via ativação de AKT (Lee et al., 2006).
Em relação ao perfil de expressão da subunidade NR1 do receptor
NMDA e os transportadores gliais de glutamato (EAAT1 e EAAT2),
observou-se uma queda na expressão do mRNA da subunidade NR1 no
córtex, no período latente (ausência de crises convulsivas).
Curiosamente, encontramos também uma queda na expressão do mRNA
dos transportadores gliais de glutamato EAAT1 e EAAT2 neste período.
No entanto, se considerarmos a diminuição paralela da subunidade
GluR1 do receptor AMPA no mesmo período, é possível supor que, no
período latente esteja ocorrendo um enfraquecimento de sinapses
corticais excitatórias, devido à baixa regulação das subunidades dos
receptores glutamatérgicos.
94
No hipocampo a expressão do mRNA de EAAT2 diminuiu no
período crônico, quando comparado com o grupo controle (período em
que o animal apresenta crises espontâneas recorrentes). Paralelamente
ocorreu nesse mesmo período, um aumento (“upregulation”) de cerca de
5 vezes do mRNA da subunidade NR1 do receptor NMDA. Estes
resultados suportam a ideia de que a diminuição da recaptação do
neurotransmissor excitatório glutamato da fenda sináptica, juntamente
com um aumento da expressão da subunidade NR1 possam estar
contribuindo para o aparecimento das crises convulsivas encontradas no
período crônico (Rakhade & Loeb, 2008).
A redução da recaptação de glutamato pelos EAATs poderia
explicar hiperexcitabilidade em focos epilépticos. De fato, estudos em
modelos animais sugerem um efeito causal da downregulation de
EAATs na epileptogênese (Rothstein et al., 1996, Tanaka et al., 1997,
Sepkuty et al., 2002). Consistentemente, bloqueando a captação de
glutamato teremos elevados níveis de glutamato extracelular e aumento
da excitabilidade da rede local, resultando em um limiar que pode
evocar em atividade epileptiforme espontânea (Campbell & Hablitz
2004). Di Maio e colaboradores (2011) também mostraram que os
neurônios hipocampais de animais tratados com pilocarpina apresentam
uma upregulation das subunidades NR1 e NR2B do receptor NMDA (Di
Maio et al., 2011). Dessa forma, é importante destacar que os resultados
obtidos no nosso estudo utilizando animais tratados com pilocarpina
pode proporcionar uma melhor compreensão do curso de respostas
moleculares e celulares durante a epileptogênese e identificar potenciais
alvos terapêuticos para prevenir o desenvolvimento da epilepsia crônica.
No presente estudo, aplicamos uma abordagem na qual pudessem
ser detectados alterações bioquímicas sutis, como o nível de
fosforilação, conteúdo total de proteínas e expressão de mRNA. No
entanto, as análises realizadas no hipocampo e córtex total não
caracterizam as sub-regiões ou tipos celulares (neurônios ou astrócitos)
em que as variações neuroquímicas ocorreram. Embora a subunidade
NR1 de NMDA e GluR1 de AMPA sejam amplamente expressos em
neurônios, elas também podem ser expressas em células gliais,
especialmente após insultos (Gottlieb & Matute, 1997, Fan et al., 1999,
Seifert et al., 2003). A via das MAPKs bem como ativação de AKT
também podem ocorrer em diferentes regiões e tipos celulares no SNC
(Neary et al., 2004, Kaminska et al., 2009). No que tange os
transportadores de glutamato EAAT1 e 2 estes são predominantemente
expressos em astrócitos, porém a morte neuronal e astrogliose podem
mudar a sua expressão. Portanto, uma abordagem como a
95
imunoistoquímica para a caracterização de sub-regiões e tipo celular
com referência a ativação de enzimas ou perfil de expressão de
proteínas, será necessária em estudos futuros.
Por fim é possível postular um quadro geral em que a ativação do
sistema glutamatérgico durante o SE poderia desencadear a ativação de
proteína cinases de distintas vias de sinalização, alterando a expressão
gênica e produzindo distúrbios neuronais de longo prazo após as crises
convulsivas (Bading & Greenberg, 1991, Gass, Kiessling, Bading 1993).
A compreensão destas modificações pode ajudar a compreender os
mecanismos que envolvem a epileptogênese.
7 CONCLUSÕES
Os dados do nosso estudo mostraram um perfil de diversidade de
vias de sinalização em resposta a pilocarpina. Os achados principais
incluem:
- Aumento da fosforilação dos sítios Ser831
e Ser845
da subunidade
GluR1 do receptor AMPA no hipocampo e córtex, respectivamente após
Pilo-SE. Este aumento pode estar relacionado à ativação de cinases,
como PKA, PKC e CaMKII no status epilepticus, que pode conduzir a
um aumento do receptor AMPA e da excitabilidade neuronal,
potencialmente desempenhando um papel na manutenção da atividade
convulsiva.
- Ativação de ERK e p38MAPK
no hipocampo e córtex no período agudo,
fato que pode estar relacionado à degeneração neuronal irreversível
encontrada neste período, bem como seu envolvimento nos mecanismos
de plasticidade sináptica.
- Ativação de AKT no hipocampo no período latente, que pode estar
relacionada a um mecanismo de resposta aos danos celulares induzidos
pelo processo convulsivo no período agudo, sendo assim uma tentativa
de diminuir a intensidade da lesão.
- Downregulation dos transportadores gliais de glutamato e upregulation
da subunidade NR1 do receptor NMDA que parecem estar intimamente
envolvidos com o aparecimento de crises convulsivas durante o período
crônico, pois contribuem para a manutenção dos altos níveis de
glutamato e hiperexcitabilidade. Esse achado sugere esse sistema como
possível alvo terapêutico para o tratamento da epilepsia.
96
8 PERSPECTIVAS
- Avaliar a ativação das enzimas PKA, PKC e CaMKII no hipocampo e
córtex dos animais submetidos no modelo da pilocarpina, fazendo
correlação com os resultados de modulação da fosforilação da
subunidade GluR1 do receptor AMPA.
- Determinar o conteúdo total e o nível de fosforilação dos sítios Ser897
,
Ser1303
das subunidades NR1 e NR2B do receptor NMDA no hipocampo
e córtex dos animais submetidos no modelo da pilocarpina nos
diferentes períodos.
- Determinar o conteúdo total (protéico) dos transportadores EAAT1 e
EAAT2 no hipocampo e córtex dos animais submetidos no modelo da
pilocarpina nos diferentes períodos.
- Avaliar a atividade de enzimas fosfatases como: proteína fosfatase 1
(PP1) e calcineurina (PP2B) no hipocampo e córtex dos animais
submetidos no modelo da pilocarpina nos diferentes períodos.
- Determinar o conteúdo total das subunidades do receptor GABA no
hipocampo e córtex dos animais submetidos no modelo da pilocarpina
nos diferentes períodos.
- Aplicar técnicas de imunoistoquímica para determinar as sub-regiões e
tipos celulares relativos as alterações neuroquímicas (modulação de
MAPKs, do receptores glutamatérgicos e transportadores de Glutamato).
97
9 REFERÊNCIAS
Ahn S.M., Choe E.S. Activation of group I metabotropic glutamate
receptors increases serine phosphorylation of GluR1 alpha-
amino-3-hydroxy-5-methylisoxazole-4-propionic acid
receptors in the rat dorsal striatum. J Pharmacol Exp Ther
329:1117-1126, 2009.
Attwell D. Brain uptake of glutamate: food for thought. Journal of
Nutrition 130, 1023–25, 2000.
Bading H., Greenberg M.E. Stimulation of protein tyrosine
phosphorylation by NMDA receptor activation. Science
253:912-914, 1991.
Banke T.G., Bowie D., Lee H., Huganir R.L., Schousboe A., Traynelis
S.F. Control of GluR1 AMPA receptor function by cAMP-
dependent protein kinase. J Neurosci 20:89-102, 2000.
Baraban J.M., Fiore R.S., Sanghera J.S., Paddon H.B., Pelech S.L.
Identification of p42 mitogen-activated protein kinase as a
tyrosine kinase substrate activated by maximal
electroconvulsive shock in hippocampus. J Neurochem
60:330-336, 1993.
Barco A., Bailey C.H., Kandel E.R. Common molecular mechanisms in
explicit and implicit memory. J Neurochem. 97(6):1520-33,
2006.
Bear M.F. A synaptic basis for memory storage in the cerebral cortex.
Proc Natl Acad Sci USA 26; 93(24):13453-9, 1996.
Bear M.F. Homosynaptic long-term depression: a mechanism for
memory? Proc Natl Acad Sci USA 96(17):9457-8, 1999.
Beleza P. Refractory epilepsy: a clinically oriented review. Eur Neurol.
62:65-71, 2009.
Berkeley J.L., Decker M.J., Levey A.I. The role of muscarinic
acetylcholine receptor-mediated activation of extracellular
signal-regulated kinase 1/2 in pilocarpine-induced seizures. J
Neurochem 82:192-201, 2002.
Bhat R.V., Engber T.M., Finn J.P., Koury E.J., Contreras P.C., Miller
M.S., Dionne C.A., Walton K.M. Region-specific targets of
p42/p44MAPK signaling in rat brain. J Neurochem 70:558-
571, 1998.
Bjerrum O.J., Heegaard N.H.H. CRC handbook of immunoblotting of
proteins. CRC Press 1, 1988.
98
Boehm J., Kang M.G., Johnson R.C., Esteban J., Huganir R.L, Malinow
R. Synaptic incorporation of AMPA receptors during LTP is
controlled by a PKC phosphorylation site on GluR1. Neuron
51:213-225, 2006.
Boulton C.L., McCrohan C.R., O'Shaughnessy C.T. Cyclic AMP
analogues increase excitability and enhance epileptiform
activity in rat neocortex in vitro. Eur J Pharmacol 236:131-
136, 1993.
Bracey J.M., Kurz J.E., Low B., Churn S.B. Prolonged seizure activity
leads to increased Protein Kinase A activation in the rat
pilocarpine model of status epilepticus. Brain Res. 1283:167-
76, 2009.
Brazil D.P., Yang, Z., Hemmings, B.A. Advances in protein kinase B
signalling: AKT ion on multiple fronts. Trends in Biochem
Sci 29:233-242, 2004.
Brecht S., Kirchhof R., Chromik A., Willesen M., Nicolaus T., Raivich
G., Wessig J., Waetzig V., Goetz M., Claussen M., Pearse D.,
Kuan C.Y., Vaudano E., Behrens A., Wagner E., Flavell R.A.,
Davis R.J., Herdegen T. Specific pathophysiological functions
of JNK isoforms in the brain. Eur J Neurosci 21:363-377,
2005.
Brisman J.L., Rees Cosgrove G., Cole A.J. Phosphorylation of P42/P44
MAP kinase and DNA fragmentation in the rat perforant
pathway stimulation model of limbic epilepsy. Brain Res
933:50-59, 2002.
Calloni G.W,, Penno C.A., Cordova F.M., Trentin A.G., Neto V.M.,
Leal R.B. Congenital hypothyroidism alters the
phosphorylation of ERK1/2 and p38MAPK in the
hippocampus of neonatal rats. Brain Res Dev Brain Res
154:141-145, 2005.
Campbell S.L., Hablitz J.J. Glutamate transporters regulate excitability
in local networks in rat neocortex. Neuroscience 127:625-635,
2004.
Cargnello M., Roux P.P. Activation and function of the MAPKs and
their substrates, the MAPK-activated protein kinases.
Microbiol Mol Biol Rev 75:50-83, 2011.
Carvalho A.L., Duarte C.B., Carvalho A.P. Regulation of AMPA
receptors by phosphorylation. Neurochem Res 25:1245–1255,
2000.
Cavalheiro E.A., Leite J.P., Bortolotto Z.A., Turski W.A., Ikonomidou
C., Turski L. Long-term effects of pilocarpine in rats: structural
99
damage of the brain triggers kindling and spontaneous
recurrent seizures. Epilepsia 32(6):778-82, 1991.
Chen J.W., Wasterlain, C.G. Status epilepticus: pathophysiology and
management in adults. Lancet Neurol. 5, 246–256, 2006.
Chomczynski P., Sacchi N. Single-step method of RNA isolation by
acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem 162:156-159, 1987.
Cooke S.F., Bliss T.V. Plasticity in the human central nervous system.
Brain 129(Pt 7):1659-73, 2006.
Cordova F.M., Rodrigues A.L., Giacomelli M.B., Oliveira C.S., Posser
T., Dunkley P.R., Leal R.B. Lead stimulates ERK1/2 and
p38MAPK phosphorylation in the hippocampus of immature
rats. Brain Res 998:65-72, 2004.
Costa M.S., Rocha J.B., Perosa S.R., Cavalheiro E.A., Naffah-
Mazzacoratti Mda. G. Pilocarpine-induced status epilepticus
increases glutamate release in rat hippocampal synaptosomes.
Neurosci Lett 356:41-44, 2004.
Crossthwaite A.J., Hasan, S., Williams, R.J. Hydrogen peroxide-
mediated phosphorylation of ERK1/2, Akt/PKB and JNK in
cortical neurones: dependence on Ca2+ and PI3-kinase.
Journal of Neurochemistry 80:24-35, 2002.
Cull-Candy S., Brickley, S., Farrant, M. NMDA receptor subunits:
diversity, development and disease. Curr Opin Neurobiol
11:327-335, 2001.
Curia G., Longo D., Biagini G., Jones R.S., Avoli M. The pilocarpine
model of temporal lobe epilepsy. J Neurosci Methods
172:143-157, 2008.
Dhillon A.S., Hagan S., Rath O., Kolch W. MAP kinase signaling
pathways in cancer. Oncogene 26:3279-3290, 2007.
Di Maio R., Mastroberardino P.G., Hu X., Montero L., Greenamyre J.T.
Pilocapine alters NMDA receptor expression and function in
hippocampal neurons: NADPH oxidase and ERK1/2
mechanisms. Neurobiol Dis 42:482-495.
Din N., Ahmad I., Ul haq I., Elahi S., Hoessli D.C., Shakoori A.R. The
function of GluR1 and GluR2 in cerebellar and hippocampal
LTP and LTD is regulated by interplay of phosphorylation and
O-GlcNAc modification. J Cell Biochem. 109(3):585-97,
2010.
Dong Z., Bode A.M. Dialogue between ERKs and JNKs: friendly or
antagonistic? Mol Interv. 3:306-8, 2003.
100
Dudek S.M., Fields R.D. Mitogen-activated protein kinase/extracellular
signal-regulated kinase activation in somatodendritic
compartments: roles of action potentials, frequency, and mode
of calcium entry. J Neurosci 21:RC122, 2001.
Engel J, Jr. Surgery for seizures. N Engl J Med; 334(10):647-52, 1996.
Engel J., Pedley T.A. Introduction: What is epilepsy? In: Engel J, Pedley
TA, editors. Epilepsy: A Compreensive Textbook. First ed.
Philadelphia: Lippincott-Raven. 1-7, 1997.
Esteban J.A., Shi S.H., Wilson C., Nuriya M., Huganir R.L., Malinow
R. PKA phosphorylation of AMPA receptor subunits controls
synaptic trafficking underlying plasticity. Nat Neurosci 6:136-
143, 2003.
Fan D., Grooms S.Y., Araneda R.C., Johnson A.B., Dobrenis K.,
Kessler J.A., Zukin R.S. AMPA receptor protein expression
and function in astrocytes cultured from hippocampus. J
Neurosci Res 57:557-571, 1999.
Fernandes J.G., Schmidit M.I., Monte T.L., Tozzi S., Sander JWAS.
Prevalence of epilepsy: the Porto Alegre Study. Epilepsia 33,
132. 1992.
Flavell S.W., Greenberg M.E. Signaling mechanisms linking neuronal
activity to gene expression and plasticity of the nervous system.
Annu Rev Neurosci. 31:563-90, 2008.
Furuta A., Rothstein, J.D., Martin, L.J. Gluatamate transporter protein
subtypes are expressed differntially during rat CNS
development. J Neurosci. 17 (21), 8363-75, 1997.
Garrido Y.C., Sanabria E.R., Funke M.G., Cavalheiro E.A., Naffah-
Mazzacoratti M.G. Mitogen-activated protein kinase is
increased in the limbic structures of the rat brain during the
early stages of status epilepticus. Brain Res Bull 47:223-229,
1998.
Gary D.S., Milhavet O., Camandola S., Mattson M.P. Essential role for
integrin linked kinase in AKT-mediated integrin survival
signaling in hippocampal neurons. J Neurochem 84:878-890,
2003.
Gass P., Kiessling M., Bading H. Regionally selective stimulation of
mitogen activated protein (MAP) kinase tyrosine
phosphorylation after generalized seizures in the rat brain.
Neurosci Lett 162:39-42, 1993.
Giblin K.A., Blumenfeld H. Is epilepsy a preventable disorder? New
evidence from animal models. Neuroscientist. 16(3):253-75,
2010.
101
Goto E.M., Silva Mde P., Perosa S.R., Arganaraz G.A., Pesquero J.B.,
Cavalheiro E.A, Naffah-Mazzacoratti M.G., Teixeira V.P.,
Silva J.A, Jr. AKT pathway activation and increased
neuropeptide Y mRNA expression in the rat hippocampus:
implications for seizure blockade. Neuropeptides 44:169-176,
2010.
Gottlieb M., Matute C. (1997) Expression of ionotropic glutamate
receptor subunits in glial cells of the hippocampal CA1 area
following transient forebrain ischemia. J Cereb Blood Flow
Metab 17 290:300, 1997.
Hamilton S.E., Loose M.D., QiM, Levey A.I, Hille B., McKnight G.S.
Disruption of the M1 receptor gene ablates muscarinic
receptor-dependent M current regulation and seizure activity in
mice. Proc Natl Acad Sci USA 94:13311–6, 1997.
Hanada M., Feng, J., Hemmings, B.A. Structure, regulation and function
of PKB/AKT - a major therapeutic target. Biochim Biophys
Acta, 1697:3-16, 2004.
Henley J.M., Barker E.A., Glebov O.O. Routes, destinations and delays:
recent advances in AMPA receptor trafficking. Trends
Neurosci 34:258-268, 2011.
Henshall D.C., Araki T., Schindler C.K., Lan J.Q., Tiekoter K.L., Taki
W., Simon R.P. Activation of Bcl-2-associated death protein
and counter-response of Akt within cell populations during
seizure-induced neuronal death. J Neurosci 22:8458-8465,
2002.
Hopkins K.J., Wang G., Schmued L.C. Temporal progression of kainic
acid induced neuronal and myelin degeneration in the rat
forebrain. Brain Res 864:69-80, 2000.
Izquierdo I, Medina J.H. Memory formation: the sequence of
biochemical events in the hippocampus and its connection to
activity in other brain structures. Neurobiol Learn Mem
68:285-316, 1997.
Jiang W., Van Cleemput J., Sheerin A.H., Ji S.P., Zhang Y., Saucier
D.M., Corcoran M.E., Zhang X. Involvement of extracellular
regulated kinase and p38 kinase in hippocampal seizure
tolerance. J Neurosci Res 81:581-588, 2005.
Johnson G.L., Lapadat R. Mitogen-activated protein kinase pathways
mediated by ERK, JNK, and p38 protein kinases. Science 298:
1911-2, 2002.
Kaminska B., Gozdz A,, Zawadzka M,, Ellert-Miklaszewska A,, Lipko
M. MAPK signal transduction underlying brain inflammation
102
and gliosis as therapeutic target. Anat Rec (Hoboken)
292:1902-1913, 2009.
Kim A.H., Yano H., Cho H., Meyer D., Monks B., Margolis B.,
Birnbaum M.J., Chao M.V. Akt1 regulates a JNK scaffold
during excitotoxic apoptosis. Neuron 35:697-709, 2002.
Kim E.K., Choi E.J. Pathological roles of MAPK signaling pathways in
human diseases. Biochim Biophys Acta 1802:396-405, 2010.
Kim S.W., Yu Y.M., Piao C.S., Kim J.B., Lee J.K. Inhibition of delayed
induction of p38 mitogen-activated protein kinase attenuates
kainic acid-induced neuronal loss in the hippocampus. Brain
Res 1007:188-191, 2004.
Kim Y.S., Hong K.S., Seong Y.S., Park J.B., Kuroda S., Kishi K.,
Kaibuchi K., Takai Y. Phosphorylation and activation of
mitogen-activated protein kinase by kainic acid-induced
seizure in rat hippocampus. Biochem Biophys Res Commun
202:1163-1168, 1994.
Leal R.B., Cordova F.M., Herd L., Bobrovskaya L., Dunkley P.R. Lead-
stimulated p38MAPK-dependent Hsp27 phosphorylation.
Toxicol Appl Pharmacol 178:44-51, 2002.
Lee A., Pow D.V. Astrocytes: Glutamate transport and alternate splicing
of transporters. Int J Biochem Cell Biol 42:1901-1906, 2010.
Lee H.K., Kameyama K., Huganir R.L., Bear M.F. NMDA induces
long-term synaptic depression and dephosphorylation of the
GluR1 subunit of AMPA receptors in hippocampus. Neuron
21:1151-1162, 1998.
Lee H.K., Takamiya K., Han J.S., Man H., Kim C.H., Rumbaugh G., Yu
S., Ding L., He C., Petralia R.S., Wenthold R.J., Gallagher M.,
Huganir R.L. Phosphorylation of the AMPA receptor GluR1
subunit is required for synaptic plasticity and retention of
spatial memory. Cell 112:631-643, 2003.
Lee S.H., Chun W., Kong P.J., Han J.A., Cho B.P., Kwon O.Y., Lee
H.J., Kim S.S. Sustained activation of Akt by melatonin
contributes to the protection against kainic acid-induced
neuronal death in hippocampus. J Pineal Res 40:79-85, 2006.
Leite J.P., Neder L., Arisi G.M., Carlotti C.G., Jr., Assirati J.A., Moreira
J.E. Plasticity, synaptic strength, and epilepsy: what can we
learn from ultrastructural data? Epilepsia; 46 Suppl 5:134-41,
2005.
Livak K.J., Schmittgen T.D. Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods 25:402-408, 2001.
103
Lothman E.W., Bertram E.H., 3rd. Epileptogenic effects of status
epilepticus. Epilepsia 34 Suppl 1:S59-70, 1993.
Mathern G.W., Babb T.L. Hippocampal sclerosis. In: Engel J, Pedley
TA, editors. Epilepsy: A Compreensive Texbook.Philadelphia:
Lippincott-Raven; 133-55, 1997.
Mathern G.W., Babb T.L., Vickrey B.G., Melendez M., Pretorius J.K.
The clinical-pathogenic mechanisms of hippocampal neuron
loss and surgical outcomes in temporal lobe epilepsy. Brain
118 (Pt 1):105-18, 1995.
McBain C.J., Mayer M.L. N-methyl-D-aspartic acid receptor structure
and function. Physiol Rev 74:723–760, 1994.
McCubrey J.A., Lahair M.M., Franklin R.A. Reactive oxygen species-
induced activation of the MAP kinase signaling pathways.
Antioxid Redox Signal 8:1775-1789, 2006.
McKINNEY R.A. Excitatory amino acid involvement in dendritic spine
formation, maintenance and remodeling. J Physiol. 588(Pt
1):107-16, 2010.
Meador K. How to image memory in epilepsy. Epilepsy Curr 6(6):189-
91, 2006.
Meldrum B.S. Glutamate as a Neurotransmitter in the Brain: Review of
Physiology and Pathology. J. Nutr. 130: 1007S-15S, 2000.
Mello L.E., Cavalheiro E.A., Tan A.M., Kupfer W.R., Pretorius J.K.,
Babb T.L. Circuit mechanisms of seizures in the pilocarpine
model of chronic epilepsy: cell loss and mossy fiber sprouting.
Epilepsia 34(6):985-95, 1993.
Michaelis E.K. Molecular Biology of Glutamate Receptors in the
Central Nervous System and their Role in Excitotoxicity,
Oxidative Stress and Aging. Progress in Neurobiology 54:
369-415, 1998.
Murray B., Alessandrini A., Cole A.J., Yee A.G., Furshpan E.J.
Inhibition of the p44/42 MAP kinase pathway protects
hippocampal neurons in a cell-culture model of seizure
activity. Proc Natl Acad Sci U S A 95:11975-11980, 1998.
Neary J.T., Kang Y., Shi Y.F. Signaling from nucleotide receptors to
protein kinase cascades in astrocytes. Neurochem Res
29:2037-2042, 2004.
Nebreda A.R., Porras A. p38 MAP kinases: beyond the stress response.
Trends Biochem Sci. v. 25. p.257-60, 2000.
Obrenovitch T.P. & Urenjak J. Altered Glutamatergic Transmission in
Neurological Disorders: From High Extracellular Glutamate to
104
Excessiva Synaptic Efficacy. Progr. Neurobiol. 51: 39-87,
1997.
Oh M.C., Derkach V.A., Guire E.S., Soderling T.R. Extrasynaptic
membrane trafficking regulated by GluR1 serine 845
phosphorylation primes AMPA receptors for long-term
potentiation. J Biol Chem 281:752–758, 2006.
Oliveira C.S., Rigon A.P., Leal R.B., Rossi F.M. The activation of
ERK1/2 and p38 mitogen-activated protein kinases is
dynamically regulated in the developing rat visual system. Int
J Dev Neurosci 26:355-362, 2008.
Olsen R., Betz H. GABA and Glycine. In Siegel G.J, Albers RW,
Brandy ST, Prince DL. Basic Neurochemistry: Molecular,
cellular and medical aspects. New York: Elsevier, 291-301,
2006.
Ottersen O.P., Storm-Mathisen J. Glutamate. In: Björklund A., Hökfelt
T., eds. Handbook of chemical neuroanatomy. Vol 18.
Amsterdam: Elsevier; 2000.
Peterson G.L. A simplification of the protein assay method of Lowry et
al. which is more generally applicable. Anal Biochem 83:346-
356, 1977.
Posser T., de Aguiar C.B., Garcez R.C., Rossi F.M., Oliveira C.S.,
Trentin A.G., Neto V.M., Leal R.B. Exposure of C6 glioma
cells to Pb(II) increases the phosphorylation of p38(MAPK)
and JNK1/2 but not of ERK1/2. Arch Toxicol 81:407-414,
2007.
Priel M.R., Albuquerque E.X. Short-term effect of pilocarpine on rat
hippocampal neurons in culture. Epilepsia; 43(Suppl 5):40–6,
2002.
Rakhade S.N., Loeb J.A. Focal reduction of neuronal glutamate
transporters in human neocortical epilepsy. Epilepsia 49:226-
236, 2008.
Rakhade S.N., Zhou C., Aujla P.K., Fishman R., Sucher N.J., Jensen
F.E. Early alterations of AMPA receptors mediate synaptic
potentiation induced by neonatal seizures. J Neurosci 28:7979-
7990, 2008.
Robinson M.J., Cobb M.H. Mitogen-activated protein kinase pathways.
Curr Opin Cell Biol 9:180-6, 1997.
Rodrigo R., Felipo V. Control of brain glutamine synthesis by NMDA
receptors. Front Biosci 1; 12:883-890, 2007.
Rothstein J.D., Dykes-Hoberg M., Pardo C.A, Bristol L.A, Jin L., Kuncl
R.W., Kanai Y., Hediger M.A., Wang Y., Schielke J.P., Welty
105
D.F. Knockout of glutamate transporters reveals a major role
for astroglial transport in excitotoxicity and clearance of
glutamate. Neuron 16:675-686, 1996.
Russi M.A., Vandresen-Filho S., Rieger D.K., Costa A.P., Lopes M.W.,
Cunha R.M., Teixeira E.H., Nascimento K.S., Cavada B.S.,
Tasca C.I., Leal R.B. ConBr, a Lectin from Canavalia
brasiliensis Seeds, Protects Against Quinolinic Acid-Induced
Seizures in Mice. Neurochem Res 37 (2):288-297, 2012.
Sanabria E.R., Su H., Yaari Y. Initiation of network bursts by Ca2+
-
dependent intrinsic bursting in the rat pilocarpine model of
temporal lobe epilepsy. J Physiol. 532 (Pt 1):205-16, 2001.
Sanacora G., Zarate C.A., Krystal J.H., Manji H.K. Targeting the
glutamatergic system to develop novel, improved therapeutics
for mood disorders. Nature Reviews Drug Discovery, 2008.
Sanderson J.L., Dell'Acqua M.L. AKAP signaling complexes in
regulation of excitatory synaptic plasticity. Neuroscientist
17:321-336, 2011.
Santos S.D., Carvalho A.L., Caldeira M.V., Duarte C.B. Regulation of
AMPA receptors and synaptic plasticity. Neuroscience.158
(1):105-25, 2009.
Scorza F.A., Arida R.M., Naffah-mazzacoratti mda G., Scerni D.A.,
Calderazzo L., Cavalheiro E.A. The pilocarpine model of
epilepsy: what have we learned? An Acad Bras Cienc.
81(3):345-65, 2009.
Seifert G., Weber M., Schramm J., Steinhauser C. Changes in splice
variant expression and subunit assembly of AMPA receptors
during maturation of hippocampal astrocytes. Mol Cell
Neurosci 22:248-258, 2003.
Selcher J.C., Weeber E.J., Christian J., Nekrasova T., Landreth G.E.,
Sweatt J.D. A role for ERK MAP kinase in physiologic
temporal integration in hippocampal area CA1. Learn Mem
10:26-39, 2003.
Sepkuty J.P., Cohen A.S., Eccles C., Rafiq A., Behar K., Ganel R.,
Coulter D.A, Rothstein J.D. A neuronal glutamate transporter
contributes to neurotransmitter GABA synthesis and epilepsy.
J Neurosci 22:6372-6379, 2002.
Siegel J.G., Alberts R.W., Brady S.T., Price D.L. Basic Neurochemistry,
Molecular, Celular and Medical Aspects. Elsevier 7:267-290,
2006
Smolders I., Khan G.M., Manil J., Ebinger G., Michotte Y. NMDA
receptor-mediated pilocarpine-induced seizures:
106
characterization in freely moving rats by microdialysis. Br J
Pharmacol 121:1171–9, 1997.
Sperk G., Drexel M., Pirker S. Neuronal plasticity in animal models and
the epileptic human hippocampus. Epilepsia. 50 Suppl 12:29-
31, 2009.
Sutula T.P., Hagen J., Pitkanen A. Do epileptic seizures damage the
brain? Curr Opin Neurol 16:189-195, 2003.
Sweatt J.D. Mitogen-activated protein kinases in synaptic plasticity and
memory. Curr Opin Neurobiol 14:311-317, 2004.
Tanaka, K., Watase, K., Manabe, T., Yamada, K., Watanabe, M.,
Takahashi, K., Iwama, H., Nishikawa. T., Ichihara, N.,
Kikuchi, T., Okuyama, S., Kawashima, N., Hori, S., Takimoto,
M., Wada, K. 1997. Epilepsy and exacerbation of brain injury
in mice lacking the glutamate transporter GLT-1. Science
276(5319), 1699-702.
Thomas G.M., Huganir R.L. MAPK cascade signalling and synaptic
plasticity. Nat Rev Neurosci 5:173-183, 2004.
Tibbles L.A., Woodgett J.R. The stress-activated protein kinase
pathways. Cell Mol Life Sci 55:1230-1253, 1999.
Turski W.A., Cavalheiro E.A., Bortolotto Z.A., Mello L.M., Schwarz
M., Turski L. Seizures produced by pilocarpine in mice: a
behavioral, electroencephalographic and morphological
analysis. Brain Res; 32:237–53, 1984.
Turski W.A., Cavalheiro E.A., Schwarz M., Czuczwar S.L.J., Kleinrok
Z., Turski L. Limbic seizures produced by pilocarpine I rats:
behavioral, electroencephalographic and neuropathological
study. Behav Brain Res; 9: 315–35, 1983.
Tzschentke, T.M. Glutamatergic mechanisms in different disease states:
overview and therapeutical implications – an introduction.
Amino Acids 23, 147–52, 2002.
Waetzig V., Zhao Y., Herdegen T. The bright side of JNKs-
Multitalented mediators in neuronal sprouting, brain
development and nerve fiber regeneration. Prog Neurobiol
80:84-97, 2006.
Walz R., Bianchin M., Linhares M.N., Leite J.P., Sakamoto A.C.
Epilepsias. In: Kapczinski F, Quevedo J, Izquierdo I, editors.
Bases Biológicas dos Transtornos Psiquiátricos. Segunda ed.
ARTMED; 429-44, 2003.
Walz R., Medina J.H., Izquierdo I. Biochemistry of Long-term memory:
the case of one trial step-down inhibitory avoidance. In:
107
Calabrese P., Neugebauer A, editors. Memory and Emotion.
New Jersey: World Scientific; 2002.
Walz R., Roesler R., Quevedo J., Rockenbach I.C., Amaral O.B.,
Vianna M.R., et al. Dose-dependent impairment of inhibitory
avoidance retention in rats by immediate post-training infusion
of a mitogen-activated protein kinase kinase inhibitor into
cortical structures. Behav Brain Res 105(2):219-23, 1999.
Waxman E.A, Lynch D.R. N-methyl-D-aspartate receptor subtypes:
multiple roles in excitotoxicity and neurological disease.
Neuroscientist 2005; 11:37–49, 2005.
Whitlock J.R, Heynen A.J., Shuler M.G., Bear M.F. Learning induces
long-term potentiation in the hippocampus. Science
313(5790):1093-7, 2006.
Wiebe S., Blume W.T., Girvin J.P., Eliasziw M. A randomized,
controlled trial of surgery for temporal-lobe epilepsy. N Engl J
Med. 345(5):311-8, 2001.
Winder D.G., Sweatt J.D. Roles of serine/threonine phosphatases in
hippocampal synaptic plasticity. Nat Rev Neurosci. 2(7):461-
74, 2001.
Yokoyama N., Mori N., Kumashiro H. Chemical kindling induced by
cAMP and transfer to electrical kindling. Brain Res 492:158-
162, 1989.
Zhao Y., Herdegen T. Cerebral ischemia provokes a profound exchange
of activated JNK isoforms in brain mitochondria. Mol Cell
Neurosci 41:186-195, 2009.