Estudos moleculares e estruturais de enzimas de

Leishmania visando o desenho racional de inibidores

antiparasitáriosri.

APRT

Texto que sistematiza o trabalho científico do candidato para aobtenção do titulo de Livre Docência

Prof. Dr. Otavio Henrique Thiemann

Departamento de Física e InformáticaInstituto de Física de São Carlos

Universidade de São Paulo

Agosto de 2004

I F S (. U S P SERViÇO DE BIB~IOTECAINFORMAÇAO

,Indice

AgradecimentosIntroduçãoCapítulo I

1.1- Leishmanioses1.2- Desenho e desenvolvimento de fármacos

Capítulo II2.1- Síntese de purino-nucleotídeos2.2- Trabalhos apresentados em seguida

6

7

1114

16

20

Silva M, Silva C.H, Iulek J, Oliva G, and Thiemann OH. Crysta/structure

of adenine phosphoribosy/transferase from Leishmania tarento/ae:

potentia/ implications for APRT cata/ytic mechanism. Biochim Biophys

Acta. 2004;1696(1):31-9. 23

Silva M, Silva C.H, Iulek J, and Thiemann O.H. Three-dimensiona/

structure of human adenine phosphoribosy/transferase and its re/ation to

DHA-uro/ithiasis. Biochemistry. 2004;43(24): 7663-71. 32

Monzani P.S, Alfonzo J.D, Simpson L, Oliva G, and Thiemann O.H.C/oning, characterization and preliminary crystallographic ana/ysis of

Leishmania hypoxanthine-guanine phosphoribosy/transferase. Biochim

Biophys Acta. 2002;1598(1-2):3-9. 41

Castilho M. S., Araújo A.S., Oliva G. and Thiemann O.H. Biochemica/and

structura/ characterization of Leishmania major Fried/ing xanthine

phosphoribosy/transferase. Mo!. Biochem. Parasito!. Submetido. 48

Capitulo III3.1- Via glicolítica3.2- Glicose-6-fosfato isomerase

3.3- Trabalhos apresentados em seguida

596365

2

I F S (. U S P SERViÇO DE SiBLlOTECAINFORMAÇÃO

Cordeiro A.T, Godoi P.H.C, Delboni L.F, ouve G, Thiemann O.H. Human

phosphog/ucose isomerase: expression, purification, crystal/ization and

pre/iminary crystallographic ana/ysis. Acta Crystallogr D Biol Crystallogr.

2001; 57(Pt 4):592-5. 68

Cordeiro A.T., Godoi P.H.C., Silva C.H.T.P., Garratt R.C., Oliva G.,

Thiemann O.H. Crysta/ structure of human phosphog/ucose isomerase

and ana/ysis of the initia/ cata/ytic steps. Biochim Biophys Acta. 2003,

1645 (2): 117-22. 72

Cordeiro A.T., Hardre R., Michels P.A., Salmon L., Delboni L.F.,

Thiemann O.H. Leishmania mexicana mexicana g/ucose-6-phosphate

isomerase: crystal/ization, mo/ecu/ar-rep/acement so/ution and inhibition.

Acta Crystallogr D Biol Crystallogr. 2004; 60(Pt 5):915-9. 78

Cordeiro A.T., Michels P.A., Delboni L.F., Thiemann O.H. The crysta/

structure of g/ucose-6-phosphate isomerase from Leishmania mexicana

revea/s nove/ active site features. Eur J Biochem. 2004; 271(13):2765-

72. 83

Hannaert V., Albert M.A., Rigden D.J., da Silva Giotto M.T., Thiemann O.H., Garratt R.C., Van Roy J., Opperdoes F.R., Michels P.A. Kinetic

characterization, structure model/ing studies and crystallization of

Trypanosoma brucei eno/ase. Eur J Biochem. 2003;f70(15):3205-13. 91

Capitulo IV"4.1- Rastreamento de inibidores a partir de extratos

de plantas e animais marinhos

4.2- Trabalhos apresentados em seguida

100102

Napolitano H.B., Silva M., Ellena J., Rocha W.C., Vieira P.C., ThiemannO.H., Oliva G. Redetermination of skimmianine: a new inhibitor against

the Leishmania APRT enzyme. Acta Crystallogr E Struc. Rep. 59: 01503-

01505 Part 10, 2003. 105

3

Napolitano H.B., Silva M., Ellena J., Rocha W.c., Vieira P.c., ThiemannO.H., Oliva G. Redetermination and comparative structura/ study of

isopimpinellin: a new inhibitor against the Leishmania APRT enzyme. Acta

Crystallogr E Struc. Rep. 59: 01506-01508 Part 10, 2003. 108

Silva M., Napolitano H.B., Ellena J., Rocha W.c., Vieira P.c., Oliva G.,

Thiemann O.H. 3-(S,7-Dimethoxy-2,2-dimethy/-2H-benzo[b ]-pyran-6-

y/)propionic acid: a potentia/ inhibitor against Leishmania. Acta

Crystallogr E Struc. Rep. 59: 01575-01577 Part 10, 2003. 111

Napolitano H.B., Silva M., Ellena J., Rodrigues B.D.G., Almeida A.L.C.,

Vieira P.c., Oliva G. and Thiemann O.H. Aurapten, a nove/ coumarin

with growth inhibition against Leishmania major promastigotes. Braz. J.

Med. Biol. Res., No Prelo. 114

Silva M., Silva C. H. T. P., Rocha W. C., Castilho M. S., Vieira P. c., Oliva

G. and Thiemann O. H. In-vivo and ln-vitro effect of four alkaloids of

Adiscanthus fusciflorus: Inhibition of phosphoribosyl transferases activity

and antileishmanial effect. Submetido. 125

o

Berlinck R.G.S., Hajdu E., da Rocha R.M., de Oliveira J.H.H.L., Hernandez

I.L.C., Seleghim M.H.R., Granato A.C., de Almeida E.V.R., Nunez C.V.,

Muricy G., Peixinho S., Pessoa C., Moraes M.O., Cavalcanti B.C.,

Nascimento G.G.F., Thiemann O.H., Silva M., Souza A.O., Silva C.L.,

Minarini P.R.R. Challenges and rewards of resesrch in marine natural

products chemistry in Brazil. J. Nat. Prod. 67 (3): 510-5222004. 142

Capitulo VConclusões

Referências:

155158

4

Agradecimentos

Aproveito este espaço para reconhecer as pessoas que contribuíram de diversas

maneiras para a realização deste trabalho. Meus agradecimentos:

• Aos Profs. Glaucius Ollva e Richard Charles Garratt, pela amizade e acolhida no

Grupo de Cristalografia de Proteínas e Biologia Estrutural do IFSC incentivando

constantemente com competência e dedicação os trabalhos nas mais diversas

formas.

• As Profa. Ana Paula U. de Araújo pela acolhida nos primeiros anos nolaboratório e longas discussões de trabalho e a Profa. Leila M. Beltramini, pelo

apoio e acolhida junto às disciplinas do curso de Licenciatura em Ciências.

• Aos colegas de trabalho; técnicos, pos-docs, alunos e estagiarios do Grupo deCristalografia de Proteínas e Biologia Estrutural do IFSC, que ensinaram tanto

e com tanta dedicação permitiram a realização dos trabalhos de pesquisa

apresentados.

• A Luciana, Jaciara e Fernando, que com muita paciência e dedicação nos

ajudam no nosso cotidiano.

C) • Aos diversos colaboradores, sem os quáls varios projetos não existiriam.

• Aos Drs. Wim M. Degrave, Larry e Agda Simpson, que tanto me ensinaram nosanos que me acolheram em seus labotatórios.

• A minha esposa Flavia, e meu filho Daniel, pelo carinho e tantas alegrias que

fazem tudo valer a pena. Sem seu companheirismo nada seria possível.

5

Introdução

Esta tese trata de aspectos de biologia molecular e estrutural apresentados

através de uma coletânea de artigos publicados ou submetidos para publicação,

refletino nossa modesta contribuição na área da parasitologia molecular e

estrutural. Nestes artigos as técnicas empregadas abrangem a bioquímica,

biologia molecular, parasitologia molecular e cristalografia de proteínas.

A motivação que levou a escolha do tema desta tese focalizado nas vias de

recuperação de purino nucleotídeos e na via glicolítica foram duas: Em primeiro

lugar representa um conjunto de trabalhos realizados após meu doutoramento e

assim caracteriza uma nova linha de pesquisa, tanto para mim quanto para o

Grupo de Cristalografia de Proteínas e Biologia Estrutural do Instituto de Física de

São Carlos; em segundo lugar permite a formulação de uma tese sobre uma

tema coerente. Em contrapartida, os artigos aqui apresentados não representam

a totalidade da minha produção científica ao longo destes anos.

) Com a exceção do primeiro capítulo, cada. capítulo traz uma breve introdução ao

assunto a ser abordado e os artigos a ele. relacionados.

O primeiro capitulo traz uma breve introducao aos temas desta tese, decrevendo

a leishmaniose e ao desenho racional de inibidores viando futuro desenvolvimento

de fármacos.

O segundo capitulo aborda a via de sintese de purinas. Apos uma breve

introducao seguem-se quatro artigos que descrevem aspectos da bioquímica e

estrutura das fosforibosiJ transferases (PRTases) de Leishmania e humana.

6

o terceiro capitulo aborda a via glicolítica. Apos uma breve introducao seguem-se

cinco artigos. Os dois primeiros abordam a descrição da glucose-6-fosfato

isomerase (PGI) humana e as observações decorrentes do estudo estrutural

sobre esta enzima. Os dois artigos seguintes tratam da PGI de Leishmania

mexicana mexicana, sua clonagem, caracterização, atividade de inibidores

analogos ao substrato e sua estrutura cristalográfica. Finalmente o quinto artigo

desreve os trabalhos realizados com a enolase de Trypanosoma brucei.

O quarto capitulo descreve trata da busca por inibidores de PRTases e Leishmania

em extratos naturais, de plantas e animais marinhos. Compõe este capitulo sete

artigos, os tres primeiros descrevem a estrutura cristalográfica de tres inibidores

de uma Rutaceae Adiscanthus fusciflorus que possuem atividade inibitória sobre a

APRT de Leishmania. O quarto artigo, aceito para publicação, descreve o

isolamento e caracterização da atividade inibitória sobre o crescimento da cultura

de Leishmania major do 7-geranyloxycoumarin, Aurapteno, uma cumarina isolada

de Esenbeckia febrifuga (Rutaceae). O quinto artigo descreve os estudos

bioquímicos e celulares de quatro inlbldores isolados de Adiscanthus fusciflorus.

Os dois artigos finais descrevem os avanços na identificação de compostos com

atividade biológica de interesse a partir de extratos de animais marinhos.

7

Capítulo I

As décadas de 1950 e 1960 foram levadas por grande otimismo em

assuntos referentes à saúde pública e agentes infecciosos. Em 1951, a

Organização Mundial da Saúde (OMS) declarou que " ... malaria is no longer of

major importance ..." e lançou-se uma ambiciosa campanha de erradicação da

enfermidade [1]. Tal otimismo não se limitou a infecções por parasitos como a

malária. Estendeu-se a todas as doenças infecciosas, bacterianas, virais,

parasitarias, etc..., julgando-se que em poucos anos a humanidade estaria livre

dos micróbios.

Apesar dos avanços da ciência nas ultimas décadas, muitos agentes

etiológicos permanecem como uma ameaça à saúde publica e outros,

considerados erradicados, de fácil tratamento ou mesmo sob controle, estão

ressurgindo [2]. Isto se deve a fatores socioeconômicos e ambientais, fatores

.0comportamentais de risco, especialmente em populações de refugiados, em

emergências complexas, pela invasão de áreas silvestres ou pelo aparecimento de

formas resistentes aos tratamentos disponíveis."

Dentre as patogenias para as quais nunca foi desenvolvido um tratamento

adequado, seja por quimioterapia ou uma vacina eficaz, se destacam as doenças

causadas por protozoários parasitas. Das etiologias causadas por espécies da

ordem Kinetoplastida, destacamos as leishmanioses que estão colocadas na

categoria I (doenças emergentes e não controladas) pela Organização Mundial da

Saúde [3], junto com a doença do sono ou trypanosomíase africana e dengue,

8

apesar dos promissores resultados com o composto Miltefosina, em fase IV de

testes clínicos.

o interesse médico e de saúde pública despertado pelos Kinetoplastida se

soma o interesse no sentido da pesquisa fundamental que os membros dessa

ordem despertam. Esta ordem representa um ramo antigo dos eucariotos como

descrito por Carl Woese e colaboradores em 1987 [4]. Em espécies de

Kinetoplastida foram identificados fenômenos de grande interesse como a

editoração do RNA mitocondrial por adição e deleção de uridinas. Este um

fenômeno intrigante e ainda pouco resolvido. A falta de tRNAs codificados pelo

genoma mitocondrial, apesar dessa organela possuir capacidade de tradução e

síntese protéica, implica na importação de tRNAs do citoplasma para a matriz

" I EUKARYAI

I I dmo- slimeBACTERlA ram- animais flagellates molds

. . g" green "Iiatpurple ~e non-sultur pIants CI es euglenoids

""-ct " bacteria bactenaUG ena fungi

cyanobacteria

flavobacteria

mitocondrial. ocomplexo genoma

Thermotoga __ "

mitocondrial e sua

incomum organização

são alvos de intensos

o estudos desde sua

W~se (1987)MicrobiolR~51:221-227

descoberta. Transcrição

policistrônica, uma

característica de bactérias foi identificada em Kinetoplastida também, assim como

a existência de um sistema de trans-splicing, ao invés do cis-splicing identificado

em outros eucariotos [5].

9

Recentemente foi inclusive identifica da a presença de genes de cloroplasto

no genoma nuclear de Trypanosoma [6]. Esta descoberta implica em uma perda

secundaria dessa organela e pode vir a ter interessantes desdobramentos.

As características peculiares citadas alem da importância a saúde publica

humana, com as conseqüentes implicações sócio-econômicas resultantes de

tornam os estudos desta ordem de grande interesse.

1.1- Leishmanioses

As leishmanioses são zoonoses classificadas

em oito diferentes grupos segundo a sintomatologia

e espécie de parasito envolvido (Tabela I). São

causadas por protozoários de diversas espécies pertencentes ao gênero

Leishmania, ordem Kinetoplastida. Estima-se que 400.000 novos casos ocorram

anualmente nas regiões tropicais e subtropicais do globo, estando mais de 10

o milhões de indivíduos contaminados e 400,milhões sob risco de infecção [7, 8].

Esses alarmantes números retratam um alto índice de mortalidade e morbidade

"das leishmanioses. Em humanos a doença tem manifestação crônica de

apresentação cutânea ou vlsceral. As formas cutâneas do Novo Mundo se

caracterizam por desenvolverem lesões metastáticas mutilantes nas várias

mucosas. As formas viscerais, distribuídas em ambos os hemisférios, se

caracterizam por infecções do sistema retículo-endotelial.

10

Tabela I. Classificação do gênero Leishmania.

Species de Leishmania • Condição clínica b Epidemiologia c

A. Seção d HypopylariaLagartos - Novo Mundo

Leishmania agamaeLeishmania ceramodactyli

B. Seção PeripylariaLagartos - Velho Mundo

Leishmania adleriLeishmania tarentolae

Mamíferos - Novo MundoComplexo Leishmania braziliensis I (subgênero VianniaJ)

L. b. braziliensis C,ML. b. guyanensis CL. b. panamensis C, ML. b. peruviana CL. b. laisoni r CL. b. colombiensis CL. b. naiffi rL. b. shawi'L. b. equatorensis

C. Seção SuprapylariaMamíferos - Novo Mundo

Complexo Leishmania mexicana i (subgênero Leishmania)L. m. mexicana C (D)L. m. amazonensis C, D, V li, P, ML. m. pifanoi D (C)L. m. aristidesiL. m. venezuelensis CL. m. garnhami CL. m. enriettiL. m.forattinii

Complexo Leishmania hertigi (subgênero Leishmania)L. h. hertigiL. h. deanei

Mamíferos - Velho MundoComplexo Leishmania donovani (subgênero Leishmania]

L. d. donovani V, PL. d. infantum V, C ••, AL. d. chagasi • N, C ",.AL. d. archibaldi V, C, O

Complexo Leishmania tropica (subgênero Leishmania)L. t. tropica C, R, Vb, P, OL. t. killicki CL. aethiopica C, D, M

Complexo Leishmania major (subgênero Leishmania)L. m. major C, D, [V]

Leishmania gerbilli g

Leishmania turanica n. sp. g

Lagartos - Velho MundoLeishmania gymnodactyliLeishmania hemidactyliLeishmania hoogstraaliLeishmania zmeevi

ZVLZVLZVLZVL

ZVLZVL

AVLZVLZVL

AVL

ZVL

ZVL

11

• Adaptado de [10- I6). Esta tabela exclue a descrição "Leishmania sp." Para conter apenas aquelas espécies identificadas seguindo a proposta de Lainson,R. and Shaw. J. J.[IO). • Resumo das condições clínicas humanas [15,16): A, leishmaniose asintomática; C, leishmaniose cutãnea (CL); D, Ieishrnaniosedifusa cutànea (DCL, disseminada); M, leishmaniose mucocutânea (MCL); O, leishrnaniose oronasal; P, Ieishmaniose post-kala-azar dennica (PKDL); R,leishmaniose recidiva (LR, forma de relapso); V, leishrnaniose visceral (VL); ( ) existência incerta; [ ), baseada em um único caso [16]. c Caracteristicasepidemiológicas de acordo com Desjeux, P. [15): AVL, leishmaniose antroponótica visceral; ZVL, leisbmaniose zoonótica visceral. d Seção é um termotaxonômico aceito e introduzido por Lainson R. e Shaw, J. J. in 1979 [12]. c L. chagasi foi incluído no complexo Leishmania donovani por Momen, H. eta!. [17]. f Leishmania naiffi, L. laisoni e L. shawi foram classificadas por Desjeux, P. [15] como patogênicas a humanos apesar de apenas infecções emanimais terem sido descritas [16].' L. gerbilli e L. turanica foram isoladas de Rhombomys opimus e são endêmicas da Ãsia Central [18] e Russia [19]respectivamente. Estas espécies são caracterizadas por desenvolvimento suprapylaria. Até o momento estas espécies não foram classificadas em umcomplexo especifico. h Manifestação rara [15]. ;A classificação de "complexo" foi introduzida por Lainson, R e Shaw, J. J. [l I, 13].10 subgênero Vianniafoi proposto em 1989 por Lainson, R. et. a!. 1989.

Célula de LelshmanJa major (amarelo) sendofagocitada por um macrófago FIgura derrucroscopra eletromca de varredura colondaartificialmente

As formas de tratamento têm se

baseado no uso de antimônicos pentavelentes

como o antimonato de N-methyl glucamina

(Glucantine) e o estibogluconato de sódio

(Pentostam) [20-22]. A duração da terapia e a

resposta clínica variam de região a região e da

interação patógeno-hospedeiro. Na prática, a aplicação de altas doses por

prolongados períodos é comum. Isto se deve em parte a rápida eliminação destes

A B c

II

Exemplos das manifestações cllnicas dasLeishmanioses A- Lelshmanlose visceral Nota-se o abdomen dístendído mdicandosplenomegalia e a severa atrofia muscular B- aLetsbmanioss mucocutânea Nota-se ocomprometimento da reglêo da oral e nasal C-t.eishmanose cutênea Nota-se o aspectopustular desta manrfestação em particular (deWtMN .who íntltdr)

compostos da corrente sangüínea. Em

casos de recidiva e nas infecções por L.

aethiopica leishmanioses viscerais,ou

indica-se o emprego da anfotericina B

(Funqlzon) [22, 23]. A anfotericina B

apresenta efeitos colaterais indesejados e

até graves, portanto necessitando ser

ministrada em hospitais, uma dificuldade

adicional tratamento,no em se

considerando saúdecondições deas

pública prevalentes nas regiões endêmicas. Esta terapia tem se mostrado pouco

12

eficiente em diversos casos. Em pacientes resistentes ao Glucantine e ao

Fungizon não se identificam alternativas eficazes. Tende-se a repetir o

tratamento, com doses nos limites da tolerância ou a utilizar o isotionato de

pentamidina como uma última alternativa [20, 21]. Aliado a baixa eficácia de

tratamento, se observam também diversas reações de toxicidade que vão desde

náusea, vômitos e mialgia até, nos casos mais graves o choque, alterações

eletrocardiográficas, hipersensibilidade e trombose venosa. Estas características

indesejáveis, associadas ao aparecimento de formas resistentes de Leishmania

[23], têm exacerbado a necessidade do desenvolvimento de drogas

antileishmanióticas mais eficazes e menos tóxicas ao paciente. A toxicidade é

particularmente severa no tratamento de crianças e idosos ou indivíduos

portadores de infecções oportunistas secundárias.

1.2- Desenho e desenvolvimento de fármacos

A abordagem moderna para o desenvolvimento de drogas [24, 25] explora

enzimas únicas ao metabolismo do parasito ou que possuam diferenças de

"especificidade catalítica entre a enzima do parasito e a do hospedeiro. Estas

enzimas podem ser empregadas como alvo no desenvolvimento de inibidores da

cadeia metabólica, sem com isso afetar o hospedeiro. Para tanto, torna se

indispensável à determinação da estrutura tridimensional da enzima, a

caracterização do mecanismo de catálise e identificação do sítio catalítico, bem

como de domínios reguladores presentes na mesma [24]. Analises filogenéticas

13

mostram que os protozoários parasitos formam clades relativamente profundas

tendo divergido do restante da linhagem eucariota em um ancestral primitivo [26,

27]. Esta observação é uma evidência adicional que mesmo enzimas homólogas

entre o hospedeiro e os parasitos podem ter divergido suficientemente permitindo

o seu uso como alvos em abordagens de quimioterapia. Um estudo dessa

magnitude requer o desenvolvimento de proteínas mutantes, resistentes a

inibidores ou com características cinéticas alteradas a fim de permitirem elucidar

o mecanismo catalítico e os aminoácidos envolvidos no sítio catalítico. O primeiro

composto desenvolvido desta forma foi o anti-hipertensivo Captopril, um inibidor

da angiotensina convertase. O acúmulo de dados referentes a estruturas

cristalográficas e cinética de diversas enzimas levou ao desenho de vários

compostos adicionais para o emprego clínico (para uma revisão veja Kubinyi,

H.[24]).

14

Capítulo 11

2.1- Síntese de purino-nucleotídeos

o metabolismo de purino-nucleotídeos em protozoários parasitos é

significativamente diferente daquele de mamíferos. Em humanos os purino-

nucleotídeos são sintetizados de novo, a partir de precursores não-nucleotídeo

tais como aminoácidos, amônia e dióxido de carbono. Os purino-nucleotídeos

podem também ser reciclados pela via de recuperação [28-31]. Os passos

enzimáticos da via de síntese de novo são bem conservados ao longo de diversos

taxa.

Os nucleotídeos podem também ser formados a partir de purinas e purino-

nucleosídeos livres. Na via de recuperação, as purinas reagem com 5'-fosforibosil-

1-pirofosfato (PRPP) formando os nucleosídeos-5'-monofosfatos correspondentes.

Estas reações reversíveis são catalisadas por distintas fosforibosil-transferases

J (PRTases) substrato-específicas. AsPRTases formam uma classe de

aproximadamente 10 enzimas que cataílsarn reações semelhantes envolvendo

PRPPe uma base nitrogenada [32]. Em mamíferos, essas reações são catalisadas

por duas enzimas distintas: adenina-fosforibosil-transferase (APRT;

AMP:pirofosfato fosforibosiltransferase; EC 2.4.2.7) e hipoxantina-guanina-

fosforibosil-transferase (HGPRT; IMP: pirofosfato-fosforibosil-transferase; EC

2.4.2.8) nas reações reversíveis esquematizadas na figura 1. A HGPRT catalisa a

remoção do grupo pirofosfato (PP1) de PRPP e a adição de uma base purínica

15

Guanina

(hipoxantina ou1" o o- O' APRT(XJ + -'oy-.,~"-to-j-O-~-o-~

O2 Hrpoxantma

O O2 <=(~HN~l'"'""(+. ~(~)-~+

guanina) em uma

reação do tipo SN2+ PP

1

(ataque nucleofilico

de segunda ordem)

aparentemente. O

mecanismo de

FigullI 1: As dIVersas reações de transferência catalisadas pelas PRTases estão mostradas PRPP 5'-fosforibosi~l-plrofosfato, APRT ademna-fosforibosll-transferase; HGPRT hlpoxanlln&-guanina fosforibosl~transferase; XPRT xantina fosforibosil-transferase; PPi pirofosfato

reação da maioria

das PRTases

começa a ser elucidado. Mecanismo do tipo duplo-deslocamento (mecanismo

"pingue-pongue") foi sugerido para a OPRT(orotato-fosforibosil-transferase, EC

2.4.2.10) [33] e UPRT(uridina-fosforibosil-transferase, EC 2.4.2.9) de levedura

[34]. Giaconello A. e Salerno, C. [35] sugeriram que HGPRTde humanos segue o

mecanismo seqüencial em um modelo aleatório e de rápido equilíbrio, onde os

produtos se dissociam em seqüência ordenada, primeiro a base purínica seguida

do complexo Mg-P-Rib-PP (magnésio-fosforibosil-pirofosfato). Entretanto, a

(J análise de HGPRT de Schistosoma msnsoni favorece o modelo de reação

seqüencial ordenada, onde PRPPse liga a enzima primeiro e os produtos IMP ou

GMPsão liberados por último [36]. Este modelo difere do proposto para a HGPRT

de humanos [35], e sugere a possibilidade de desenho de inibidores específicos

para o complexo binário enzima-purina. O pirofosfato formado (PPi) na reação de

transferência é rapidamente hidrolisado favorecendo o deslocamento do equilíbrio

de reação para a formação dos mononucleosídeos.

16

Esta cadeia de recuperação permite ao organismo a reutilização de purinas

obtidas da degradação de ácidos nucleicos ou nucleotídeos (Figura 2). A via de

recuperação está presente em todos os organismos estudados, incluindo

protozoários parasitos [28, 31]. Em Kinetoplastida e diversos outros protozoários,

a via de recuperação consiste na única forma de obtenção de purino-nucleotídeos

[31, 37]. Como conseqüência cada gênero de parasito, auxotrófico para purlno-

nucleotídeos, desenvolveu um conjunto específico de enzimas da via de

recuperação que Ihes permite utilizar purinas pré-formadas (Figura 3). As

implicações terapêuticas do metabolismo de purino-nucleotídeos em

kinetoplastidas são substanciais [30, 31].

o

Ribose-6-phosphate _ PRPP--,PRS-I i

Synthests-ae NO""! I

~~Adenylosuccinate I \L

MRjMP

ADSL \ /AMD 1\ IGMS

~ADP-- AMPPPi I GMP-GDP:--+IGTrl

PPi~ PR'PP-YPPí

,

APRTf--PRPP HGPRTI

Adenine Guanine

AAir.. Hypoxantine

Os Kinetoplastida se

destacam pela suscetibilidade a

análogos de purino-

nucleotídeos [31, 37, 38, 39].

A HGPRT de Leishmania é

relativamente inespecífica e

pode utilizar pirazolopirimidinas

como substrato. O mais

Figura 2: Via de recuperação e interconverção, em células demamíferos. APRT- adenina-fosforibosil-transferase; HGPRT-hipoxantina-guanina-fosforibosil-transferase; PRPP- 5'-fosforibosil-I-pirofosfato.

estudado desses compostos é o

análogo da hipoxantina,

alopurinol (4-

hidroxipirazol[3,4]pirimidina) (Figura 4). O alopurinol é metabolizado por HGPRT

17

aos vários análogos de IMP (Figura 4), um eficaz inibidor de succinil-AMP-sintase

e GMP-redutase [40]. Conseqüentemente, alopurinol acarreta a inibição da

biossíntese de purinas nesses organismos. Além do efeito inibitório descrito, o

análogo de IMP é convertido a análogos de AMPque uma vez fosforilados a ATP

Ribose-6-phosphate-_ PRPPPRS-Í

liMPl .unJo PPi" PRPPAD~~ \.) Xhantine

~; 4/ " XMP.." "-- HypoxantineAdenylosuccinate . MR / XPRT Guanine

ADSL \ AMD IGMS

~ADP- AMP pPi",l .. G.M.P-GDP~

~ l tivPPi

7~RTt"--PRPP I ::;;rrAdenine Guanine

AA'iI-.. Hypo~antine

Figura 3: Via de recuperação e interconverção, em células deKinetoplastida. APRT- adenina-fosforibosil-transferase; HGPRT-hipoxantina-guanina- fosforibosil-transferase; PRPP- 5' -fosforibosil-l-pirofosfato. XPRT - xantina-guanina -fosfonbosil-transferase;AAH- adenina deaminase.

são eficientemente

incorporados na transcrição de

RNA e levam a uma rápida

degradação dos mesmos,

acompanhado da inibição de

síntese protéica [28].

Alopurinol é utilizado

extensivamente no tratamento

de hiperuricemia (ácido úrico

sangüíneo elevado) e artrite

aguda (gota) [41]. Também tem sido explorado clinicamente no tratamento de

leishmaniose cutânea [42] e Doença de Chagas crônica [43]. Isto se deve, em

parte, pela incapacidade das PRTaseshumanas de metabolizarem este composto

[31, 44]. Entretanto, reações adversas e a falha terapêutica foram observadas no

uso de alopurinol [43, 42] alertando para a necessidade de aprimorar este

composto. A via de recuperação de Leishmania e Trypanosoma se encontra

esquematizada na figura 3. Esta via varia substancialmente entre os diversos

protozoários parasitas e foi revisada em detalhe por Berens, R. L. et. aI. (1995)

[31]. A heterogeneidade nos componentes enzimáticos da via de recuperação dos

18

I F S ( U S P SERViÇO DE 8IB~IOTE\J• INFORMACAO

purino-nucleotídeos dentre os protozoários pode ser uma conseqüência da

pressão seletiva sofrida em seus nichos

ecológicos específiCOS. A maioria dos

,e<X' ~ N_Ã--çi I ) -rJV .. p~_l>;Formicina Alopunnol \ I..

f-l-DeaZ8inOSlra

parasitos, incluindo Plasmodium,

Leishmania, Trypanosoma e Toxoplasma,

_1Qc0. -rfÓ '1fÓlnosina Tubercknn

depende da atividade de fosforibosil-

transferases para a recuperação de purino-

6~Thjoguanosina nucleotídeos [31]."o

Figura 4: Bases nitrogenadas: Hipoxantina eGuanina, substratos das HGPRTases. Abaixo, algunsanálogos de purino-nucleotídeos testados comoinibidores em diversos parasitos protozoários.

Estasdiferenças entre as espéciesde

Leishmania e os hospedeiros mamíferos

tornam a resolução da estrutura tridimensional e o estudo de mutantes das

PRTasesmuito atraentes como alvos para o desenho racional de drogas [29, 39,

40].

2.2- Trabalhos apresentados em seguida

() Apresento em seguida quatro artigos relacionados com a família das fosforibosil-

transferases (PRTases). O primeiro descreve a estrutura cristalográfica da

Adenina fosforibosil-transferase (APRT) de tetstimente tarentolae em complexo

com o produto de reação AMP. Esta estrutura foi resolvida a 2.2Â e permitiu,

baseado na sobreposição estrutural com outras PRTasese calculos de potenciais

de interação molecular sugerir que o PRPPé o primeiro substrato a se ligar ao

sítio ativo, enquanto o AMPé o ultimo substrato a deixar o sitio ativo.

19

o

o segundo artigo descreve a estrutura cristalográfica da APRT humana a uma

resolucao de 2.1Â e contendo AMP ligado ao sítio ativo da enzima. A resolução

dessa estrutura permitiu a identificação de importantes residuos envolvidos na

especificidade ao substrato e discriminação de bases. A analise da estrutura da

APRT humana com os dados clínicos de pacientes acometidos de urolitíase

forneceu informações estruturais para os mecanismos pelos quais essas mutações

levam a urolitiase.

O terceiro artigo descreve a clonagem, caracterização molecular e a cristalização

da hipoxantina-guanina fosforibosil-transferase (HGPRT) de Leishmania

tarento/ae. Esta representa a primeira HGPRT de Leishmania cristalizada. Uma

publicação descrevendo as analises decorrentes deste trabalho esta em fase de

redação.

O quarto artigo descreve a clonagem e caracterização molecular da xantina

fosforibosil-transferase (XPRT) de Leishmania major. A cristalização desta enima

ainda não foi obtida, porem um modelo estrutural foi obtido baseado na estrutura

de outras PRTases descritas anteriormente. Este artigo foi recentemente

submetido para publicação.

1. Silva M, Silva C.H, Iulek J, Oliva G, and Thiemann OH. Crysta/structure of

adenine phosphoribosy/transferase from Leishmania tarento/ae: potentia/

implications for APRT cata/ytic mechanism. Biochim Biophys Acta.

2004; 1696(1): 31-9.

20

2. Silva M, Silva C.H, Iulek J, and Thiemann O.H. Three-dimensiona/

structure of human adenine phosphoribosy/transferase and its re/ation to

DHA-urolithiasis. Biochemistry. 2004; 43( 24): 7663-71.

3. Monzani P.S, Alfonzo J.O, Simpson L, Oliva G, and Thiemann O.H. C/oning,

characterization and preliminary crystallographic ana/ysis of Leishmania

hypoxanthine-guanine phosphoribosy/transferase. Biochim Biophys Acta.

2002; 1598(1-2) :3-9.

4. Castilho M. S., Araújo A.S., Ollva G. and Thiemann O.H. Biochemica/ and

structura/ characterization of Leishmania major Friedling xanthine

phosphoribosy/transferase. Moi. Biochem. Parasitol. Submetido.

21

Avaltabte onllne at www.sdencedirect.com

aetI!NCI!@DtRI!CTO

ELSEVlER

Crystal structure of adenine phosphoribosyltransferase from Leishmaniatarentolae: potential implications for APRT catalytic mechanism

M. Silvaa.l. C.H.T.P. SilvaR.I, J. Iulek", G. Oliva", O.H. Thiemann":"'l~f(JY» qf 1'ro1d1l (.'ry>ltltlógraphy ••1IJ SlrucmJ'i11 lIIúló1!>' 1'ity,kJ<l",tiM" '1S';••, ('",,},....Uoit"",Ir/" SJ& l'on,fn.(ISp,

á>. 1h'lbalhadw SJ.x~ .«()(J. p.o. B~' Ji$9. 13566-J9tJ. Sliô Cerlo», SI>.brazil• Dq"""KMI 1>/Clttml$fr): BtOlult"ology eMt"", SIQ/{! lf'd'''f'Kit? ~fP""1a (iro esr, PR, lJra:til

Rec-civcd I May 2003; """'1"00. Úl revised funu 31 My 2003; •••.""pkd 5 &v_ti>« 2003

-----,------

TIl" ülrc(-tlimcnsionaJ wlrncturc of ÚJishmania ialfl'ltlQ1ae adcmno: phOlll'horilxll>yltr.tlI5f~'UlS<: (APRT, iu C<JIul'lcx with adcIl05ine-S.monophosphate (A.\fP) and a pbo;;pbatcÍUllllll$ been sclved, RdiucU!cllt agaiusl X-ray dillIa<;tioll dala cxtcllding to2.2-Á I'C$QlutiOllled to afinal ctystallog.raphic R (acIm of 18.3% StnldUllll C.(IIllparisoll$ ammgs1 this APRT enzyme and otber 'type I' PRTases wbose snuemreshave been dctemuncd revesl 5e\'cntl illll'ortallt lbalmes uf th.: I'RTa~'S catalytíc mechanism, Based U11muctural i~itioos andmoleeulllr lnl.mtctionpotential calculotíoll$, íl was possibl~ to SIlggcst tlm! the I'RPP ís tlte fsst substrate 10 bínd, wbile lhe AMl' is th.: la.<;tprod\lct 10 íeave lhe active Sue, ín accerdance to recent kinctic studies pertormed with the Leishmania JQlu>Wl11i APRT,t,p 200.1 El$!vier II V. Ali rigbtwf.eserved

1. Introductioll

The biosynthesis of purine, I>yridíne and Pi'rimidínenucleotidcs, as well as t)f tIrotuatic amíno acid" is Catt1lyzedby enzymes of the phosphoribosyltransfernse (pRIase)furoUy. Moo organísms llYUthCSjZ~adenine Iluoleotidcs bybotb the de novo and lhe salW1ge pathways. I'n eontmst;prctozean parasites are striot })Urine nucleotI~ fUlXotrophsbecause of the absence ar 11 purine de. novo bíosyntheticpatllWa)' [I l- ll1crefol'c. 111<>1'areabsolutély dependent ouseavcnging proformedp\lt'Íll<} nueleotides fcom the 1\00 01'lhe media, Kinetoplastid profu:roa from the genus Lels"-numia possess tllt'ée PRTtlSes iuvoWed lu tlle rceyelillg ofpuríne nucleotídes bythe solvageputhway: adenille PRTtISe(APRT) (fie 2.4.2.7), hypcxamhíne-guanine )'R'rlí$o(lIGl'RT) (EC 2.4.2.8)ml<l xanthine PR1àse (xpRl) (EC

Ablllwiilli(W' I'RI'P, ,SI ,p~lI~-I).ríbosyl-l'.p)'JVplloflllhalt; Pl'í,PJIl"l!'hospbllt; Al'RT, adq:h:epho&jlhori!iosyllrallsfctasl:; Ol'll:l'. orolatc~llOrilmyJ 1raIlsfenm:;1Kif'1t1',.ll}poxmllhine-~phalpbQrílmyl..--r..r-;Xl'Itt. ~ p~y1Ira1lsiC:tasl:

• ('~s: ~ 1\01.; +)$.1647l-9'156; f;!x;+S5'J6473.98&1.

e.•••"aadtI_" tl,ic~f;Se., •••.bt(PlL ~).I nw ••• ú!I:Qr~COll~ éCjlWI)' ro Ihú~.

lS7(j.9õ3íli$ • sceíiw1t _ () l(l()3l!~lI:.rB.V.AIl righIÜ~.dl>i:IO.l(Jllí1.~p~3.09.oo3

2.4.2.22) [21. 111CdiJlere»ces in purÍlle llucleotide metaM-lism betwcen the llllllnmalilUl hoo and tllc prorowan para-sites have stimulated considereble interesr in lhe 5ldvagcplllhway as a potentíal !arge! for ehcmotherapy (forreview,see Ref. [2]).

Leishmanta tareutolae, n.j)fl1uíte or th~ gecko IiZlll'ds,hes been exploited by OUf as well as other Iaborarories as amodel trypanosomarid for a variety oI 1U01eculat, bioclwm-li:al and evoluuonary swdies. Several l'RTases have beencl~ from dItIeront organisms. Howcver. ooly IhrecAPRT enzymes have been crystallized IUId had tllCtt $Il'Uê-ture determined: (i)tbo Leishmama dOllovani Al'ln' inCCII!lf'!CX wlth three dillerouí ligtmd~,. ooenllíc, AMP au)dcírrate-suífare í011S [3}; (ti) lhe SocchnlTmlJ1Ces cerel'isiaeAl'RT, in two forms, one wíthou; au)' IigiUld tuld analtenlative (onu wílh li su!fate ion ínthe tlCÚve sUe (41and (iií) the Giardta lamblia Al'RT in complex. with either9..<Jeazaadenillc píus sulfuteor wilh MgZt_phosphóribOsyi-pyrophospblrtc (5).

Thek:tIOWll PRTnse.stl1.u::tuIés fall infO two groups .. TI1C'ty!>c I' PRTnscs are idelltitied by li CCltlSM'CÓ PRPP bíndingmotif whích features fwo adjllCCllt acidic residues sur-l'Owlded by one or more hydropbobic rcsídue [li}. ThesePRlàseS reveal 11 CQ~ «!~foldanhePRl1> motifandafíexible loop, besides a core regiollOflrt le{j$ttive. pa.rallel.~

22

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Articles

Biochemistry 2004, 4.5. 7663"" 7671 7663

Thrce-Dimcnsional Structure 01' Human Adenine Phosphoribosyltransfcrase and ItsRelation to Dl-l/v-Urolithiasisl-'

Mareio Silva}.!; Ca rios Hennque Tormch de Paula Sílv<I,§/'·l Jorge lulek." and Otavro Hennque Thlem3nn"'~

Laboratory ofProtem Crysta{/qg,'al'hy and SII'Ué·llll'á/lJi()log)'. Ph}"iCS Instttute óf Sào Carlos. U,,"~~·.'llyOfS",) Pau/o.AI!. Trabalhador Sõocarlense 400. P/> 80x 369, 13566·590 Siio Certos; SI'. 81''';11, and Departmem ofChcJ/1í.<try,

l:Ilol".'h,w/{'gy Center. Suue U"it·ersit., of Ponta 0,.0$;"" PR .. Bruzt!

n""'''ÍI'"d NN"nnbe,. /9, 1003; n,,'fts.,J .Ham,seríp! nec"h·.,J AJwd 14, 200./

A8~'TRAcr. ln mammals, adenine phosphoribosyhransferase (APRI. r~ 2,42,7) is present in ali tissuesand provides lhe only known rnechsnism for lhe metabclic salvage of adenine resulting Irom lhe polyarninebiosyrnhesis pathway or from dietary sources. In humans, APR,T dcficiency results in serious kidneyillness such as nephrolitluasis. interstiunl nephritis, and chronlc renal failure as a result of 2.8-dihydroxyadenine (DHA) precipitation in lhe renal interstitium. To address lhe molecular besis ofDHA-urolirhiasis, the recombinant human APRTwas crystallized in complex wíth adenosinc 5'-mollophospoote(A.\.fP). Refinement 01' Xsray diffraction data extended to 2.1 Á resolution led to a final crystallcgraphic&><1'" of 13.3% aOOan Rr,,,, of 17.6%. '11IÍs structure L'!composed of nine J}-strands and six n-helices, andthe acuve sue pocket opens slíghtly w accommodate lhe Alv1P product, The core 01' APN.T 18 similar tothat 01'othcr phosphoribosyhransferases (l'RTases), although lhe adenine-binding domam is quite diffcrentStructural cornparisons between the human APRT and other "type I" Pk'Iases of known siructure revealedseveral important Ieatures oí'the biochemistry ofPk'Iases. We propose íhat lhe residues located 111 posiuonscorresponding to Leu 159 and Ala 131 in hAPRT are rcsponsible for the base specificitics ar typc I PRTllSCS.111e compararive analysis shown here also provides structural information for lhe mechanism by whichmutations in lhe hurnan APRT lead to Dl+Avuroluhiasis.

Usuallv, adenine is deteeted at low levels ín blood andurine duê to APRT activity (1, 2). lu mammals, adeninephosphoribosyltrnnsferase (APRT)I is prcsent in all tissuesand provides lhe only known mechanism for lhe metabolicsalvage of adcninc resulting fram lhe polyam me biosynthesispalhway or from dietary sources (3 - 5)" Two tyres af

t 11W: work Wll$ iIlJ'p..>Ii,-"l ia J>8I1 by ("JlaIlI 99102814-9 (FAPIlSP')liIod "",'t'ived fi'''lIldi.d '''.1'1_ f")II! lhe UNOPíWOtId llwtk.'WHOSpecial Prov-.lmme ror R_ar~h and Tt1Ú1IÍJl8in TropiCál Dí~Il'.ut.{TDR) (10 Q,KT.). MS. and CH.T.d.P.s. aro FAPESP fuU""Wúptl,,-ard~. This wQd: has bcen plll1illlJy IUpported by lhe NationalS}"ehrott •.••' t.íghILMbood"')· (LNLS). BmjJ, ~I 123.710'2, forilw data ccll«lioo aI lhe Protda C.ryót3Uograpby Beamline,

1Coordinat"" f()l lhe hllln"" APIIT X-tllY $ll'uctlllc 118\''' bccnMI"""led ú. jhe PI'<>I~1ftDa~, Baul: <"lIby 1ORg),

• To wlwm I;m,,~~ld",W .bould be addremd l'IUJlI(!;(55-16)273·8089, Fax: (55-16) m·9SSLE-r1JIIiI: lhíCUHlllll@if-'C.!l$p.lv.

t U"jv\'!t'I'Íty ,'>I' São Paull,)."11,_ lmUIOl'Jconltibuted equ<llI)'to \lu, work.10Urel1l adm-: $cl\ooI ofl'harm_liool SOÍ(1_ of Ribeirà o

Preto, Unlwuíll. ofSiíl Paulo, Av. de>C..afé,VII, 14tt40-903 RibcirílóP"''1ô, SP. Brazil.

• S late Uní\'!mÍiY of Ponta Or,,"$4.'Abbre\-laIiOlIil: AI'RT, odoI,ulj' 1~lO$Jlborih<Myll.r_ferl!i<e;Pltr""",

plwphtYilx'$j1Imnsf«aBe; hAPRT. human adeJlioo phO$pholihofyt·1ran$f~ lPTG, j$l.'lJllX'P}1 P·I.l-Hbi~ctopycanOOde; 3D, tlm.'e-dim."sia\l\l; AMP, .'OIIt"cm, ••q>t,,',;phate; Tm, 1l:is(l~)'JIIt'lhy1)-atnlnomethane; SOS -PAGE, mum dod«yl rulfate-pol)'lI(f)'bmidegcl clcctrophocciis; PRPP. pllooIphoribQ$ylpyrophospluttc; PP, 1'>,,1,"1-p!límphah •.

deficiencies are curreruly recogmzed in humans, both dueto mutations in the APRT gene. T~l)C I deficiency is lheresult of a complete loss of APRT activity (5)., whereas intype D dcficiency, APRI has fi rcdueed affinity for PPRP,Jeading to li ll)-fo/d increasc in lhe K", for Ihi$ substrntil (6).Both types 01' dcficicncy resuh in lhe accumulatíon ofadenine, which is then oxidized by xanthine dehydrogenase(XDH. EC L2.3.2) to 2.8-dihydro~')'adenine (ORA), via an8.hydro.,yadenlne intennediate (7). DHA either is eliminatedthrough lhe urine or, in largc amounts, cen precipitate in lhelddn..}' tubulcs due to its 10\1/ solubility, resultillg in 2,8-. díhydro.xyadenine stones aOO urolithíasis (8). The majorclinical manifestntions associated wíth APRI deficiency-rclated kidney diseases are thc appearance ar kidney 510nO$,crystalluria, bematuria, dysuria, and infections in lhe unnarytraet (8). Such 11 clínica I profile can resuh in severe kidneyfaílure.

PbosPtoribosyhl'llllSferascs (PRTases) caralyze lhe dis-placéltlent of a PRPP (l·1 '-pyrophosphate lhrouz,h linítrogell-containing nucleophile. The reaction produets are a /l-1-substituted ribose 5'.phoophate and a free pyrophosphate (PP)(9). Thc nuclcophile \Qr mos! PRTa~ is 11 nucleetide base,while lhe product is II nucleoside 5'-mon~,phol.-phate. lheproposed oocleopbilic llttack by thcpunne \.'l( pyrimidíne baseai lhe PRPP ribose Cl' atom involves a sequential proccss

10, 102Vbí0360758 CCC; $21.50 (> 1004 Ameríean Chenúcal SocietyPobliahed on Web 0512512004

31

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

EL'5EVIER fI.oehimio .1 BiophyoÍ<:O ActA J 59&(1002) l 9

Short seqoonce-paper

Cloning, characterization and preliminary crystallographic analysis ofLeishmania hypoxanthine -guanine phosphoribosyltransferase

Paulo S. Monzani ", Juan D. AJfoIlZO b, Larry Sirnpson b. Glaucius Oliva li, Otavio H. Thiemann 11.*

'Lilboral1»Y of PmMIt CY)$tãlk>gr""J,y ami SmMUTiJ! 81ol4gy. Ph)$ítS lll$tlhil., ef Siió Carios, If"r.·trsity of S.i" P",,/(} Usp'A", 1lub<,lhador SJ"""rkt ••" 41)(). 1'>566.,90. São C•• ríos "'Si'. TlnniJ

~lI(J••.anJ il1Igh", J>kJü:aí111$11''''/0$.}.b~1J JluiúlÚlg. 9i)()9J·J66::. VCU. L"$ Angel.:!>. (Ji. t:~Received li NoV<'lllbct 2001; at«pl<d 4 FcbruaJy 2002

Abstnct

H)'flOxanthioe gllaninc plmspboribosyltt:lI",fem"" (lIGPRT) (EC 2.4.2.8) is an ímpot1llnt enzyme ín\'olved ín the r.,cycliog 01' puno"aucleotídes in ali cells, PafllSitic protozoa of lhe order IGtleWpbslida are IUlable lU synth<:$iu purínes de 1IOVOlUld U5e lhe salvsge pathwayfor lhe SYlltl",,,,1sof nucleOOdes; dlCrcíO«'. this pathway is an IIttr.tCIlve tar!l.\-'1 for lIutiparasitic drug <ksIgJl. 111\:hgpr/ gaJc was clollcd liom aU,;slunani"larenldlaegenomic bm-ary 30.1 lhe ""'l""nce de1e"lI'Iiucd. Tbe L: ,_«,Ia ••hgpi'l se ••e UM'!.";"" a 633 ,,,,,deolíde openreadingfiante lhat eecodes a 23,4-kDu proteín. A pairnise aliguruent oftbe diftCt\mt HGPRT's $CQUMCeSrevealed a 26% 53%:sequence ldentity\\'ilh thc úish",,,,lia sC'luenca lUld 87% idcntity to lhe HGPKr of Leishmaília donavanl. A rCAXlltlhinant protein '-"'aS expresscd in&cJterichia colí, puriticd to hOlDogellcity and iound to retain enzymlltÍc acti\'ít)'. Tbe rtcltd}'·state kineuc paratnel(.'t$ were do;,tcnllÍllcd for U",reccmbinant enzyme and lhe enzyme is aetive as a bomodin~ in soluUoll. Sing1e cl)'$tals were obtllined for thc J~ tare1l1al{tlt HOPRTrepresentiog lhe fim LelshmanJa HGPRT Cl)'$taUizeJ and initial crystlll~phic data ~'Ue collecsed, lpe et)'$t:als obtained belong to theorlhomombic$p3ce groul'(P212121)\\'Íth unit«lJ p~a"58.104 A,b ••S5.443 A and <:=87.398 A and díllractto a n:solution 00.3Á. lhe nvailability (li thc HGJ>RT enzyrne 110m [-e/s/Ul/anJo and ilS Cl)'$taUkatinn suitable for X-ray díffraction data collection sbouldprovide lhe basis for a fUlIClíolllll and sl:tUCluraJ analysls ar dÚ$ et12)'uIC, ""bieh has b..'CI1 proposed as a potcutiaJ brgct for rational drugdesign, in a Leishmani« Inod<:l,;ys! em, Q 2002 Elscviec Sci<._ a.v. AlI rigbts reserved,

Most organisrus ~)'nthesize purine nucleoudes by bothlhe de novo and lhe sal vage pathways, 111coutrast, proto-zoan parasites are strict puríne nucleotide auxotrcphsbecause of lhe absence of a purine de novo hiosynlhcticpathway [I]. Enzymes of lhe phosphoribosyltransferase(PRTíUiC)Canul)' eatalyze the biosymhesis of'purine nucleo-lides. Three PRTase enzymcs ar-e known 10 be involved inlbe recyclíng of puríne nucleolides lIy lhe s..1lvage pathwayín lhe Idnetoplastld protozoa fi'om lhe geaus Leishmanía,hypoxanlhinc-guaniue PRTasc (HOPRT) (EC 2.4.2.8),ooclllnePRTII&e (APR1) (EC 2.4.t. 7) and xanthine PR:1àse(xpRT) (EC 2.4.222) (2). HOPRT is responsible for cata.tyzing the conversicn of guaníne and hypoxallthine and «-J)-S-pho$phoribosyl í-pyrophosphate (PRPP) imo guaninl>-5-monopbosphate (GMP), ínosinc-â-rmmophosphere and

• ('~1"'ndilli'l''''tMt, TeI.:.•55.1(>-213-9751>; llIx: 455·1f,..173-98i1.e4J;(l11 ~"~M@~f"",.1lOp.br (O.1I. Thiemo.m),

GI67-4S)$I()2!S· _ JiOIlImall~t e lOOl m-ier S~ D.V. AlI ri$bls ••••••••••«l.l'll: Só 167-4S3~(Ol)U0334·S

p)'J'ophQsphate (pPi) [~J, The only hgprt gene that has bcencloned aad cliaraeterized from the Leishmania genus is thatfrOOl 'Leishmania donovani [4J and no strucmral data are.Imown for tI\C Cltl.yme of this l)lU1ISitcgenus. Tbe avail-abUity oime 1JypaItQse»na CYIlEI UOPRT saucture [5] is ofgreat comparatíve ímportance and wiU be used for themolecular suhstitutí<m approach.

Leishmania taremolae bas been exploüed as li modelLeishmania for a varíety oC moJecular, bíochemlcal andcvolutiollary studies. TI\C cvolutionary data support theínclusíon of L. taremolae as 11 monophyletic cíade branchingbetween lhe Vitlll1lia aud Leishmallia SIIbgenem {6- 8], Asin fhe case. or otber ttypanosomatids, L. tarentolae ís lipuríne nuc)cotidc auxctropb {9]. The case of cell culture andgenetic annlysis of L. taralliQkJe shoeld facilitatc its \1..'«: forsite-directed mutagenests of' lhe hgpri gene as well as forfunctiol\a! complementation and testlng af inhibilory sub-stratcs for lhe tationa! drug ~ign fur futuro lcisbmaníasischemotherapy; We deseribe Jn this plljlCt lhe cloning,

40

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Bíochemícal and structural cha racterizatíon of Leishmanla major Friedling

xanthíne phosphoríbosyltransferasc

Marcelo S. Castilho. Alexandre S. Araújo, Glaucius Oliva and Otavio H. Thíemann ,.

Laboratory of Protein Crystallography and Structural Bíology. Physícs Institute of São canos,

Uníversity of São Paulo - USP, Av. Trabalhador Sãocarlense 400, PO Box: 369, 13566-590,

São Cartos - SP, Brazil.

• Corresponding author: Tel.: (55-16) 3373-9756; FAX: (55-16) 3373-9881; E-maU:

thiemann@íf.sc.usp.br

Keywords: LeishmaniB major, XPRT. xanthine phosphoribosyltransferase, homology

modeling.

1

47

Protozoan parasites of the order Kinetoplastida, as well as severa I known protozoa, are stríct

purine nucleotide auxotrophs (1], lacking the entire de novo purine synthesis pathway and relying on

the host and the recycling by the salvage pathway for lhe required purine nucleolides. In contrasto

most organisms synthesize purine nucleotídes by both the de novo and the salvage pathways. In the

kínetoplastíds three PRTase are known to be involved ín lhe recycling of puríne nucleotídes;

hypoxanthine-guanine PRTase (HGPRT) (EC 2.4.2.8), adenine PRTase (APRT) (EC 2.4.2.7) and

xanthíne PRTase (XPRT) (EC 2.4.2.22) (2]. XPRT is responsible for catalyzing the conversion of

xanthine and o.-D-S-phosphoribosyl 1-pyrophosphate (PRPP) into xanthine-S-monophosphate (XMP)

and pyrophosphate (PPí) by the anomeric inversion of the ribofuranose ring [3]. Kinetic analysis of

Leishmania donovani XPRT revealed that this enzyme preferentíally phosphoribosylated xanthine but

could also recognize hypoxanthine and guanine [4] as substrates. The structural explanation for such

selectivity remams unclear, since the only structural ínformation available comes trom E. coli XGPRT

crystallographic structure. In that structure. the substrate specific interaction with Glulle and ASpl40

resídues through a water molecuíe, could bê responsible for guanine > xanthine » hlpoxantine

selectivity (5; 6].

In a broad project to design Leishmania specífic inhibítOrs. we have cloned the xprt gene trem L major

Friedling based on the sequence identifted in lhe Leishmania genome effort. We overexpressed the

recombinant enzyme to homogeneity in a heterologous expression system of Escherichia coIi. The

access to the recombinant protein aRows the kinetic characterization of the recombinant enzyme and

opens the possibility of às use ín the seareh for novel PRTases inhibitors, as well as the molecular

understanding of base selectívity of each PRTase. To advance our understanding on these essential

enzymes a structural model based on homology principies was built. According to molecular dynamics

protocols thís model is stable and ean correctly account for the XPRT topology.

The L major xptt gane was amplifled by PCR (Polymerase Chaln Reaction) trom genomic DNA with

olígodeoxyribonucleotides primers specitic for the 5' and 3' ends of the known L. major xprt $Iene. The

primers for PCR amplification introduce a Nde I and a Xho I restriction site at the highlighted positions

(5' TAGCTACATATGCTACCAACCCACATG - Nde I; 5'TCTCGAGTCAGAGCTIGGCAGGATAAC

GGG 3' - Xho I). The xprt DNA fragment was ck>ned into the expressíon vector pET-29a (Novagen) at

the Nde IIXho I sites and transformed into E. co/i Bl21 (DE3) competent ceUs by standard protocols

[7]The amplified xptt DNA contained an cpen reading frame C/f726 base pairs that encodes for a protein

of 241 amino acids wlth sequênce ldentity to other XPRTases. Alignment of L. major XPRT with other

sequences highlights the conserved purine and PRPP binding domains (fig1) [8]. The predicted amino

acíd sequence of L. major XPRT shares 87% ldentity with the L. donovan; XPRT [4] and sequence

divergence is mostly concentrated at the N- and C- términus regiC/ns.

2

48

The purification of recombinant XPRT was carried out at 4°C unless otherwise specified and using the

following steps: E..w/i cells were induced at an 0.0.600 of 0.8 with 0.5mM IPTG for 15h at 20°C in LB

media, and harvested by centrifugation (25000g for 15 min.). The cel! pellel was dissolved in 100 mM

Tris-HCI, 10 mM MgCI2. 1mM PMSF and 1mM \eupeptin. pH 7.5 (buffer A) and ceU Iysis was

achieved by ten 1-min cycles of sonication ln an ice bath. The crude extract was clariüed by

centrifugation (25OOOgfor 15 min.) and brought to 50% (wlv) ammonium sulfate for 25 min with slow

stirring. The suspension was separated by centrifugation (25000g for 15 min.) and the pellel was

dissolved in 5mL of buffer A and loaded in a 16-ml Phenyl-sepharose column. equilibrated in buffer A

+ 1M (NH.}~04 at 0.8 mllmin f1ux. XPRT eluted at O.7M (NH.hSO .•.The proteln fractlons were pulled,

desalted ín a 15mL Hytrap desalting column and loaded lnto a 1SmL Fast flow Q-sepharose. XPRT

eluted in the column void with only trace contaminants as revealed by commansie stained SDS-PAGE

(fig.2).

3

49

"""I., .•••. ,'\U'

1..d_ •.._1·"",<"011

---Nl,Í"Utuc Y-<';t'v':t:··-··Ml,f-~J1:';:C r.<J:P'1/!.<

.$i6f

L •••••}~c

".~"-E.có.U

1f.Z: _":""':"":_I ,l~~ •.• ",:"l~Ç., ~_~:~~t::_,_",.,l~"..l ..~r_"'"'.,~~tl

"·S., .• . • - - • . T_ ~---- ~ •. - . - '--: _.. •• •

":'$ • , . - .. --_._-- --. '.: ,:l1 ~~--_#_...~._- ';:;; t'l" '·I1JI···-H~U_"""'-~~#~ ~ (- - --:--~;tJt----~ ";1;.' - l:"~l .•

PRPI>~.'3_'" ,;';" ... :~".'.""':%.'''.l,,-..j0' H' '." -, _~_ "L.~".,..t H' ,', -, ...• E.C!i>lJ. lt4 _ ,W· r - -~'V :s: (l A~_-A ~A

....•r. .•• JorL.doaov •• l·C.~J.

Figuté 1· MuJlipli: alignments of I\,pt<""tlt~ti\'. XPRT sequences, 1M _mo aàd """UCtl<CS of _«ai XJ>Rl' prolcitl$ aré sho,vn alillhed ",tb lhe I•.

mqjor FricdlinJ: seqUé",,", 11.: ••••;"" acid pO$itro... 41'\: indiClIl"d ai the .id<-'$ .". lhe alignment 111<:shaded boxes Indi."... conscr""d mutaú"" (g""}) and

conllt:t'\·"d rcsid_ (bI~ck) and lhe pr«Iícl«l I'RI'!' bindi"l: .il< i. hígblighled in 11.: pktur." The wqw:n.:" '''<1 rc",~,,,"I. lhe sprt I""" cl<m.:d i•• 011I'

labor.llory. The """""n""" W~,.ClIIiS""d by Ih.: CU;STAl.X progfll1ll/9]

4

50

1 2 3 4 5

Purification Total Protein Specific Purification

step (m gIm I) Activity (U) fold

Lysis 217.8 8.01.10.4 O

(NH4hS04 138.5 1.2.10"3 1.4

Phenyl 51.0 1.9.10-3 1.5sepharose

Qsepharose 15.5 3.6.10.3 4.5

Figure 2- (upper penal) Expression of L. major Friedling XPRT in E. roli ano purification of 1he

recombinant protein .. The proteins were separated in a 15% SDS-PAGE gel. Lanes: 1-molecular

weigh marker. 2-darified extracts (S20000 supematant). 3-ammonium $\Jlfate precipitate fraclion.

4-pooled fraclions from Pheoyl sepharose HP. õ- pooled fraclions frem Q sapherose FF. (Iower

panel) Table of XPRT purification.

The kinetie parameters of L. majorXPRT were determined spectrophotometricaly at2Q4 nm as

described by Jardim et ai [4] at 25°C over a 30 seconds reaction. The Km Valué for xanthine and

guanine are símilarto those reported for L. donovani XPRT 7:1: 2IJM forxanthine and above 100 IJM

for guanine. The Km for hypoxanthine of 61 ± 26 11Mfor L. major XPRT differs by sEWen-fold to the Ldonovani XPRT 450 ± 97 11Mfor the same substrate. Such contrast in Km values ean be due to small

5

51

structure differences between the two enzymes. Unfortunately. the structure of nelther enzyme has

been determined at atomic resolution. This fact prompted us to model L major XPRT 3D structure

using T. cruzi HGPRT. another Type I PRTase (Poe code 1TC2) {10]. as a model (figure 3a). This

task was performed with the Modeller program [11].

Despite low sequence identíty among XPRTases, ali type I enzymes show a conserved folding

comprising 4-5 parallel (} sheets flanked by 3-4 (1 helix (12] which should be conserved belween the

tamplate (1TC2) and our homology based model. Ramachandran plots [13] and Verify-30 seores {14]

were used to evaluate the quality of the best 3 modele. Ali residues of our model are Iocated in

allowed regians. Verify-3D seeres for individual residues. with a stiding window of 21 residues. were

aboveO.2.

6

52

A B

Figure 3- The

panel shows

1TC2

aystallograp

hic structure

and the

XPRT

homology

cgenerated

mode! in

three

dífferent

confonnation

s. (a) 1TC2

secondary

structure is

presented as well as PRPP and alopurinol binding sites. (b) XPRT homology mode! generated by

MODELLER 6.0 program shows high topological similaríty to 1TC2. except for the first helix which has

not been modeted. (c) XPRT energy minimized structure show that hood domain loses most

secondary structure in the absence of ligands (during mínímízation and molecular dynamiCSstudies

only protein atoms were considered). although the PRPP binding domain is overall conserved. (d)

XPRT model after 200 pico seconds shows that the overall topology is stable.

Molecular dynamic simulations. using the GROMACS [15] package, were used to evaluate the

molecular stability of our rnodel. The model was relaxed through energy minimization using the

conjugate gradientalgoríthm, followed bya 100 pico seconds molecular dynamics at300K (27QC) in

vacuum.$ubsequently, 5260 water mo/ecules were added to the system resulting ina rectangular box

of 6.4 x 6.4 x4.5 nm.An energY minimization was performed using the conjugate gradient a1gorithm

and then a molecular dynamics símuíatlon was carried on at300K (27°C) and 1 atm for 200 pico

7

53

seconds. A time step of 1 fento second and perlodic boundary condltions were appílad in ali

simulations. The long-range coulomb interactions were computed using the PME (ParticJe Mesh

Ewald) [16] algorithm and for short-range coulomb and Van der Waals interactions a cut-off of 2.0 nm

was used, For temperature and pressure coupling we used lhe Berendsen algorithms [17]. The overall

three-dimensional structure of the model did not changed signifícantly through out the molecular

dynamics simulation. For a matter of comparison. the initial and final structures are depicted in figure

3b.

From tha superposition of 1TC2 on our homology mcdel, It can be seen that when the puríne

substrate ís located in the binding site it shall interact with residues Va1121.LYSI52.Tyr174.lIe175and

Glu1Bt. It is hypothesized that Tyrm and Va1121encase the purine ring while the other residues are

involved in hydrogen bond interactions.

In facto XPRT purine bínding site model differs trom the template HGPRT onlyin residues

Valj21. Tyr174,Phel80. GIUj81(lIeI13. Pheuw, Leu170.ASP171respectively). Therefore we hypothesize that

these residues must be responsible for xanthíne. over hypoxanthine selectivity. As previously

described {18]. severat subtle structural differences contribute to the efficient use of xanthioo over

other substrates. Indeed greater xanthine selectivity may not be attributed to just one or a few

particular amino acíds, sínce substrate posltionlng in the active site may play an important role ln lhis

subject. For instance, ín the human HGPRT [19,20J. guanine binds through a hydrogen bond between

NH2 and the main chain oxygen of resídue Asp2O$,while xanthine binds through a hydrogen bond

betweeo carbonyl oxygen and ASP206maio chain NH. revealing that selectMty is due to substrate shift

inside lhe purlne blnding site.

Although an entire understanding of substrate selectivíty would require a complete structural

analysis, 11is well eslablished lhat some of the described mutations are related to xanthine selectivity.

Just to name 000, as described for Tritrichomonas foetus HGPRT [21], Tyrm hydrogen bonds to

GIUle" repositioning the maio chain NH to interact with xanthine. It must be said though that thera ís

some evidence that this interaction is not critica 1to xanthine use. First. humano Trypanosoma cruzi,and Plasmodium falciparum HGPRT have phenylalarÍine at thls position, yet P. faJciparum HGPRT tsable to use xanthine effectively. Second. the Trp199Phe mutant of T. gondii HGPRT has robust

xanthine PRTase activity [22].

Folfowing the same superposition strategy, the PRPP binding site, whose residues are quite

conserved 10 type I PRTases. can be easlly identlfied ln our model (LVSw. GIY80,Tyr8$. ASPI2:1.Serl24,

Arg187).The cisgeornetry between Leuse-LysS9.also found in the structures of T. cruzi HGPRT [1023],T. foefus HGPRT [21}, and E. coli XGPRT [5,6] ís observed in our constructíen. In this conformation,

Cys NH would hydrogen bond to the pyrophosphate moiély and pos~ion GIY60to hydrogen bond to the

8

54

pyrophosphate (as observed ln the other structures). These Interaclions would not be possible had

Leuss-Lys59a trans peptide bond.

Despite molecular dynamic simulalions did no! affect the XPRT model overall folding, the

seeondary structure from the hood domain was not conserved during ali slmuíation interval. This result

sU9gests that substrate binding might influence XPRT cerrect tolding once simulation mímics an apo-

enzyme. In fact, preliminary crystallographic sludies show thal upon concentration XPRT precipitates.

unless in the presenca 01 xanthine. Olherwise, the Ioss of secondary structure in the hood domam

might be a reflex of great f1exibility in this region.

The PRPP binding domain seems to be more stable In the absence of the substrate and was

observed through out the molecular dynamics protocol.

In conclusion, lhe overaU homology model represents a reasonable description of XPRT three-

dlmensional structure, which has already baen used to ratlonalíze the binding of XPRT inhibitors

identified in our laboratory.

Acknowledgment

This work was supported in part by a research grant 99/02874-9 to O. H. Thiemann end 98/14138-2 to

G. Otiva (FAPESP). MSC and ASA received a scholarship frem FAPESP. We would like to thank the

members of the Protein Crystallography and Structural Biology Group (IFSC-USP) for helpful

discussions In lhe course ofthiswork.

9

55

I F S ( U S P SERViÇO DE BIB~IOTECf.• INFORMACAO

References

[1]. Berens, R. L., E. C. Krug, and J. J. Marr. (1995) Purine and pyrimidine metaholism. J. J. Marr and !\L

Mullcr (cd.), Biochemistry of Parasitic Organisms and its Molccular Foundations. Acadcmic Press,

London

[2]. Ullman, B, and D. Carter. (1997) Molecular aod Biochemical Studies 00 the Hypoxanthine-guanine

Phosphoribosyltransferases ofthe Pathogenic Haemonagellates.lnt. J. ParasitoL 27;203-213.

[3J. Musick. W.D. (1981) 5tructural features of the phosphoribosyltransferases and their relationship to

the humao déflciéncy dlsorders of puríne and pyrimldiOé metabcüsm. CRC Crit.RéV.Blochem.

11,1-34

[4J. Jardim, A., Bérgeson, S. E .• Shih, S., Carter. N., Lucas, R. W., Merlin, G. Mylaer, P. J., Stuart. K"

unman, B. (1999) Xantine PhosphoribosiHranferase from Leishmaní donovaní- Molecular

cloníng, bíochemícal characterization and Genetic analysis. J. Biological Chem. 274: 34403-

34410

[5J, Vos, 5., de Jersey, J., and Martin, J. l. (1997) Biochemistry 36, 4125-4134.

(6]. Vos, S.; Parry, R. J.; Duros, M. R.; Jersey, J.~Martin J. L. (1998) Structures of'free and complexed fonns ot'Escherichia coli x3l1thinc-guanine phosphoribosyltran.,fcrasc. J. MoI. Biol., 282, 875-889

(7]. Sambrook, J., Russel, D. W. (2001) Molecular cloning: a laboratory manual 3,dedition

[a]. Hershey. H. V. & Taylor, M. W. (1986) Nucleotide sequence and deduced amino acíd sequence of

Escherichia coü adenine phosphoribosyltransferase and comparíson with other analogous

enzymes. Gene. 43,287t293.[9]. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougln, F. and Higglns, D.G. (1997) The

CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by

quality analysis tools. Nucleic.Acids.Res. 25, 4876-4882.

[10]. Focia. P. J .•Craig 11I. 5. P., Eakin, A. (1998) Approachíng fue transition state in the crystal

structure of phosphoribosyltransferase. Biochem .• 37,1712Q..17127

[11]. Sali, AJ., Blundell, T. L. (1993) Comparative proteio modelling by satisfactioo of spatial

restralots. J. Moi. Biol., 234. rrs.[12]. Guddat LW. Vos 5. Martin JL, Keough DT, De Jersey J.• (2002) Crystal structures of free, IMP-.

and GMP-bound EscherichiB coIi hypoxanthine phosphoribosyltransferase. Protein science, 11

(7), 1626-1638

[13]. Laskowski, R.A.; Mac Arthur, MW.; Moss. D.5.; Thomton, J.M. (1992). Procheck version 2.

[14]. VRIEND, G. (1990). WHAT IF usar manual

[15]. Undahl, E.; Hess, B.; van der Spoel. D. (2001) GROMACS 3.0: A package for molecular

simulation and trajectory analysis; J. MoI. Mod., 7, 306.

10

56

[16]. Darden, T., Yorl<, O., Pedersen, L. (1993) Particle mesh Ewald: An N-log(N) method for Ewald

sums in large systems. J. Chem. Phys. 98,10089-10092

[17]. Berendsen. H. J. C., Postma, J. P. M., DiNola, A., Haak, J. R. (1984) Molecular dynamics with

coupling to an external bath. J. Chem. Phys. 81.3684-3690.

(18]. Heroux, A., White, E. L., Ross, I. J., Borhant, D. W. (1999) Crystal Structures of the

Toxoplasma gondii Hypoxanthine-Guanine Phosphoribosyltransferase-GMP and -IMP

Complexes: Comparison of Purine Binding Interaclions with the XMP Complex. Biochem ..

38, 14485-14494

(19]. Eads, J. C., Scapin. G., Xu, Y., and Sachettini, J. C. (1994) The crystal structure of human

hypoxanthine-guanine phosphoribosyltransferase with boung GMP. Ceu 78, 325-334.

[20]. Shi. W. X .• U. C, M .. Tyler, P. C .. Furneaux. R H,; Grubmeyer, C., Schramm, V. L., and Almo, S.

C. (1999) The 2.0 angstrom structure of human hypoxanthineguanine

phosphoribosyltransferasa in eompíex with a transition-state analog inhibitor. Nat. Strucl. Biol.

6.588-593.

[21]. Somoza, J. R, Chin. M. S., Focía, P. J .. Wang, C. C., and Fletterick, R. J. (1996) Crystal

structure of the hypoxanthine-guanine-xanthine phosphoribosyltransferase from the protozoan

parasita Trifrichomonas foefus Biochemistry 35, 7032-7040.[22]. White, E. L., Ross, L. J., Davls, R. L., He'roux, A., and 6orhani, D. W. (2000) The two

Toxoplasma gondií hypoxanthine-guanine phosphoribosyltransferase isozymes torm

heterotetramers J. 8io!. Chem., 275 (25), 19218-19223

[23]. Focia. P. J .. Craig. S. P., 11I,Nieves-Alicea. R. Fletterick. R. J., and Eakin. A. E. (1998) A 1.4

angstrom crystal structure for the hypoxanthine phosphoribosyliransferase of Trypanosoma

cnm Biochem., 37. 15066-15075.

11

57

Capitulo 111

3.1- Via glicolítica

o metabolismo celular para todos os seres vivos utiliza praticamente as

mesmas enzimas distribuídas em algumas sequênciasde reaçõesbem conhecidas

denominadas vias metabólicas. Essas vias metabólicas são responsáveis pela

manutenção da homeostase do organismo. A via glicolítica (Figura 5), por

exemplo, é responsável pela transformação de glicose em compostos cada vez

mais simples

glicolise

glucrn;e I.-(lh"'f'hate

V-NAOP+ + H.O

~~,11l+

"-poosphoghlCOllOlackllle

• ",O6-JIhosrtbõgluconate

fN

AOP+

NAOPH+ H +

eu,nbulose 5-pbosphate

Itf""v..

nlulo" ( rilx"" I 15-pl~teX5-phosphatc

scdoheptutosc gI)'C",aldchydo

7~ate X 3-phosphate

glyceraldeh)'de.. dihydroxyacetone y <rythr~ v: (li"UCtose 1Via das pentoses (não-oxidativa)3-(lhosphate phospbaIe 4-phosrhate 6-phosphate

I. +r 1.7-P,

~ ><XIoIk.1'Iulooe 7-j1hosp/ta1c

glucosc IJ-f'hosphato

1~(;6J>isoF.nerasefructose 6-foI1Osphale 1

Via das pentoses (oxidativa)

fructose I/~kphosphate

J

Figura 5: Esquema representativo da glicólise da via das pentoses em tripanosomatideos. A

enzima glicose-6-fosfato isomerase está indicada em vermelho. A via das pentoses fornece o

agente redutor NADPH e a ribose-S-fosfato, importantes no combate de agentes oxidantes e na

biosintese de ácidos nuclélcos (Figura adaptada de Hannaert et ai, 2003; [47])

58

e a concomitente formação de moléculas armazenadoras de energia, conhecidas

como ATP (adenosina-trifosfato) [45, 46]. Tais moleculas funcionam como

verdadeiras "moedas de energia" e são consumidas por enzimas em outras vias

metabólicas e demais processos fisiológicos, como por exemplo, a contração

muscular.

A via glicolítica pode ser divida em duas etapas (figura 5). A primeira,

conhecida como via de Embden-Meyerhof, é a fase anaeróbica na qual a glicose é

capturada do meio extracelular e degradada até piruvato gerando como resultado

líquido apenas duas moléculas de ATP; o piruvato (ou ácido pirúvico) pode ser

convertido em ácido lático ou a alguns derivados alcóolicos. A segunda fase da

glicólise ocorre nas mitocôndrias, depende de oxigênio (processo aeróbico) e é a

responsável pela produção de 36 moléculas de ATP (por molécula de piruvato).

Outra via crucial no metabolismo é a via das pentoses (Figura 6). Esta é

responsável pela produção da ribose-5-fosfato presente nos ácidos nucléicos e

concomitante produção de NADPH2 , coenzima necessária como agente redutor

-) em muitas reações metabólicas. A via tem como ponto de partida a glicose-6-!

fosfato e produz por descarboxilação as pentoses, açurcares de 5 carbonos. O

ciclo retoma a via Embden-Meyerhof" pela' produção de frutose-6-fosfato e

gliceraldeído-3-fosfato.

Juntamente com as Leishmania ssp, o Trypanosoma brucei e T. cruzi são

outros importantes protozoários parasitos humanos, transmitidos por insetos

hematófagos e causadores da doença do sono e doença de Chagas,

respectivamente. O T. brucei tem sido utilizado como modelo principal em

59

estudos de identificação e validação de potenciais alvos metabólicos para o

desenvolvimento de novas drogas. Trypanosoma e Leishmania são dois gêneros

da família Trypanosomatidea, ordem Kinetoplastida, são caracterizados pela

compartimentalização de parte do metabolismo energético em organelas tipo

peroxisomas, denominadas glicosomas [47].

IGllCOSEI

1 CATPAOP

A primeira etapa

IGlICOSE-6-P INAOP NAOPH2

~ 6-fosfogUcona 6-latona

na pesquisa e

1 21ácido 6- fosloglicónicor=-3 NAOPH2

kido 3-eetoglic6N<:o-6-Pt-C024 . Iribost-5-P I--,iblllosa-S-'

5~ c: tVia de -\ffUt()t'-6-P~IUfOst-5-P ~

EmbchttI- "do-htptufOst-7-P c.:gfice,.ldeido-3-P IMtyerhof -lgliç.,aldeid0-3-p 0fitOM-4-P~ fruto•• -6-P I

t I

desenvolvimento de

novas drogas

antiprotozoários é asinta••de identificação de enzimasnudeo-ldeo$

essenciais para a

sobrevivência ou

desenvolvimento dos

Figura 6: Via de formação da pentoses mostrando as enzimasparticipantes: (1) glicose-6-fosfato desidrogenase, (2)lactonase, (3)fosfogluconato desidrogenase, (4).: fosforribose-isomerase, (5) fosfopentose isomerase, (6 e 7) trancetolase e(8) transaldolase.

parasitos. A

disponibilidade de

seqüências gênicas

obtidas pelos principais projetos qenornas de parasitas permite a identificação de

enzimas e vias metabólicas exclusivas dos parasitos ou bioquimicamente

diferentes das de humanos [48]. A comparação bioquímica é a primeira evidência

para incluir uma via metabólica e suas enzimas na lista de possíveis alvos de

drogas antiprotozoários. Alguns exemplos de possíveis alvos identificados pela

análise comparativa do metabolismo de trypanosomtideos incluem (1) a via

60

glicolítica e via das pentoses, ambas apresentam os primeiros passos de reação

compartimentalizados no glicosoma, uma organela exclusiva dos parasitas; (2) o

metabolismo do composto NI-N8-bisglutationil espermidina (ou tripanotiona) pela

enzima tripanotiona redutase, o composto e enzima análogos em mamíferos são

a glutationa e a glutationa redutase; e (3) metabolismo de folato pela enzima

bifuncional dihidrofolato redutase-timidilato sintase que em mamíferos as funções

redutase e sintase estão associadas a cadeias separadas [49,48].

A etapa seguinte à identificação das vias promissoras é a validação genética

ou bioquímica das enzimas alvos. As duas principais ferramentas genéticas para

validação de possíveis alvos são o silenciamento gênico (gene knockout) e mais

recentemente o RNA de interferência (interference RNA, iRNA) [50]. Ambas as

técnicas visam à anulação por silenciamento ou a redução por interferência dos

níveis de expressão gênica [48]. A validação bioquímica requer o uso de

compostos químicos que interagem de maneira especifica e seletiva bloqueando

ou diminuindo a atividade das enzimas alvos. Esta é uma abordagem mais

) complexa, pois requer métodos experlrnentals para garantir a especificidade e!

seletividade in vivo dos compostos utlllzados [48]. Somente após as etapas de

identificação e validação é que se recomenda "um maior investimento na busca de

compostos líderes que atuem de maneira eficaz e seletiva no bloqueio da enzima

alvo.

A qllcóllse é uma importante, e em alguns casos, a única via metabólica

utilizada pelos tripamosomatideos para a obtenção de ATP. As primeiras sete, do

total de dez, enzimas da glicólise estão compartimentalizadas no interior do

61

glicosoma [45]. Uma conseqüência desta compartimentalização é que as enzimas

glicolíticas dos kinetoplastideos diferem em características cinéticas e estruturais

quando comparadas com as enzimas homólogas de mamíferos e o fluxo

metabólico da via é regulado de forma distinta. [45, 46]. Não apenas a glicólise é

localizada no interior dos glicosomas, mas também um parte significativa da via

das pentoses (Figura 6), que utiliza intermediários da glicólise para formação de

D-ribose-5-fosfato e NADPH, utilizados em processos de biosintese de

nucleotídeos e defesa contra stress oxidativo [46].

3.2- Glicose-6-fosfato isomerase

Glicose-6-fosfato isomerase (E.c. 5.3.1.9) - também conhecida como

fosfoglicose isomerase - é uma enzima intracelular que catalisa a reação

reversível entre a glicose-6-fosfato e a frutose-6-fosfato. Esta reação de

isomerização é uma etapa comum a via glicolítica, gliconeogênica e a via das

-j pentoses (Figura 5).

Em promastigotas de L. mexicana", 90% da atividade da PGI está localizada

"no citosol e o restante, menos de 10%, está associada aos glicosomas. Apesar

desta dupla localização, apenas uma cópia do gene correspondente a PGI foi

identificada e a atividade citosolica e glicosomal são bastante similares,

descartando assim a possibilidade de se tratar de isoenzimas com diferentes

localizações. A presença de enzimas glicolíticas tanto no citosol quanto no

glicosoma varia entre diferentes espécies de parasitas tripanosomatideos e pode

62

ser detectada para a maioria das enzimas desta via [51]. A PGI de T. brucei, T.

cruzi e L. mexicana apresentam menos de 50% de identidade com outras PGI's

de mamíferos e todas as três apresentam um fragmento N-terminal de

aproximadamente 50 aminoácidos que não apresenta identidade significativa com

nenhuma outra seqüência (ou fragmento) pesquisados em bancos de dados

públicos. A função deste fragmento é desconhecida e a hipótese que esteja

envolvido na sinalização para o transporte pela membrana do glicosoma ainda

precisa ser avaliada. Os resíduos catalíticos descritos nas estruturas de PGI de

coelho, de porco, humana e de Bacillus stearothermphilus são conservados nas

seqüências de trypanosomatídeos. Apesar da conservação dos resíduos

catalíticos, diferenças nos parâmetros cinéticos entre a PGI de L. mexicana e a

PGI humana foram observadas em condições experimentais idênticas levando a

necessidade de uma análise estrutural mais detalha das PGIs de parasitas e

humanos.

Do ponto de vista genético, experimentos de RNAi revelaram que a

() diminuição do nível de PGI na forma sançuínea de T. brucei resulta na inibição de!

crescimento de até 50% no primeiro dia e volta a normalidade daí em diante

(Figura 7). Essa recuperação do fenótlpo após os primeiros ciclos é um efeito

comum na forma sanguínea do T. brucei.

63

~ A~ ;' 11.!12 t 1/ !] 10'0 1. li' j~~ i!' I,

I.· .. /' AV· tl

I / / t! l /'j / ;-"'ií ,(_i' - :'L?il "r ,!l li

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4,5Days

• não-induzido

5.0 5.5 6.0 6.5 7.0 7.58.0

• selvagem • induzido

Figura 7: Representação gráfica do desenvolvimento de culturas da forma sanguínea de T. brucei

(Figura adaptada do site http://www.trypanofan.org)

o resultado dos experimentos de RNAi em T. brucei, juntamente com as

evidências bioquímicas, contribuem para a validação da PGI com potencial alvo

para o desenho de drogas anti-tripanosomatideos.

3.3- Trabalhos apresentados em;seguida

Apresento em seguida cinco artigos' relacionados com as enzimas da via

glicolítica, as glucose-6-fosfato isomerases (PGI) de humanos e Leishmania

mexicana mexicana e aenolase de Trypanosoma brucei. Os dois primeiros artigos

descrevem a clonagem, cristalização e a estrutura cristalográfica da PGI humana

na sua forma livre de ligantes no sitio ativo. A estrutura foi resolvida a 2.1Ã e

64

permitiu, pela comparação a outras PGls de mamíferos permitiu propor um

mecanismo para os primeiros passos catalíticos.

O terceiro e quarto artigos descrevem os trabalhos realizados com a PGI de L.

mexicana em colaboração com o Prof. Dr. Paul A. M. Michels (Research Unit for

Tropical Oiseases and Laboratory of Biochemistry, Christian de Ouve Institute of

Cellular Pathology, Bruxelas, Belgica). O terceiro artigo relata a cristalização e os

estudos com quatro inibidores fosforilados desenvolvidos pelo laboratório do Prof.

Dr. Laurent Salmon (Laboratoire de Chimie Bioorganique et Bioinorganique, Orsay

Cedex, França). O quarto artigo descreve a estrutura da PGI de L. mexicana e

características de seu sítio ativo em comparação com a estrutura da PGI humana

e de outros mamíferos.

O quinto artigo relata os resultados obtidos no estudo da enzima enolase de

Trypanosoma brucei onde tive uma pequena participação. Este trabalho descreve

a caracterização da enzima recombinante, sua cristalização e as observações

decorrentes da modelagem molecular por homologia com outras enolases

disponíveis.

1. Cordeiro A.T, Godoi P.H.C, Delborii L.F~ Oliva G, Thiemann O.H. Human

phosphog/ucose isomerase: expression, purification, crystallization and

preliminary crystallographic ana/ysis. Acta Crystallogr D Biol Crystallogr.

2001; 57(Pt 4):592-5.

65

2. Cordeiro A.T., Godoi P.H.C., Silva C.H.T.P., Garratt R.C., Oliva G.,

Thiemann O.H. Crystal structure of human phosphoglucose isomerase and

analysis of the initial catalytic steps. Biochim Biophys Acta. 2003, 1645

(2): 117-22.

3. Cordeiro A.T., Hardre R., Michels P.A., Salmon L., Delboni L.F., Thiemann

O.H. Leishmania mexicana mexicana glucose-6-phosphate isomerase:

crystallization, molecular-replacement solution and inhibition. Acta

Crystallogr D Biol Crystallogr. 2004; 60(Pt 5):915-9.

4. Cordeiro A.T., Michels P.A., Delboni L.F., Thiemann O.H. The crystal

structure of glucose-6-phosphate isomerase from Leishmania mexicana

reveals novel active site features. Eur J Biochem. 2004; 271(13):2765-72.

5. Hannaert V., Albert M.A., Rigden D.J., da Silva Giotto M.T., Thiemann O.

H., Garratt R.C., Van Roy J., Opperdoes F.R., Michels P.A. Kinetic

characterization, structure modelling studies and crystallization of

Trypanosoma brucei enolase. Eur J'Blochem, 2003;270(15):3205-13.

66I F S (. U S P SERViÇO DE BIB~IOTECA

INFORMAÇAO

A •.xa CtYl!OLJi!r~~H:ljhiç,. S...:~ÚOl' n8iologicalCrystallography15SN 09'J7 -444Y

Artur T. Cordeiro/ Paulo H. C.Godoj/,I> luis f. Oelboni/tGlaudus Oliva".J> and Otavio H.ThiemannA*

"1.olx",,,,,,,· <Jf Proreío C!)"1011'4(ôj>lly AOd

~t{\Ktuf"-' Bíólogy~ P"1\ysk-> 1!'I:$Vn.r:é (t." s.\.oCil~im. l1t.A.<fi:r-~tv .ufS;i1:i P.áu!t.t~ llSP'.Av, lrilbálhadt~ ~Adt-m~ .aoo. PC ai)o( .169.1.156 •. ·5'90 sa••.•C~l($- SP",8t.uil. alld

"CiittnÍjuy l~tiMt' ó!~ C*,ka . 11SPfA'Ii. TJ.uiha:h~ S.aoc,'i4;ti~.&OO. PC BtJ~ .l6iJ.13~6·>90 5.\"Cano<• sr. 6_il

t P.~1i~ .addtl/U~ Pl)A::i:fU'.:í •• Uniw-t;$~*Ci1tóli<:a d. I';;oçm do c.ld••. Me. s•••H,

(:llOOt Inte..JUlliooaIV", ••• d. Cty>1.1I1108'iiphl'Pdn.red h O#ftm.~_ .H~f~ ~

Human phosphoglucose isomerase: expression,purification, crystallization and preliminarycrystallographic analysis

íteceívoo 2 OC'-..Dbe-: 2.)00A.«epte-d \6 ,la1U3ty 20;) l

Phospboglucose isomerase (POI) i, the second enzyme in lhe&ly.;oly!lc pathwa)' and calal)'"". an atdosc-ketosc isomerizatloe.Outside lhe «U. }'GI hu bcCII found 10 fuaction aS both a cytokincand Ai • growlb tactOt. The hlWlan pgi ll<'nc was eíoned and lheexprcsscd cnzymc was puriâcd 10 bomogcncity_ Iscmcrphous Cl)'SIalswere obtaíned under IWOcondíuons anil hékmg 10 lhe 1'2.2.2, spacewoop. \VIlh unít-cell paramerers e» 8().37.b" 107.504.e" 270':;3 A. A94.7% complete dala ""I was obtained and precesscd 10 a Iintitiogrcsohuíon of 2.6 À. llH: asynwlcuic unit cOlltaills two hPOI dlnWrIacrording to dcnsíty calculauons, a seh-roration funcríon mal' sndmoíccntarreplaccment solutioo.

1. Inlroduction

PlmphogllléOSe Mllléfase (1'01; E.C. 5.3,1.9)ís a IUltltitul\ctÍOllal enzyme COIl11'0..,d ofhOModílllcn with molrcular masses rdngingfrom ltX) 10 12il I<D•. With rhe exeeption (,Isome intrecetlular para!ltes, POis are- involvedin the gJyrolytlc and glucooeogenesis p3lhwaysln mcst known organism.~ (Andersson 111 al.•1998). 1'OIs calalytA: lhe inlr:.ccUulac ísomer-ízation rea.:tiOll of o-gluoosc-.6-pbosphatc(061') 10 o--úuctose--<>1'hosphate (F6P). Theproposed Qtalytie mechanísm ÍIl\'olves severalolq>lll'ja lhé Iormatíon ai li a.-encdial Iater-Dl<:diatc. simil4r 10 tríose phospbate ísomerase,

The sequenee Wuilarity between PGli andIl<:urolffikin (NL; Faik a aL. 1988), autocríneOImility (""Ior (AMF; II &. Chittwiu, 20(0)snd diffenmtiation and ll1lltllfllion mediator(OMM; Xu te al.; 1996) indlC8t<:ti a broadcr rolef.". lhis CIIZ)l1lCin ccll {"nedon. Reeenr inves-rigation has sh<>wn the stlmularion of mouse(limoU!" ""Us' tlIOlilit)· and lhe enhancement aí

ncurite autgrowln ín prOflcnit= of D<urooalcelb by lhe addition o( Ba,-il11MI SW«fQo.

lIuffffloplúlu;'l'O! to thecnkure medium (SIUlet at, 1999).

The human hotnolt>gue hPOI and ;1$ 00·enz)tne$ bave been J1'ltliied ÍI"<>n1 severalússues with no particular tissue ~pt:clficily.bPOl has &<:<111 chtlfa~·tl:-rized by the anal;1Us oíbmnan gellétic dcíects atrecting the PBÍ gene(Xu & Beuder, 1994). Deteets ÍIl tbe hpgi lociare lhe eeuse ot mau)' autosomaí rc4'C$!IÍ\· •••

disordel1l sucll 3B haemotytic fIlIlICmia.

J:kp::nding (>ti lhe "'''''ril)' Qi rbel'Gl dcti·ciency, neonatal dearh ean occur fmm neero-logíu1 disordm.

Tbe Cl)'SIa(wgral'hlc Itructurcs of lhe rabblt,8odJ1l1$ and pig PGI enzynws bave beenprcvÍOll.ly reperred aI l"C&o1utmu. raJlgiJlgfl'ocn 2 ..3 10 6.0 À (Jetrery et a/~ 2000; Rsiao fft

aI., 1991; Mulrhead &. Sbaw, 1(14). Ahhoughlhe sequence lIinúlarity ot hpGI. c)'loldllC' and&rowfi fal:tOrll reveaí a broader cnzymc Iunc-non, 110ItruGtUl'aI data hu been obraíned forlhe hUllltl11~nzyme.The availability of a Cl)'Stalstructure of hl'Gl <:ould help clllcidJttc lheetlZ)'llle ulalylic mecllllJlí ••••• ,,4 íls substratcspedtidty. \Ve present here ti", fttst "1éCe!lSÍU!c:xpn:w.m. cry$taUitÁllioo a.nd l'reliminaryX ·ra)' charactrtir.llt;()I\ u( lhe '",,,,a,,POIent)llIe. Tbc data obtaíned íh<»\'S Ihat tbehPOI Olz}"llIe a)'Stallize& ín oondítions similar10 tbo$e of lhe rabbic homologue (Jeficry et i11~

2000).

2. Materiais and metMds

2.1. Human I'Glllxpre!lllicm, ""rüicoalion andchMa~1erizalion

TI,e. ""Ci gene "-&4 ampli1kd from li bUlllaJIbraín cDNA librA!)' (GlBOO·BRL) by lhepoIyn~t'a$C 'Min rcaet:loo (l'CR) bssed ou Ibeavaílable hlllllan l'Gl sequence (a(ÇCmon No.NM ..POO11S). Oligod~",xynueleatide prnucn;tor l'CR amplitlca!iOll (Qf.BCQ,BRL) Intro-duee botb NdeI lInd HíndUl Testrictioo sites aIlhe !I alld )' end, te$pCCt.ivdy (S' .AüA(lCl'.CCCUATGGCCO<..'TCfCACCCO<1GAC:3',,.,del; S'·AGcrAAGCITITATIOOACI'CT·ooccrOOCGC3'. lIill<UII) fQf cloning intolhe pEl"29a(+) CxprCssiOIl veetor (Novagell).111" l'CR rt3CIÍon, t<lIltainÍllg 2 pmol of eachprimer and AWroxim.4U:ly SO ng of lhe bUlMll

brlÓn cDNA. was eanitd out in a GeneAmp2400 Iher~Çl" (perkÍIt·E.l!.ner CETOS),"Ih 2.$ U af Amph"Thq DNA polymerase(Protnega) _di"g (O lhe manufllct •••.er'sÍIllItl'Urtiom. The sample \\1M subje«cd to2 nt.ín ~naturatioll lí! 3(jJ K (oJk;w«l by 30cydt$ o( dcn.t'lrlllion aI J67IC (íJ>[ OS mi••,aIlt>c.Dllg 81 313 IC101' OS mill" ••d "xlen.oon t<l

67

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

EL'iEVIER Iliooohimí<aet Riop")!,i ea Ado IM5 (2001) I P 122

Crystal structure of human phosphoglucose isomerase and analysisof the initial catalytic steps

A.T. Cordeiro", P.H.C. Godoi8,b. c.n.r.n Silva3, R.C. Garrau",G. Olivaa,l\ O.H. Thiemann" .•

'I."bomttll'). 0/ f'Nli!in CfY$tiJllogmphy muI S11lMw'aJ Bialngy. I'IU""cs .Instltlf'" qf Sfia C"r!(I$. U11il·",.<iI)· ()J Ma I'a,,/o-USP.Á\t rriJballutdlH' S'ã4ca;ridnsc 400. l!O. Bi1X J69, 1$566-590 SiíQ CiJrlos-Sl'. Bro::iJ

"CIt"",t",,,y 1=ltute of Sà<l (ÃJFÚ>'. Untwlf'$Ít)' of Mo l'á"Ú>-lJSP, Av. TrabdlhadlH' S1ú>t"'lkn$~ 4()O. 1',0. BIJI<369. 13566-590 São CarlàhW'; fI,a:/1

1("",,;...,.; 21 rebnuur 2002, reeeíved in ,",,,Atidli>nu 2 S"1'_r 2002; _q>Ied 2$ Sel'tenl\>••.2002

The seeond 1.'11Z}111" i" ti", g1y,,-olytic path ••••.•y,plt<::<>phoglu<:mi( mIK'nI" (pGl). ""talyll<.-:' IUl ílllra(,ellular aJdos.: 1.:.:10"" isomcrizatioll.II",e we describe ti", IIlUD'Ul n'C<IIl~,illalll PGl !,1n'clore (1iJ'(1I) wJvcd ill lhe ahsence of acti••e site ligarod$. CI)'Slals j""lIIlOfpholls to lho,",previously reported were used 10 eollect a 94% ()omplele data te! to a limiting resoRttion of 2.1 Â. From me comparison between lhe âeeactive site hPGl structure anel the availablc human and rabbít PGI (rl'GI) Slructurcs, a mechanism ror protcin initíal catalytic step$ Í$

proposed, Bínding or lhe pOOIIpbate moict)' of lhe wbstrale to two distind ekul\:1l1s or lhe setive sil\: às responsibtc for dtivíllg li series ofS1nlctllral chlmlll'S resnlting ín the poJarisation ar lhe aenve site histidine, priming it for lhe initial ríng~jng $ter of ClItJllysis.C 2002 Elsevier Science B.v AD rigbts reserved.

1. Iatrcduetioa

Phosphoglucose isomerase (FOI; EC5.3.1.9) is 11 cyto-solte cnzyme úlal cataíyses lhe iutercolwersion of o-glu-cose-6;)OOsI)11lI1C (GóP) and o-üuciosc-õ-phosphate (F6P~The intennediate has been eharacterised as a cis'.euediolatecompoend with lhe double bound between Ct and e2. Thereectíon ís reversíble and its directIDn is esscmlally drivenby lhe G6P and Ji6P concentratiens, rol partícípates tuglyeolysís, gluconeogenesls and the pemose phosphatepathwliy. Recently; extracellular functiOl:\$ of li neoroleukin[I], an autoerine motility fitctor [2] and 11 mataranon íilctOr[3] have also been assoclated with mammalinnPGI. Fur-themlOl'C, rol deficieucy has been ímplieated ín non-sphtr-

Âbb~: 001, phosphodl\l;(\s. ÍSOJllet1lSe; d'Ol. l30bil ~ho·dll..,.., OOl1l<:rllS.; 06P. 1I-s:lucosc.6-phosphatc; F6P. lI-l'ructosNi.pbos.pIl.úe; hl'Ol, licc .etl"" 5íIC Ibrm (lf·bumon p~hOlll_ ismnemse;6l'G, 6-phollpho'lI-gIUOOllllle

• eoa..p",idíllg auU"'t. 1.L *SSoJ6·273-80S9;Iàx: +55.16,213-9881.

1t_Il~. 1~~r4C.\l$f'.llf (Q.1J. 'll\lóm.mn).

IS7o.96391021$ • $ile frotu mal"'t O 2002 llhevic>t Scl<mçç O.V. AlI ri$hIi ~ck>~I().1()16lS157o.9G39(02)0()464.s

ocyüe haemolytíc anemia and lu other autosomal reeessivedisorders {4).

Snuctures of mammalian POis are represented in thePDa by human [5] and plg (to be published) strucrures bothwuh asulfate íon occupyíng lhe binding site ofthc substratephosphate, three rabbit POI structures (rPOI) in the form oí'lnhibitor bound complexes [6-8) and a rpm $lrUCtltte wlththe product, F6P, eomplexed to lhe acuve süe (9), thereforerepreseuting llgand-boon<i forms of ihe enzyme,

A meltistep çaUllytic meehanism has been proposed forlhe interconversion of 06P and V6P. lu 0I)e recent proposal,HistS8 ís responsible for performing lhe initial ring-openingstep by protonation of the G6P rins oxygen, aided b)' anapproptiately orÍct1tatcd \Valer molccule 01' llydrox;)'l 1011.Once the substrate is in its Iilwar fonu, the isomenzlltlollsteps are believed to take place in lhe same enzyme cavity,prillcipaUy by me aeidlbase lICtiOl1 ofOlu;lSl !1J. Desplte lheconsidcrablc progrcss madc ín 1WCIttye~s ill understaudillglhe struetural hasis (Ir catalysis, Iittlc i~known about lhemeehanism by whicll the aetive site assumes its catalyticallyactive confonnatíon. Thís has been due príncipally to tlteabscuce of a detaílcd descriptiOtl of thc ctlzyme ín itssubstrate frce formo

71

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Ai;""..1C'Yj.tllk~"'~-h.iCa S~ti<t~ o8iolugicalCrystilllugrdphy

Artur T. Cordeiro," RenaudHardré, b Paul A. M. Mkhels, e

laurent Salmon,b luis F.Oelbonid and Otavio H.Thiemann'"

·w~ ••!:)ry.~.Ji P~~ilt CtV.titllosr~t1» :p.u'Swt:h.v-;;i Bibl()gy; Ph~t:~ tl'tStiWlf..' ot MoC4ifkw. li!l~lio:'ty U:f u•.•ft..,fu, USPj

Av.lr ••••I~~...", se 400, P(J _lt.9,lJ,';;;,90 $ao c.,!<>1SP. ama, '1,.aIx>t.>IOi!í:de Cb:imÍ<t Bl()Q(''Pf\~e *1 BII)itJ,()(.ganr~,

CNRS-~-1J{811"., 1J\1í(r!\ro tk Ch~t?Moiéa;takê et de$.~!'4'tJ)( d'();üy~Ufll~ité P.••ris:,Sud XI, 9J40.s Ot$.1y {:a>tx~rr,.iU\C~ • ..-keseitf~hU~il fot r top~t."i1j f.)<~ aneltabOf".iot!tM'y .,( Siof;;:fIM~r~ CÍltís~bn • 0uv4!:

li1:l'l§1tU <I.C~lrnJ;r~tholoa:r~ lWf'AtW

HippoMlt ]'.I. 1100 Qruwds, 8efgium. alld4IIf'<mtlfida UAiv~íd:Jde·CatõJ:Q de Mí1tiU(J4!'l,.il;. ç.~ ~ Púç~dl,r Calà6, Ali, P..;JJt-h~""i> C""'s (". '';;;1, 37lO'.3551'uç •• li<!C;)ldas,"~.i. 6f.ut I

(;í 2004 hw •.••tIo~ tlnioo <liC<yV•• I~rP"_J,, 0.;.,•••••.• - alI •.•11I4<,~•••"'"

crystallization papers<<<-----<-----~"~._"~-~~~~~~~-~-

Leishmania mexicana mexicanaglucose-ê-phosphate isomerase: crystallization,molecular-replacement solution and inhibition

Gíucose-e-phosphare Isomerase (POI; EC 5.3.1.9: also oneu caííed byits oId nomenclature phospboglucose isorueruse) is an intracellularenz:,.mc lhal catalyses lhe revcrsíblc ecnversion of o-glucOM:6phOlSphutc (G6I') to n-íructose 6 phosphatc (1'61'). '111C nativeLeishmunítll'GI is a homodímcnc llIokculc oi 60 !;Da !XI monomerwith 47% sequcnoe identity 10 human POI. h hJ15 becn showl1 to bcP=CIlt in both lhe eyrosol and lhe 1l1YC(l$()WCoi l.A'ísilmaniaprollu&ugotc. 411d represents li. potential target for rational drugdesi3JI. lbe preseat ,,'Or\( deseribes lhe aystalliraiion 01 twobaclerialJy expressed Leis/múmia PUI ecnstructs, one correspondingto the natural protein and lhe otber 1(1an N·tc:mrin ••lly dele..," fonu,erySIaU. ti hO!b foem. ate iJcnrí.:al and pr"$CJlI a largc c uníl«Upara1llCtcr, •••complete dala ocl WiUi eoãeeted trow til<:NI.··rnrimúlydel"ledPUI te a resoluuce of3.3 Á in space group P6,. with uek-ceílparalll<'.tér. 11 " b : 871). c '" 354.7 À, (t " fi " 90, y " 120". AprelintÍllllry study of me firsI inhibilon 10 be C\'.1"81"d ou lheLeMlml1nút enzyme 1$also reporred.

1, Introduclion

Glocose.j\.phot;phate isomerne (PGI; EC$,3.1.9) ls an Ílltraer:UullIr eDZyme that alta-Iy~"$ lhe revendble CQ1lVCntoC! of o 1.',lu<'OSC6p1tosphatc (061') 10 ofiuct""" 6phOlil>h31c(F6P), ThÔ$uomcriz.-tlOll r<:acôon is ti. <:ommÓll&tep in lhe g1y(O/ytk, t1U1:OIlé:Otenc:si&andpellto<se-pllO$phale .,.rhwa)$.

PUI ""$ bem studied ín lhe Kinelopl.a$l.idaas a pownd.d larget (or lhe design (lf novelínltlbltOOl bceanse of lhe dilten:nces betweealhe host (h",llan) and .,.rn.mc glycolyticpathwflys and lhe dependente oi tllé parasíle.0Jl t1y«>lysu- Rt«ttdy, RNA-imerk.rcoo:.(R.."<Ai) slUdies have tcvealcd lha! dé.creasillglhe levcl oi PUl ín ·bloodstrelUll-{orm 1iyp-mW.roma bruél!i POI n:,,"II' in li 50% growthinhibillÓll (R.:admcnd er el; 2(03). This n::sultis índlealÍ\'e ai lhe central role tha! PUI pIay,ín lhe paruite llIetllbo!i$lll.

ln úúhm<miq mexican« mnk«nllI'ronu~gOl"s, rol ""livil)' .", ",<lU"}' (90%)detc:cted 10 lhe cytosol .vd lhe remaind"r ísIooatiu<l to perQxisomc,1ikc organclícs csllcdglyCO$Om~ Th.:. rol I<:thity ín lhe tworompWlllCllt$ coald not be attlibUled todirrerenl illoell1.yme' owing to protein .im;·laTiI)' and li .mgl" 1'(,1 1l"11C ;$ prellKnt in lhebaploid gMOlllé (NyanlC I!J <l/~ 1994), Glyro·_mll pr~e.llt ÍIlaHKíneloplll$dda and arekt)own. 10 conl{llll1111cntaliu lhe llnt seven~"IlZ}'1Ut:$ Qf lhe gI)-\'O/ytic palhwa)' válh

R«.~ivM u- j\UgU:iI lfi(}:I

Accept.;W 1l r~uJl~' 2{."'4

important eonsequences Cor lhe regulatloo ofti", r.Iyoolytic tlm: (Micbcls I!J lII, 2000),

PGI C3taJytic resldues are ..-eU conserved ínL. IMxiC4lUl, T. cru:i and Tl>ruc"; asldentilk.dby lhe nlígolUL-u1 of thcír _ino,.cid sequeneeswilh those of .ubbit (kffcry I!J sI., 2000), plg(Davics &: Muirbelld, 20(2). hUlllall (COrdéiroI!J <11., 2OQ) and Badl1J1$ (Suo <I di,. 1999), tbectyslld strncrures of whidl hsve been descnbedprevi._I,., 1hi, pauem ti wrm:n'ed resklues."p,gesl$ Ihal lhe kinelopl3$dd 1'Gb wrc aeemmon rCllÇÚQn mechanisrn wilh otber l'Ob,NevenhdClió" <fit!.,..",,,,,. CIIn be observedbetween lhe llIanunaJlan an<l parasíuccnr.ymes. A d«atlcd compari$Ol1 of lhe huma ••and LeislIIIUlllí4 POI stnICtUl'CS i$ critica! 10investigole wbctber these dínerencClió C"<Ul beexplcited in Ieture struc:turc,t!ir«:lcd <1m!;<ksign,

ln lhe prescnt work, we dc~bc lhe !iri!Sl1CéWiíul exptellSÍ.OJl, Q")'$Idll:tation andpreliminary X -ray cluI.ra.::tcrízation of lhel~;"'l!mallío 1'01 ''''~yull',f'ur tbis purpoStl, 1W"exprCS&ioo COIl!IlmCt5 'RUe prepared,OllcronWnÍllg tltO fuU-1entth gcm: (PGHJ1/)anda SC«lIld COIlSlnll:t (drol-Lm) ín whleh lhe S'end of lhe gene lhal rodes lIll N-IetnÜllal""'10"11"" unique to lhe LeíshnumútPUI wasdeletcd. Heng<lnal crystals wítb alara" ellnil·cell paramet« were é)htain«l4nd ~aly:re<l by"'·rfl}' di1fractioll, The initial pha$int data fordPGI-Lm were obtalrte<l. AMit\onal1y. weItaw compare<l lhe inltibit<>ry elfC:C1$ Q{ fOllr

001: 10,1 1O!1S09Q74449(1400371l2

77

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Ei«. J. 8/("" ••"". 271, 276$-2772 (2004) e FEHS 2004 d<li:I().llll!j.I4J2·103).2()04.ll4105.x

lhe crystal structure of glucose-6-phosphate isomerase fromleishmania mexicana reveals novel active site featuresArtur T. Cordeiro', Paul A. M. Michelsz• luiz F. OelhoniJ and otávio H. Thiemann'ILilboratQf")' of ProJcill Crys/aUography.mJ Struaural Biology. PI,pk:s III.titult: of SJo C<U/"$.Univr:rsil)' of SJo Paulo.s.w Cartos-St». BrtLtíl; lkSl'l1rclt Unit for l',opi<',ll Diseases and Ldhorillt>ry of Bk><ltemistry. Cluistiún de Duve Insütute ofulf"iar Patltoiogy. Brusseú. Be/gium; Jpolllijkia Vni""rsidade Ca16/iro ik Minas Gerais. P(lj."'Os de Caldas-MG, Bra::iI

Olllrose-ó-phOl>'!'hate ísomerase calal)'= lhe reversibleaklose-ketose isomerizatíon of n-glucose-õ-phosphate 10

D-rruClose-ó-plKl6phate ill glytoly$i$ and gl uccueogeuesis,aud in the n:cycling ar llC.'tose-6-pIKJSphall! in lhe pentoscphosphate pathway. Theunicellular protezoans, Trypan-ÔSOItIll brucei, T, cruz; and úísllm(ll/ia spp .• of the orderKineroplasüda are important human parasites responsi blefor African skepíng síckness, Olagas' dísease and leish-maníases, respectivdy, lu these parasites, glycolysis is auimportant (and in some CIlSCSthe Ollly) metabolic palhwayfor ATP suppJy. TIIC firsl $C\'CIlof the JO I!1JZylllCll thatpartidpate in glrcolysis, as well as ao importam fractionof ihc enzymes of the peatose pbospbate pathway, areÇ()lUpartluentali7..OO in peroxisome-like olllMCJIes called

glycnsornes, The dependence of lhe parasites ou gJycol}'l>1s,the ímportanee of' tbe penrose phosphate pathway índefense agalllsl o.ú:lative stress, and the uuíqoe compart-rnt.'I1tnJiz3lÍoll of thesc palbways, point 10 lhe enzymeseontained in lhe glycosorne as potenüal largCls for drugdesign, The present repon de~cribcs thc first crystalk»graplúc structure of a parasíte (Leishmll1tia mexiCt1l1a)glucose-6-phosphate ísonu:rase. A cemparíson of thealumie $lfUCIUrc: of L, mexicana, human and othermammahan POIs, whích lúgldights unique feamres ar lheparnsíle'lI I!1JZyIlIC,is pn."Si.'11lOO,

Ki!ywtJrdr:l~; I,fKl6I,hoglucc:1Seisornerase; glycoly-$&s;SullSlraJe..cnz.)-lUt:;human POI.

uixhl/li1llia mexicana is a humau protozoan pathogenbeIonging 10 lhe order Kinctoplasiída 11.21.AIllong lhekinetoplastid organisms, severa! human parasues are pre-sento inclu<:ting TrYJXUI()$(}1fI(1l>rucgi, T. cnIZÍ and variousl.éixhmallia specics that are responsíbk for diSC3ses SllCll asAfrican slecping sickrn:ss, Olagas' disease and Icishmaui-ases, respectivdy, oausing selÍOUS beahb probJems intropical and subtropicaJ ateall, wlúch, in severa! cases, arefataJ ir Jcft uutreated. This $CClUlno is aggravatcd by a lackof ctrcctive, available drugs for lhe treatment or infeeredindividuaIs, and lhe ICllOClS or drug-rcsisl:mt para$Ílestrains, l..ei!lhmuniaínfeclíon ma)' lead to disorders that

c_~ to Q. H. Thiomalin, LaborlItocyoI'Prtllein Oy$kú-Iography and Structural BioIot!Y,~Ii of PhysiC$ and lnr. •.-mau:., l'b)$iCs buiitule or S30 ~ Universily (lI" São Paulo,A'i'mue Traballmdor SãOca~ 400. 1'0 Do» 369. 13!i(j6...SOO.SãoCWJos.SP, BladI. FU:: .• SS 16273 9881,l'd.: .• 55 16 27) ~9.fl.tn~l:1Il~@j(~'lUII'.br 'A~Í<IHS:u-Fru6P, o-fructme-6-phasphole; D-G1c6P,u-JluOOlle-6-phó$phatc; drol-lnl., N-1mi1ínaIIy del«ed 81-.ó-pIlosphate~., f_ Le~Ú1_.dc.-; POr.~pb<I$pIlalc~ POI.Lm,~llIospIUile OOmeta~ fOOIl.l..d.IIIt_fa~,~~to iIomeríI$e([l.C. 5.3.1.9).NIJU; Thcl'OlIlD.éc>de rói' ÜIe $OluIiOOlo1ruc:tllrl$ pr~ m~f1IUf JlIt~pIlP$phate ÍIOUII:I_ ful/.lcu&thPOI-1m is lQSO $Q(I ot ÜIe (<mil wilh ÜIe 48 «$Íd\le$ dclet.t ftUm

1ti N-it:rminm (dl'GI,I.m). IQlt{Rawd 3 Oecember 2003,tmted 3J Matclt2004,~ (> MlIy2OO4)

82

can manifest themsclves in three ditTcmlt cliniçaJ forras -cmaneous, visceraI and mucocutaneous Jeishmaniasís .depending ou the .úisllmatia sptclcs iuvoMd, The aetualtreauuent for lcishmaniasis Í$ based mainly ou antimQJÜaJcompounds that.4lC oflow spcci1icity a.nd cause undcsirablcside.ctTects [1.2).

GlycoJysis is an important, and in some cases lhe only,mct3bolic pailtway for lhe ATP supply of tllCSCparasites,TIIC 6l'$t $C\'CIl of tllC JO ellzymes tlllÚ partíeipatc jngl)Ullysis are OOIllpal1mcnlaliz.cd in pcroxisomc-like Ofgatl-elks callcd g)ywsorllt'll (3), a characil:ristic of alI members oflhe Kinetoplastída. order. A cooscqlletle<: of this oQ!1lueUarJocalizatiou i$ lhat lhe kinetopl4stid g/ycol}1ic enzymesdifrl.T 111mall)'kinetie and slmctllmlproperties from thcircounll!rparts ín !)tbt-r llrganisms,and Iba! the Uux. throngllthe p..'lthway is regulaled in a dítTcmlt manncr (2,3J. Notonly gIycolysís is found in gl)WSOlllCS; also found is asigniticant Craction of many enzymes ar lhe peatosephosphaic pluhway [4,Sl. whích uses sngars for ihe fonna-

. tion af D-ribo.se-5-phosphate for nucleotidesyntht:$is andNADPH, for biO$)'nihetic~ and for dcfenseagIÚIIsto.~t stress, 11Us.plOCe$$ iS aJso ycry important for lhetr:ypanosolllCS and kishmanias, particuJàrly to eombatoxidativc aUack 1>y lhe bost. TIlI!fCíort;, both lhe gJyoolyticand pemose phosphatc patll\\'l1y$ haee been indicated aspromi$ingdrogtàrtef$I2,6,7].

Glul.XlIIe.fl-phospbáteisomerase (oClen $ÚII calíed by ilsold name, pflO$p~ Í!ioml:rIlSe;POl)is lhe $COOndemyme lU glywJyijs and eataIy;!J:s tbe te'VI!1$ible akíose-ketose isomerization ar trgllléOse 6-ph<J$p1làlc (P-01c6P) toD-fructose 6-pbosphaíe (o-Frn6p). lt is also lIllenzytlllllielink betweenglycoly$.isand the pentose phospbatepathway.

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Eur. J. Hlochen». 270. 3205-3213 (2()(tl) 1<,) FEHS 2(~13 <1",:10. Hl46fj.14J2-!U.B.20()3.!)J692.x

Kinetic characterization, structure modelling studiesand crystallization of Trypanosoma brucel enolaseVéronique Hannaertt, Marie-Astrid Albertl, Oaniel J. RigdenZ, M. Theresa da Silva Giotto:J,Otavio ThiemannJ

, Rimará C. Garratt', Joris Van Roy', Fred R. Opperdoes' and Paul A. M. Michelst

IRrseard. Unnfor Troptcal Dísnases, Chrístían de Duve lImúlI'" (>fCcllu/llr P,'l/wlo!:y illld lAbiIr<110ry (>1BWd,,'!míslrr.Unh'u.,ilé Cl11lwli./u" de 10.""11". BrU!,~,J., lJdgíllm; 'CENARGENíEMBRAP,4. flms/lia-D.P. 8,.,711;~lnsfilulO de Física de ,'Wio C-llr!o,,,. {lniw.~r#dadc de Sdo Paulo, São Carlos SP. Dnl.;?il

111 this article, we report the resulta 01' an analysís of lheglyeolytic enzyme enolase (2-phuspho-o-gly\Xrate hydro-lase) of Tryponosoma brucei. Enolase activity was detectedin both bíoodstream-form and procycle insect-smge try-panosomes, althougíi a 4.5-fold lowcr speci6c activity waslound 111lhe cnltured procyclic homogenatc, Subcellularlocaâzauon analysis showed that lhe C'IIZ}mc is onJy pre-sem in the cytosol, The 1'. brucei enolase was expressedtil Escherichia roli 1100 purified to homogeneity, The l:in-enc propertíes of lhe bacterially expresscd enzyme showedstrong similarity 10 those values Iound for lhe natural1: bT'UCti enolase presenr in li C)'IOSOtic reli fraction,indicating li proper foldíng ar the CIIZ}U1C in E. to/i. Thekinetic properties of T. lsucei enolase were also studiedin comparison with enolase frorn rabbit rnuscíe andSoccharomyces cerevisioe. Funcuonally, simílanties werefound to exíst betweea lhe three enzymes: lhe Mic./mdisconstanr (K,,) and KA values for lhe subsrraies alie! Mg>+are "e.ry simíbrc Diffcrences in pH oprima for aelh·ity,

inhibition by excess Mg1';' and susceptíbiliues 10 1110no-

valeat ions showed lhat lhe T. bruce! euoíase behavesmore lilre the yeast CIIZ)'IUe. Alignment of the amino acidsequences of 7: bruce! enolase and other eukaryotic andprokaryotic enoíases showed that ruost residucs involved111 lhe binding or jls hgands are well eonserved. StrucruremOOelling of lhe T. bruéei enzyme usíng lhe availableS. eerevisiae structures as Icmplale:s indicated that thereare some at)'pícaJ residues (one Lys and two C)'S) dose tothe 1: bruce: active site. As ihese residues are absent Iromtlie humau host enolase and are therelore polclltiaJlyíntercstíng filf drug design, wc iniuated attempts todetermine lhe three ..dímensíonal structure, T. bruce« eno-lase crystals dífi'r.u;ting aI 2.3 Â. resohn ion were obtainedand \\111 pernut us 10 pursue the determination ofstrucmre,Ãeywordr; enolase; 7Typatlosoma brucei; kineties; ml1IC! unomodelling; c.ryslalli7.,atíon.

Enola ..se (211I!ospho ..o-glyeerate hydrolase, EC 4.2.1.1 I)eatalyses lhe revcrsible dchydrauon of {)-2-phosphogl)'-ccrate (roA) to phoslllKlimolpyruvalc (PEP) in bothglycoly'llÍ-~ and glucoueogenesis. '1111.': enl)'llle has beenstudied from a large variety OfSOll.TCCS (includingArclt:lcbactt.'1'Ía, Eubacteria and Euka ryota) and found10 be highly conserved. This conservation is particularly

C«U'$p")"k,,,:~ 10 V, lI"ilU'áeJ:t. ICl'·TJtOP 74-39, A'ílUlJeHiPJl<X'I&t~ 14, 8-1100 Btlllilicl$. Bclg.i\Ull.Fax: 32 n6! ss 53, 'lei.: :12 2i64 74 72,F~nWl: h""'-laert@I"'l'.ud.oc.,beAbbr(!Yil1tilm~: IUí4. 4·1(2S,3Sj-3-carboxyoxír.m-l-)1=bon}1-L·!eu·é)iamldoJwlyl.@:\llIlÚdínll;GAJ>O!1. ~!yéttàldell)<d..,.3-pl,(.Ilphaled"h~IOg@~ U)H. I&."lale dcl,)'dmB!"J3se; PHP. '~'OSflbp.(JlPlpyl'l1vau,; ]>(h\.I>-2-pltOOl,h(l9)'C\ltálé;PGAM. phO$ph(l~-mate mutase: PGK,. phOI!pho,ilycemle bRas:; PYK,.pyruvate IúuWle.m}.IW$: e<l<daie!2·pllOlpbó,·~!\.I)~", hydtolase (OC 4.2.1.11);gfycw.dd..ltyde-).pI>osphalcdehydu)l!Clme (Se 1.2.1.11); ""'taledclIydrOgén* (I'!C 1.1.1.27); l,ht'lSj,botlYC\lral~ \dna$e (F,C 2.7.2.3);lmO$l,llÔ.sI)'CCI'lIUl l'l,lÜMe (I'.C ,.4.21); pyr\J.~'lIte kinMe (1-<::027. L4(j).(Rt>:dwd 2() l'ebnmry 100,\ revim 12May 1003,1lC«pl<d 4 June ::(03)

90

app:ncnl at lhe catalytic site and h.1S 100 to enzymcsfrom diversc !>-pccies sharillg many similar kinetic prol"erties, F..l'I(lIare from all eukaryotes analysed, and rrommany prokaryotic species, is a dimer, with idcnticalsubunits havillg a molecuJar mass of 40 0005Q 000 111;however, octamenc enelases have been reported 111 avariely of bacteria (2,3].

High-resofution crysUtl structures are known for lheenolases fl'Olll lobster and Sat."CharoJIIl'ces eereYisiae, bothas apoenzyme structures and ~Jéxes with substratesand ínJúbltot:l [4-7). lbese 1\\'0 enola.'leShave very simíla.ramino-scid stquences and íhree-dimensional structures.F..aoh monomer of enolase contains two domains. Tbc largeC-tenninal domain ís an eightfold Il/P barrel of somewhatunusual Iypc, with a topoJogy whicll diffcrs Irom lha!eommouly observed 111 lriosepttmph.alc i.•.nnerase audmany other proteins, The active site of enolase ís J'lfl'St,.111

at thc C terminas of 1his barrel, The $maU or N-tcrntin:ddomain wraps around lhe oulslde or lhe rnain domam [StMO$tof the iutersubunh coutacts are between lhe smalldomain of one rnonomer and lhe largedomain of the other,Kiretic expcrirneul$ have dcmollstratcd thaí bindinl!. of twometal íons 10 each tII01l0111el is required for activity (?< 11)-l'hey further Sllggcsted the prcsence 01' a third, inhibítory,

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Capitulo IV

4.1- Rastreamento de inibidores a partir de extratos de plantas

e animais marinhos

Durante séculos o homem utilizou-se de plantas e extratos derivados destas

como unica fonte de agentes terapeuticos [52-54]. No inicio do século XIX as

plantas passaram a representar a principal fonte de substancias para o

desenvolvimento de medicamentos em decorrencia do desenvolvimento da

química farmaceutica. Atualmente, apesar do grande desenvolvimento da sintese

organica e de novos processos biotecnologicos, 25% dos medicamentos prescritos

nos paises industrializados sao originarios de plantas e 40% de todas as novas

drogas desenvolvidas possuem a participacao de produtos de origem natural

[52]. Alguns exemplos importantes podem ser mencionados como a Asplrína'"

(Bayer) ou ácido acetilsalicílico. Este composto não é encontrado em plantas mas

é o resultado de uma modificação estrutural símples, uma acetilação de

compostos com conhecidas atividades antiinflamatórias e analgésicas como a

salicina e a saligenina, isoladas de Salix alba L. Outro exemplo consiste na

papoula (Papaver somniferum L.), de onde se obtem o ópio com conhecidas

propriedades soporíficas e analgésicas.

A quimioterapia atualmente disponível para tratamento de infecções causadas por

Leishmania esta distante de ser satisfatória. A resistência aos antimoniais

99

pentavalentes, que tem sido as drogas recomendadas para o tratamento da

Leishmaniose visceral (VL) e cutânea (CL) por mais de cinqüenta anos, esta

atualmente disseminada na Índia. Apesar de novos fármacos terem sido

disponibilizados em anos recentes para o tratamento de VL (Arnêlsome'",

Miltefosine) problemas de tratamento persistem [55-58]. A busca por novos

fármacos persiste, com os bisfosfonados (residronato e pamidronato) e derivados

de plantas como as licochalconas A e alcalóides qulnolínlcos tendo sido reportados

como tendo atividade contra infecções experimentais em sistemas modelo.

Diversos alvos em potencial para o desenvolvimento de fármacos têm sido

identificados em estudos bioquímicos e moleculares e em alguns casos em sido

validados. Os alvos moleculares, temas deste trabalho, envolvendo a via de

recuperação de purino nucleotídeos permanece como um alvo em potencial de

grande interesse [56-58].

Este aspecto revela a grande importancia que as plantas e outras fontes de

produtos naturais têm frente ao desenvolvimento de novos fármacos. Nesta

perpsectiva, vem sendo empregada a busca por composotos com atividade

inibitória das enzimas alvo de Leishmania. Para o desenvolvimento dessa linha de

investigação, sob a estreita e frutiferà colaboração com os laboratórios de

química e isolamento de produtos naturais do Prof. Dr. Paulo Cezar Vieira

(Departamento de Química, Universidade Federal de São Carlos - UFSCar) e Prof.

Dr. Roberto G. S. Berlinck (Instituto de Química de São Carlos, Universidade de

São Paulo - USP) emprendemos o rastreamento de extratos de origem vegetal e

de animais marinhos até a obtenção de compostos puros.

100

4.2- Trabalhos apresentados em seguida

Apresento em seguida sete artigos relacionados com o rastreamento de de

extratos ea caractrização da atividade inibitória de diversos compostos.

Os primeiros tres artigos tratam do isolamento e caracterização estrutural de

compostos isolados de Adiscanthus fusciflorus (Rutaceae), a isopimpinellina (5,8-

dimethoxy-psoralen), skimmianine (7,8-dimethoxydictammine ou 4,7,8-

trimethoxyfuro[2,3-b]quinoline), e o 3-(5,7-Dimethoxy-2,2-dimethyl-2H-

benzo[b]- pyran-6-yl)propionic acid. Estes compostos foram isolados de extratos

de A. fusciflorus em uma abordagem guiada pelos ensaios bioquímicas de inibição

da APRT de Leishmania. O estudo estrutural por difração de ralos-X de

monocristais dos compostos se ostra importante do ponto de vista do desenho

racional de novos compostos derivados por fornecer um maior conhecimento da

molecula em questão.

O quarto artigo aceito para publicação .se refre ao isolamento da cumarina

Aurapteno (7-geranyloxycoumarin), isolada de Esenbeckia febrifuga (Rutaceae)

por ensaios guiados pela inibição do crescimento de L. major em cultura. Esta

abordagem foi possível graças a implantação da sala de cultivo de parasitas e

células de mamíferos no Grupo de Cristalografia de Proteínas e Biologia

Estrutural. Representa um avanço significativo por permitir o estudo bioquímico e

celular dos compostos isolados como exemplificado nesta publicação e na

seguinte.

101

o quinto artigo submetido para publicação se refere aos ensaios de inibição

bioquímicos com as PRTases (APRT, HGPRT e XPRT) de Leishmania assim como

aos estudos de inibição do crescimento do parasita e seletividade frente a células

humanas.

Finalmene o sexto artigo relata, em uma revisão em colaboração com o Prof. Dr.

Roberto G. S. Berlinck (Instituto de Química de São Carlos, Universidade de São

Paulo - USP), os avanços e nossa modesta contribuição no isolamento de

compostos derivados de animais marinhos e fungos marinhos.

1. Napolitano H.B., Silva M., Ellena J., Rocha W.C., Vieira P.C., Thiemann

O.H., Oliva G. Redetermination of skimmianine: a new inhibitor against the

Leishmania APRT enzyme. Acta Crystallogr E Struc. Rep. 59: 01503-01505

Part 10, 2003.

2. Napolitano H.B., Silva M'., Ellena J., Rocha W.c., Vieira P.c., Thiemann

O.H., Oliva G. Redetermination end compara tive structura/ study of

isopimpinellin: a new inhibitor against the Leishmania APRT enzyme. Acta

Crystallogr E Struc. Rep. 59: 01506-01508 Part 10, 2003.

3. Silva M., Napolitano H.B., Ellena J., Rocha W.C., Vieira P.C., Oliva G.,

Thiemann O.H. 3-(5,7-Dimethoxy-2,2-dimethy/-2H-benzo[b ]-pyran-6-

yl)propionic acid: a potentia/ inhibitor against Leishmania. Acta Crystallogr

E Struc. Rep. 59: 01575-01577 Part 10, 2003.

102

4. Napolitano H.B., Silva M., Ellena J., Rodrigues B.D.G., Almeida A.L.C.,

Vieira P.c., Oliva G. and Thiemann O.H. Aurapten, a novel coumarin with

growth inhibition against Leishmania major promastigotes. Braz. J. Med.

Biol. Res., No Prelo.

5. Silva M., Silva C. H. T. P., Rocha W. c., Castilho M. S., Vieira P. C., Oliva G.

and Thiemann O. H. In-vivo and in-vitro effect of four alkaloids of

Adiscanthus fusciflorus: Inhibition of phosphoribosyl transferases activity

and antileishmanial effect. Submetido.

)

6. Berlinck R.G.S., Hajdu E., da Rocha R.M., de Oliveira J.H.H.L., Hernandez

I.L.C., Seleghim M.H.R., Granato A.C., de Almeida E.V.R., Nunez C.V.,

Muricy G., Peixinho S., Pessoa C., Moraes M.O., Cavalcanti B.C.,

Nascimento G.G.F., Thiemann O.H., Silva M., Souza A.O., Silva c.t.,

Minarini P.R.R. Challenges and rewerds of research in marine natural

products chemistry in Brazi/. J. Nat. Prod. 67 (3): 510-522 2004.

103

organic papers

Ma, Ct)'jt.ll~'ophia $«1<.onf

S'ruclure ReportsOnllne

H. B. NapolilanO;· M. Silva:J. Ellena," W. C. Rocha,bP. C. Vieita," O. H. Thien'<IOn"and G. Olival

""'\;MO<I< n",,,,des.\cC~\JSP.C,Pe,wJ~'.13Sf>1.'70 Sh C.u!"" SP. 6r •••W•••• d~~b. QWIniG:~u~SC.tr~c~~\.li 676,1J%~·*tOS SJu Cark» SI", Sr-ud

lCoyi".ot'<S'jflgi;H:.ryu,li X-'f'W $tW:1y

7·1W(M_<t«: 0.0.002,1.1I:_.".o.l>lwR iáélót • 0.104O.u.·",,'P"_ ._ • 12.lt

fw <k\ •• !< <>11_ "_ koy <fl<I~._.JA,~ny dttNfld fmM 1h~ -arM':!"!'.~

http;~'NJj,_u·Qtsfe·

4) lOO! " __ I UtW>rt '" CJy,1AI~I'<intóll .n Grt<It 6<iUin ~11lsh!> "'~

Redetermlnatíon of skimmianine: anew inhibitor against the leishmaniaAPRT enzyme

11", lill" compound (nhernillive narnes 7,8-dimélhoxydiclllm·mine and 4.7,s-tI'imellloxyfuro{2,3-b)quinolinc), CHHnNO •.IS a natural product extracted from Adiscamhu« fll$c{ffoms(RUIIlCil<IC), Our biochemical tests show that il has inhibitoryacuvíry "tlllinst the enzyme adenlne phosphorjbosyl-transferase (APKD from Leisnmenía. a tropical parasitceausing endemíc disease in poor eountries 11cl)'$tallizes in lhecentrosjmmctríc space group n/c, with oue molecule inibeasymmetríc unit, and has at least two C-H···O íntermote-cular íntemctions, leading 10 lhe íormarion of centrosyrn-mctric dímers.

CommentLeíshmauiasis i$ a dísease causcd by a protozoal parasito otlhe arder Kiuetoplastid. According to tbe World Heath()rganilalion reports (WH(), 1998), S8 eountries are alTectt.>d,wíth 12 million iafected peoplc and approxlmatcly 3SQmillionpeople at m.The need for 11<l!\\'deugs for the crcatmel1( 01 lheIelshmaniasís inrectíoll$. contes ftom a lack of sare drugs andthe seríous sccondary elTects observed in available "hemo-therapy (McGree"y & Marsden. 1986). lhe purine nucleotidesalvage palhway íu Kinetoplaslid ís a potentíal target for lhedevelopment of new drugs, ()\Ving to its dependence on lhalbíosymhctic palhway (Detens et ai., 1995). lu Kínetoplastid.lhe phosphoribosyltransferase (PRThse) protein Iamíly isresponsíbíe ror purine nuclcolide salvage. Looking ror newbioacuve substances, poteutially useful against Icishmaniasis.\IIe used the PRThse adenlne phosphadbQS.yltransferase(APH.T) trom I~ UJl'ffllolllC as li mudei system to sereen lheinhibitoty capaeity ar several smaUmoleculc compounds fromBrazílian plants,

lhe screenmg was pertormed u_ing lhe APlU inbibitoryassay, cíther iu the preseuce of extlllClll ar wilh Ihc puriticdcompound, and was monitofed specttoj>hotometrícatly (Tuttle& Krenilsk)', 1980).lhe lÍlte compound, (I).was isolated (rumA. fim:iflorus e:ttracts and has been structuratly investigawdbecause ar its inhibitory /lctivity agninst APRT. Enzynlaliclelt$ or (I) /lI 50 Ilglml shaw an ínhibítion activity of 68%.Further invcstigalions by molecalar dooking and dynamicsÍlllulation$ will be perfonned to study lhe interaetiaU$

l\4J!r~1\o'HI ~~i1>fti\' lD,-l~Att:.t'j)t'ltd $o 'X1;:Wf1~f 1(,"0$

(Jflhn~ te,. ~~l'of!1' lOOJ

001: li). lW7JS'H'OOSl4&)3()1~91Jetectre n ít:: ft;pri r!t

104

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

organic papers

Acta (tystallographica. Section E

Structure ReportsOnlineISSN '6DO-5 ~68

H. 8. Napolitano,·· M. Silva,aJ. Ellena," W. C. Rocha,"P. C. Vieira,b O. H. Thiemann'and G. Oliva"

"nstituto de F(s,icatH SIQC.IQ5.0SP. Cx Postal369; 13560-97D S~ C~Io~ SP, 8ralil, endb[)ept.o. QuímC:lt. UFSCar, Cx Posul 676.13565-905 S50 Cadcs SP. Srazil

lCey indiutôri

5;.gl"cry'''' X-r.ySbJdyT-120KMe'. G'(C C) - 0,002 ÀRfactt>r - 0,044wRfactor - 0.124D.ta-tõ-pararneb!r ratiô - 11.4

For details of how the$ol! key indicatOrs wereilutcn'lelticaUy .rived trom lhe If"tide. seehttpJljournals...íuCt.Gr"e.

li) 2003 ."",rnational Unkl<l ofC'yltállographyPrinte<l inCreat Britain ali rie~r'ese~

Redetermination and comparative structuralstudy of isopimpinellin: a new inhibitoragainst the leishmania APRT enzyme

The title compound (altemative name 5,8-dimethoxy-psoralen), CuHl<PS, ís a natural product extracted fromAâiscantbus fusciflorus (Ruraceae). Our biochemical testsshow that thís compound luis inhibítory activíty against theenzyme adeníne pbosphoribosyltransferase (APRT) fromLeisbtnania, a tropical parasite causíng endemíc dísease inpoor countríes, lt crystalliz.es in the centrosymmetric spacegroup P2ic. with one molecule in the asymmetríc unit, and hasat least lVI'O C-H- . ,O intennolecular interactions, leading tothe formatíon of centrosymmetric dímers,

Recelved 28 'vI) 2003Acceped 8.Sf':ptemoor 2003Onlio.:!: 18 Sep1ember 2003

CommentLeíshmaníasís ís a dísease caused by a protozoal parasite ofme order Kínetoplastid, Accordíng to the \Vorld HeathOrganízation reporta (WHO, 1998), 88 countries are atfected,wíth 12 millíon infected people and approximately 350 míllíonpeople at risk. The need for new drugs for the treatment ofle:isbmaniasis in1ections Comes from a lack of safe drugs andthe seríous secondary effects observed in avaílable chemo-therapy (McGreevy & Marsden, 1986). Loolcing for newbíoactive substances, potentíally useful against le:ishmaniasis,we used tbe PRrase adenine phospbonl>osyltransferase(APRT) trem L. tarentolo« as a model system to screen theinhibitory capacity of severa! small moleeule compounds fromBrazilian planta The screening was performed using theAPRT inbibítory assay, e:ither in the presence of extracts orwíth the purified compound, and was monitored spectro-photometrically (Tuttle & Krenitsky, 1980). The titlecompound, (I), was isolated trem A. fuscifiorus extracts andluis been structurally investigated beeause of íts inluDitoryactívítyagainst APRr. A comparative study between (1) andanother ínhíbítor ,slcinunianine (11) (Napolitano et ol., 2003).against the APRT enzyme Will be performed.

~\O~oAo

OCR3

(I)

Enzymatíc tests of compounds (I) and (lI) at 50 j1gtml showinhibitíon activíties of 50% and 68%, respectively. Furtherínvestigations by molecular docking and dynamic simulationswíll be performed to study the interactíons betweencompounds (I).and (11) andthe APRT active site. The new

DOI: '~.1107/S1600536803019925p!l':t't:.iwf'tn te r{~~::Ffr~r~I

Acta cryst. (2003), ES9, o1SQ6.-clS0801506 H. B. Napolitzno eU' .Ó» c,,H'QO'

107

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

organic papers

k1a Cty5taiJog.-aphica Section E

Stn.rcture ReportsOnlineISSN 1600S368

M. Silva," H. B. NapolitallO"·J. Ellena," W. C. Rocha,bP. C. Vieira,b G. Oliva" andO. H. Thlemann"

&lnsl;tutode Físjc;:a. de Sâc Cartos . USP,CI{ pOs.tal 369~ 13560·:970 ..São Carlos SP,Bfazll, and ItDepto.Químk:a - UFSCar,Cl( posla1676, 13565-905 - Sâc Carlos, SP,8razil

Coue$pXdence e-mail: hamikon.if.~c.(Jsp.b

Ke" Í01dÍcalors

Síngle-aystal X-eay .WdyT· 120 KMe." O'(C-<:I • 0.002 ÁR factar a 0.033•••R lactor • 0.090Data ..•.o-pafarnder ratia '" 9.8

FIlr detaíls 01 h<lW the~' key indicator!o W\!fe

aUlOrn21.1cally deived 110m the at'licle, seehUp:l/jutJrnals.iua.orgfe.

11) 2()Q, Inler03li"".1 Uni"" 01 CI)'SI;IlIogl>phyPrin~d in Greal Britain .,.all rishts resesved

3-(5,7 -Dimethoxy-2,2-dimethyl-2H-benzo[bl-pyran-6-yl)propionic acid: a potential inhibitoragainst leishmania

The title acid, C1óH2DO" was extracted from AdiscanthusfusciflonlS (Rutaceaey and is shown to inhibít adeninephosphoribosyltransferase (APRT) enzyme activity. Thiscompound crystallizes in the centrosymmetric space groupC2Jc with one molecule in the asymmetric unir. There is onestrong hydrogeu bond, with ÚD" ,0.1. = 2.6238 (12) À aud0D-H·· ·O.t = 171.1 (17)" involvingthe COOH group,forming a cyclíc dimer about a center of symmetry. Thepacking of the molecules is addítionally stabilized by one C_oH···O [Co·· ·OA = 2.9820 (16) À aud Co~H·· ·0.1. =101.8 (10)°) and two C-·H···:rr intermolecular hydrogenbonds.

Receíved 3 Juiy 2003A""ep1e<j 22 Septembe< 2003ÚfIfjne 30 Se(:i.elnber 20G3

Comment

The title carboxylic acid, (I), has been investigated because ofits interestíng inbibitory activity agaiust adeníue phospho-ribosyltransferase (APRT) from Leishmania tarentolae whichis a member of the pbosphoribosyltransferase (PRTase)family. The PRTases are responsibJe for the salvage oí purine,pyridine and pyrimidíne nueleotides, as well as aromaticamino acids. Most organísms syuthesize adeuine nucIeotidesby both the de novo and the salvage pathways. lu contrast,protozoan parasites are strict purine nucIeotide auxotrophsbecause of the absence of a purine de novo biosynthetícpathway (Berens et al.; 1995). Thereícre, these mieroorgan-isms are absolutely dependem on scavenging pre-formedpuriue nucleotides from the host or the media [Ullman &Carter, 1997). To look for new potential anti-leishmania drugs,we used the APRT trom L. terentoleess a model system toinvestiga te the inhibitory capacity of A. fusciflorus extracts.The sereeníng was performed using a spectropbotometricassay (Tuttle & Krenitsky, 1980); the ICso oi pure compound(I) is 147 jiM. lu view of this interest, we have extracted tbetitle compound, (I), and, present bere its crystalstructure,

OMe

(I)

Compound (I)crystallizes in the centrosymmetric spacegroup C21c with one molecule in the asymtnetric unit, Tberefined moIecular structure, together witbtbe atom-Iabeííngscheme, are shown iu Fig. 1 (Jobnson, 1965). Aílthe bonddístances and angles are close tonormalvaíues (ATIen et al.,

DOI: 10.11071S16O()5.l68OJ02107XOI%3Ctt<)11 ic reprint

M, Silva era! .• C,.t·t,.P5 01575Mta CtySt. (200)). ES'I, 01575-01577

110

I F S ( U S P SERViÇO DE f318~IOTE• INFORMAÇAC

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Aurapten, a novel coumarín with growth inhihition against Leishmania ItUljor

promastl gotes

11B. Napolitano', M. Silva', J. Ellcna', 8.1).0. Rodrigues', A.L.C. Almcída', 1'.C. Vícira2 O.

Olival and O.H. Thiemann'

'l..aoorat(lrio de Proteína, Cristalografia e Biologia Estructural, Instituto de Física de São Carlos,

Universidade de São Paulo, São Carlos, 8P, BrasillDcpllrtantçnto de Química, Universidade Federal de São Cartas São Caríos, SI\ Brasil

Correspondence:

O.H. Thiernann, Laboratório de Proteína, Cristalografia e Biologia Estructural, Instituto de Física

de São Carios, USP

Av. Trabalhador ~lcnse. 400, 13566-590 São Caríos, SP,13rasil

Fax: +55-16-273-9881, E-mail: tlúctllanll@if.sc.usp.br

Research supported in part by FAPESP (No. 99/02874-9 to O.H. Thiemann), H.B. Napolitano

and M. Silva are recipienl ofFAPESP scholarship.

Abstract

\}

Several natural compounds have been identified for lhe treatrnent of leishmaniasis. Among them

are some alkaloids, cbalcones, lactones, tetralones and saponins, The new compound reported

here, 1-geranylox-ycoumann, caíled aW'aptcn, belongs to lhe chemical class ofthc coumarins IInd113$ a moleeular mau af 298.37 glmol. The compund was extracfed from lhe Rutaceae speeies

E$enbeçJ..:iafobrifuga. The compound was purified from ao hexane exlract starting from 407,1g of

dricd leaves and followed by four silica gel chromatographic fractionalion steps using ditrerentsolvents as lhe mobile phase. The resulting 41mg ar compound shows significam growthinhíbition with an U),l4 af 30J4\.f<'lgainst fbe tropical paradte Leuhman!« major, whieh causessevere clinical manifestations in humans and ia endemic in lhe tropical and subtropical regions. In

lhe present study we invelltigaled lhe alomie structure of aurapten in arder to de.••crmine lhe

113

2

existence of common structural motifs that might be related 10 othcr coumarins and potcntially to

orher identífied Inhibitors of Leishmania growth and viability. This compound has a comparable

inhibitory activity of other isolated molecules. The aurapten is a planar molecule constituted ar an

aromatic system with electron delocalization. A hydrophobic side chain consisting of tcn carbon

atoms with two doublc bonds and negative density has been idcntified and may be relevant for

further compound synthesi$.

Kcy words: Coumarin, Auraptcn (7-geranyloxycoumarin), X-rays, Leishmania, tnhibitor.

Introductlon

Lcishmaniasis 15 li disease caused by a protozoan parasito of the order Kinetoplastida.

According to fhe World Health Organization (1), 12 million infected people exist in gg countries,

with approximately 350 million people being at risk. ln view of lhe lack of safe dmga and lhe

serious secondary effects caused by available chemotherapy (2), there ia a need for new droga for

the treatment of leishmaniasis infections, Therefore, lhe discovery of nove! classes of ínbibitors

em be an importam step which conlributes to overcoming the drug resisrance of LeishJtlania (3).

11\\1use of pltytothcrapy to (real human díscases lias its roots in pre..historical times and

mosl of lhe effective drugs currently available are obtained from plants (4). The biodiversity

existing ín Bra.zilian is a potential source of many new bio~tive molecules to be studied and

explored (5).

ln a search for new bioactíve substances potcntially useful against Ieishmaniasis, we II!ICd

L. major Friedlín (WHO MHOM/IU80/FriOOlin) cells as li model system to screen SntilU

molecule compounds obtained (rom Brazílian planta. The screening \VáS dane using an in "No

culture assay in lhe preseace or absence of lhe purified compound and lhe parasite growíh rate

\VaS monitored tnieroscopical1y. This appr<laéh pennitted us to identi(y a new compound wbich

was subsequenüy shown to be 7-geranyloxycoumarin (aurapten). Tbe compound belongs to the

class of collmanns and shows significanl growtlt inhibition of L major promastígores aI

coneentra1ions af miccograms per ml,

Material and Methods

E~tractlon orthe plant Inhlbltor

114

TI1C leaves of Esenbec*iafebr{fllga (Rutaccae) were COllCCICdin Piracícaba, sr, Brazil,

by Prof. Ricardo Ribeiro Rodrlgues (Escola Superior de Agricultura Luíz de Queiroz, ESALQ,

code 84295) in February 2000 and extracted according 10 lhe procedure illustrated in Figure I and

descríbcd below.

Ground Ieaves (407.7 g) were submíncd to a flrst exiractlon step witlt 4.5 L of hexane,

resulting in 9.S g of exnact aftcr lhe solvem was removed, The extract was fractionated by silica

gel chromatography through a 30 em high column measuring S em in diameter using li

hcxane!ethy/ acetate (100:0, 9:1, 8:2, 7:3, 1:1,0:1(0) and an eihyl acetate/methanol (100:0, 9:1,

7.5:25,6:4, 1:1,0:1(0) gradient system, From this purification 30 fractioas of250 mL each were

collected, Fraction 14 (hexane:ethyl acetate 8:2) wasfurther fractíonated on a 3 x 26 em silica gel

column using a gradient system \vilh hexane, methylene chloride and mclhanol (hexane 100%;

hexane/methylcnc chloride 100:0, 90:10, 80:20, 70:30, 1:1; methylene chloridc/methanol 100:0,

90:10,70:30,1:1,0:100). The 79 Iractions (25 mL each) were collected and, based on thin-layer

chromatography (Tl.C) 011 silica gel (0.25-mm thick silica gel, Merck PF 254, hexane/methylene

chloride/aceton 3:1;0.5), anel detected with, Vaniline Aeid, UV Iight 254 and 360 nm and

Dragendorff reagent, ciglll fractions were pooled. Fraction four was submined to

chromatographic separation on a 2 x 31 em silica gol column diluted isoeratieally with 3:1:0.5

hexane, methylene chloride and acetone. This step resulted in 87 fractions (25 mL each), twelve

of which were pooled afler TI.C analysis as above, Fraction tWD was submlued 10

chromatographíc separation 011 a silica gel column ou a 1 x 20 em silica gel colunm usingmethylene chloride as the mobile phase resulted in 24 fractions (25 mL each), four of which were

pooled after Tl.C analysill. Fraction four rcsulled in IIn amorphous yellow solid (47 mg) which is

7-geranyloxycoumarin (aurapten) according to NM'R IH, Uc spectra and OCIMS, lhal was

crystalhzed by vapor dítTusion, at room temperature, from hexane/methylene chloride 2:1. The

purity of lhe compound was confirmed by Tl.C (O.25-mm thick silica gel, Merck PF 254,

Darmstadt, GermaIlY). NMR and GClMS.

Parasãe assays

Stock solutiollS of aurapten were prepared in dimethyl sulfoxide (DMSO) aI 5.0 mg/mI.

Further dilutions of aurapten Were made directly in lhe L. major culture médium immediately

bcforc use. ln aU expcrimenlS the final eoncennatíon of DMSO lcss than 0.5% (vN). a

concentration lha! does not affect parasite growth rale, mobility ar morphology (6).

115

4

L. mujor Fricdlin promastigotes wcre grown to 11 concentration 01' 1.S X 104 cclls/ml in

M199 (Gíbco Laboratories, New York, NY, USA) supplemented with 10% feral bovine serum

(FBS), ]() ml\l adenine, 10 rng/rnl penicillin, 10 mgfml streptomycin, O.25~'. hemin chloride,

0.1%, biotin, and 1.01'.1 HEPES. p11 7.5. The parasire culturcs wcrc prcpared with or without

auraptcn aI final conccntrations 01'2.0, 5.0, 7.0, 10.0 and 15.0 jJ.glml. Thc effect 01' aurapten ou

parasite growth was monitored by counring in uiplicare in a Nebauer chamber after 48-h

ineubation ai 26"C.

Crystallographle characteeizauon or aurapten

Aurapten was crystallized from 2:1 hexane/methylene chloride by vapor diffusion at

room tempcrature. 'I1lC typical crystal was yellow aud was needíe shaped, X-ray diffraction was

carried out using 11 Nonius KappaCCD düTraclomcler ai roem temperature, The structure was

solved by direct methods using the SHELXL97 software (7) and was refined anisotropically with

full-matrix least-squares on P using SI-fiLXI.97 (7). The hydrogen atoms were placed at the

calculated position, eXG<:pIfor those ínvolved in If-bcnds, found 011 difference maps and funher

reflned. Final índices were: RI(F.) = 0.0895 and WRz([tl) = 0.2723 for 165 refíned paramcters,

11lC crystallographic parameters for CI9Hll~ are: :M., '" 298.37, Orthorhombic, space group

Pnma [No. 621 Z 4, a'" 6.557 (1) A, b 7.117 (2) A. C" 35.650 (2) A, V 1664.0 (9) A3•de

1.191 Mg.m'l, ''1. (Mo Ka.) = 0.71073 A, ~ = 0.104 mm", 3205 measured reflecnons, 1616 unique

(R;•• = 0.0301) 1579 of which were eonsidered for calculatlon purposes 3$ obscrvcd wirh aa 1 ;;:20(I). Tbc crystallographie data were depQs.iled in the Cambridge Crystallographíc Data Centre

(deposit@ccdc.camac.uk) under accession number 232201.

RC$Ulu and Díscussíon

We investigated and characterized lhe antiproliferatlve activity of the coumarin (7-

geratl)'loxyooumarin), or aurapten, with a moleeuler mass of 298,37 s/moi agaiMt L. májor

Friedlin promastígotes lu axeníc cultures. As shown in lligure 2, L. major promastígote growtb

was significantly íllhibitcd 1»' aurapten, with an LD5U oí 30 p..M. '1'hi& valuc rcprcsenl$ a

significant inhibitory aetivity agaias! L. major and ís similar 10 those obtained for other inhibitors

isolated from Cllherplalllli (8). The negative control, eorresponding 10th.: parasite ín the presence

of DMSO, thc auraptcn solvent, sbowed no dctectable inhibition of gtowth, elteratíon in cell

morphology or motility ar lhe concentraíions tested.

116

Mosr studies directed at lhe detection of plant scccndary metabolites wiih lelshmanicidal

activily have been done U$ing lhe promastigote form of lhe parasite because of its easier

mainrenance under in vitro conditions, However, since lhe promastigote is not lhe infective Iorm

ar the parasito in vcrtebrate hosts, thesc evaluations have only a suggcstivc valuc of lhe possiblc

leislunanicidal activity oflbe compound tesred,

There are several active compounds obtained from medicinal plants traditionally used

worídwide for lhe treatment of leishmaniasis. Among these active molecules, described in lhe

recent literature are quinoline alkaloids, isoquinoline alkaloids, Indole alkaloids, terpenes,

acetogenins, and Iignans (9). Other natural compounds with antileishmanial activity are

coumarins, chalcones, lactones, tetralones, and saponins (9). 111e compound described here

belongs to thc class of lhe coumarins and its activity agains! Leishmania promasugotes is reported

here for lhe Iirst time.

To unambiguously assígn lhe structure ar this inhibitor and to gain insight into commonstructural motifs related 10 other cnumarins and other Ieishmania mhibitors, its crystal structnre

was determined, and several structural features emerged. This new information will be valuable

for the developmenl of a new anti·Leishmanía drug since resistanee to lhe currentíy available

drugs such as antímonials and ampbotericin B has emerged (3).

The refined molecular structure together wilh lhe atom-numbering Behemo is shown in

Figure 3. The molecule is a derivative of cinnamic acid Ihat contains an aromatic system with

elecrron delocalizatlon. 111e1'e is also li hydrophobic side chain consishng of teu carbon atoms

with two double bonds with negative density, Ali bond distances and angles are close 10 normal

values (l0,1l) and lhe molecule is planar, as can be seen in Figure 3. TIRe double weak

intermolecular ínteractions of type C-H O support lhe molecular packing (12) shown in Figure

4. They are lhe intermolecular C8··~IJ8 oi' and C6--H6 ... oz' [s}'mmetry code: i) 1+:\:,y, z]

bydrogen bonds between two neighbor molecules. The distance and dihedral angles between

donor and acceptor are 3.38 (1) A, 180 (5)0 and 3.27 (1) A, 172 (5)°, respectively, TIlc last ofllte

intermolecular hydrogcn bonds CS-H5 ... 02u lsYmmctty code: ii) O.Stx, ')', 1,S-zJ tinldng these

rwo ruoleculcs shows 3.34 (1) A of distance and 163 (3)0 of dihedral angle between donor and

acceptor, The planarity shown in 11Iemoleculareonfigw:ation and lhe intermoíecular interactionsare consístent with typical $1rttctural features observed in anlj·LeishmunÍa inldbitars e13·1S).

Figure 5 shows the L. major culture in lhe presence and absence oí the inhíbiror, Forty-

eight h afier lnoculation, a significant decrease in sut\1ving promastigotcs \Vai observed ín lhe

presence 01' aurapten (Figure 5b) at afinal concemration of 30 w.1. The surviving parasites

sll()\\'ed abnormal morphology ,\\;111the preseaee of largc vacuoles and low flagcllum motilily.

117

This preliminary cvaluation 01'auraptcn's acrivíty using promastigorcs yieldcd intercsting results

indicating that lhe compound should be investigared further as a potenrial antÍ-Leishmania

compound,

Acknowledgments

We would like 10 thank lhe members of the Protein Crystallography and Structural

Diolog)' and Bíophysics Groups (IFSC, USP) for helpful discussions during thc course of lhe

sludy. We would like 10 express our gratitude 10 the organizers of lhe ACA Summer Course in

Small Molecule Crystallography, August 4- t 3, 2003, for the single crystal díffractíon experimento

Reterences

J. WHO (1998). World IIealth Organization, htlp:/!www.who.intltdr/diseasesJleish!

diseaseinfo.htm.

2. McGreevy PD &. Marsden PD (1986). Campbell WC &. Rew RS (Editors),

Chemotheraphy cfl'arasitic Diseases. Vol. 1. Plenum Press, Ncw York.3. Croft SL (2001). Morntoring drug resistance in Leishmaniasis. Tropical Medicine and

International Health, 6: 899-905.

4. Carvalho PD &. Ferreira ElL (2001). Leislunaniasis p11ytotherapy. Nature's leaderahip

againstan ancient disease. Fttoterapia, 72: 59')..6) 8.

5. Elisabctsky E & Shanlcy P (1994). Ethnopharmacology ín tlw Brazilian Amazon.

Pharmaoology and Therapeuttos, 64: 201-214.

6. Zhai L, Chen M, Blom J, Theander TO. Christensen SD & Kharazmi A (1999). The

antileishmanial activity of novel oxygenated chalcones and their mechanism of actíon, Journal o/

Anümtorobial Chemotherapy, 43: 793-803.

7. Shcldrick GM (1997). SHELXL97. Rcfinemctrt oflargc small-molecule structures usillgSHELXL-92. In: Plack, IID. Pilrkállyi L & símon K (EdiIOTli), Crystallographto Computing 6.

Oxford UnivCl-sityPress, New York.

8. Chaa-Bacad M1 &. Pena-Rodrígues LM (2001). PIant natural producl$ with

leishmnnicidal activity. Natural Product Reports, 18: 674-688.

9. Akendcngue B, Ngou-Milama E. Laurens A & Hocquemiller R (1999). Recent advanccsin the fíght against Ieishmaniasis with natural products, Parasite, 6: 3-8.

118

10. Farrugia LJ (1997). ORTEP-3 for Windows - a version ofORTEP-lII with a Graphical

User Interface (OUI). Journal of Apphed Crystallography, 30: 565.

11. Allen FH, Kennard O & Taylor R (1983). Systematic analysis of structural data as a

research teehníque in organic chcrnistry.Accounts of Chemtcal Research, 16: 146-153.

12. Spck AL (2003). Singlc-crystal structure validation \vith lhe program PLATON. Journal

of Applted Crystallography; 36: 7-13.

13. Napolitano IID, Silva M, Ellena J, Rocha WC, Vieira PC, Thiemann OlI & Oliva G

(2003). Rcdctcrmination and comparative structural study of Isopimpinellín; a new inhibitor

against lhe Letshmania APRT enzyme. Acta Crystallographica, E59: 0I5()6....()1508.

14. Napoíftano IID, Silva M, Ellena J, Rocha WC, Vi eira PC, Thiemann OlI &, OIiv3 G

(2003). Redetermination of skimmianine: a new inhíbitor against lhe Letsbmania APRT enzyme.

Acta Crystallographtca. E59: 01503 or 505.

15. Silva !vi, Napolitano fID, Ellena J, Rocha WC, Vieira PC, Oliva G & Thiemann Oli

(2003). A potential inhibitor against Leishmania, 3-(5,7-Dimethoxy-2,2-dimethyl-21I-

benzolb lt»Tan-6-yl) propionic acid. Acta Crystallographica; E59: 01 S75-0 1S77.

119

Figures

SUlca Gel Chrom.Hexane/Ethyl Acet.Ethyl Acet./Methanol

ractlo

Silica Gel Chrom.Hexane, Methyl Chiar.,

Methanol

Silica Gel Chrom.Hexane, Methyl Chlor.,

Acetone

7..geranyloxycoumarin '(Aurapteno) 47mg

Figure 1. Fíow diagrant of dte aurapten Isolatíon procedere, Individual steps ate déscribed ia

Material and Mcthoos. The solventsused for elntion of lhe chromatography cotumn are listed inlhe boxes on the Ieft side. Acet •• acetate; chrom, '" chromatography; chlor. ee chloride. Sílica gel

columa cflluents were monilored by Tl.C to select fraclions for futthcr pUlification.

120

100

90

80

70

~ eoe...c: 50.2:ã 40:c.E

:90

20

10

OO 1 2 3 4 5 6 7 8 9 10 11 12

aurapten concentration (llg/mL)

Figure 2. Atlli1\1ishmanialactMty of aurapten againsl Leishmania major FriedJin promastigOlCS.CA'lI\swere cultivated in the presence of different concentrations 01' aurapten and counted aíter 48

h. l1\chcight of lhe bars indicares de percentsgc or growth inlúbition at eaeh concenrraríoncompared to lhe conrrol experiment containing only the aurapten solvem DMSO. The

experiments were performed three times indcpcndently and each counting was performed intriplicate, Data are reported as means ± SD.

121

1 r,

Figure 3. X-my ctystal100Jllphic structure ofthe aurapren. Displacement ellipsoids are sbown at

lhe 30% probabitity Ievel, Carbon and oxygen atoms are labeled for clarity.

Figure 4. A view of auraplen's pacl;ing showing C-ILO interactions. Symmetry codes (i) and

(ii) correspoad to {l +x, s. zland [Oo5+x, Y. 1.5-z1 respcctively.

122

11

Figure 5. Leishmania major promllsugote culture. Promastigotes were culturedin M199 mediumsupplemented wilh 10% fetal bovino sernm ar 26"e alld cell víabiliry was estimated by counting

in a Neubawer chamber after 48 1101' incubation in fhe presence or absence of lhe inhibitor, A,

Negative control without aurapten in lhe presence of 0.5% DMSO. 8, Condition containing 30

~tM aurspten and 0,5% DMSO. C attd D are expansions ar Figures A and R, respecnvely(indícated by lhe squares in A and B) showing lhe different morphological characrerisnce of lheparssite in tile presenee of aurapten, Vacuoles are indicatcd by the arrow,

123

1 In-vívo and In-vttro effeet of'feur compounds of Adiscanthus fuscifloms: Inhlbítlon of2 phosphoribosyl transferases ;lcth'it~,and antilelshmanial effeet,3

4 M. Silva' •C. H. T. P. Silva', W. C. Rochab, M. S. Castilho', P. C. Vieira", G. Olival and O. lI.3 Thiemann"(,

7 x Laboratory 01' Protein Crystallography and Structural Biology, Physics Instituto of São8 Carlos, University of São Paulo, USP, Av. Trabalhador Sãocarlcnse 4{){),PO Box 369,9 13366-590, São Carlos-Sl', Brazil. b Chemistry Department, Federal University 01' São

10 Carlos - UFSCar, PO Box 676, 13565-905, São Caríos, Brazil;II

12 * Conesponding authot- e-rnail: thiemanu@it~sc.usp.hr, Phone: (55- 16) 3373-8089, Fax:

13 (53-16) 3373·9&&1.

14

15 Objectives: The aim ofthis stud:r was the screeníng of nonll.eisllmm,in lnhíbitors,1617 Methods: PJant ertraets ofwere fl"actionated guided by APRT eOZ)'J11einhibition. The18 inhibitol'8 obtaíned were further tested lu XPRT and HGPRT enzymes, The19 antilcishmanial propertíes or the seleeted moleeules were anal}'Zed on in vuro L major20 pl'Ontalo"tigote,sculture in I-il-o. The Jnteractíons between útltibitol'8 and lhe enzymes21 were IlnalY'.loob)' computatíonal moleeular docklng.2223 Results: Iloul" selected allmloid$ ftnd eumarínes present inJubitory propenies lu both24 systents nsed, the bloehemlcal PRTasc assay nnd the ln ,,1tl'OLeishmauia inhibUion.2526 COl1cJuslons: The resulta rcported here conccming the inhibitiol1 or PRTase enzymes27 and IA major promastigote parasítes Indícate that the four natural moleeules selected28 can be further cxplolted as Iead rompounds in a ratlonal drug design approach or29 compound optimization against haman leishmaniasis.3031 Abbreviations: 5' -phospho-o-d-ribosyl-L' -pyrophosphate • PRPP;3233 Keywords: Leishmania, phosphoribosylíransferase, natural product, alkaloids, cumarine,34 Adi,scanhus tuscttlona.3536 Intreduetlen

37 lu countries of África, Asia, Middle East and Latiu America t leishmaniais has been

38 identífied as a serious public health problem by file World Health Organization (\VHO) and

39 the disease is also endemic in tire southern countries of Europe. lu the last two decades the

40 appearanee of cases of co-infectíon of AIDS and Leishmanta have added 11 new dimension

1

124

41 to the problem 2.3. 'lhe peopling of new habitats and thc increased human mobility has

42 taken leishmaniasis to regions previously unaffected, such as lhe North American region 4.

43 111Cestimated prevalencc of 12 million infected and 350 million lives IIt eminent risk of

44 infection reflects the global dimension to leishmaniasis as public health concem s.45 To oppose this scenario, new drugs and new formulations of old drugs are either approved

46 or on clinícal trial, rendering the current Ieishruaniasis cbemotherapy more promising tlU111

47 it has been for several years ". lu spite of the progress, antileishmanial drugs in use are

48 generalíy toxic, expensive and dcmanding long-term treatment with hospitalization, Those

49 aracharacteristics attributable to low target specifícity 7 and eontribute to a general

SO inefficaey of lhe eurrent treatment approaches. The new drugs and formulations may

51 alleviate, but is doubtfully alter significantly, the current global scenario -. Therefore, there

52 is a great and urgent need for the development of new, effective and safe drugs for the

53 treatment of leishmanlasis.

54 TIu: institution of a rational therapeuric regimen for lhe treatment of parasitic

55 diseases depends 011 the exploitation of fundamental biochemical disparities between

56 parasite and hest, One of the most striking metabolic discrepencies between parasites and

57 human is the purine pathway !I.II. Whereas mammalian cells can synthesize the purine

S8 heterocyele de novo, ali Kinetoplastida studied are auxotrophic for purines 12,13. In these

59 organisms lhe enzymes that enable the organism to scavenge host purines are the

60 hypoxanthine-guanine phosphoribosyltransferase (HGPRT; EC 2.4.2.8),. adenine

61 phosphoribosyltransferase (APRT; Ee 2.4.2.7) and xanthíne phosphoribosyltransferase

62 (XPRT; EC 2.4.2.22) 12.13. Unique features of lhe purine salvage pathway of Leishmania

63 and Trypanosoma constitute the basis for the susceptibility of these genera to several

64 pyrazelopyrirnidine analogs of naturally oecurriág purine bases and nueleosídes 1l.13-IS.

65 A rich source of nove! lead compounds for the drug diseovery process has beco the

66 sereening of natural compound sourees such as plants, animals and mieroorganisms. Brazil

67 isreeognized as a repository of a large, and mostly unexplored, biodiversity with a vast

68 potenlial to yicld novel therapy alternatives,

69 III the present study we used lhe Lei$hmanía I'RTase enzymes as targets to screen

70 tbe inhibitory capacity of several small molecules compounds from Brazilian plants. We

71 describe ín thís communícaiion four new PRTase inhibitors and theír respectivo

2

125

72 amilcisbmanial activíties. 11l.! sclcctivity ol'lhc compounds was tested against human and

73 Leishmania cells and the molecular basis for the compound inhibition was investigated by

74 molecular docking techniqucs with each Pk'Iase. Such systematic approach oí'

75 investigation identified lhe alkaloids and 11 cumarine as lead compounds and are used in

76 their further improvement.

77

78 Materiais and mcthods

79

80 Pnrificatton q[ enzymes and inhibitors. L. tarentolae APRT, HGPRT and 1_ major XPRT

81 enzymes were purified from Escherichta coli in recombinant expression systems as

82 described previously 16.17•

83 The skimmianíne, isopirnpinellin, y-fagarine and dictamine inhibitors were purified from

84 roots and leaves of Adisoanthus fusciflorus (Rutaceae) colleeted from lhe region of Manaus

85 in the Amazon Statc of Brazil, The purification protocol includes successive extractions

86 with hexane and methanol as deseribed previously 18.19. The struoture of the tested

87 compounds is shown in Figure 1.

88

89 Hnzymatic assay and inhibitor Screening. The AI'RT, HGl'RT and XJ>RT activity aod

90 inhibition assay were performed as deseribed previously in a speotrophotometric assay aí

91 lhe wavelengths of259. 255 and 254 respectively 20. The principIe of'the assay permits to

92 explore the rale oí' change in absorbance res\llting írom the ccnversion of the enzyme

93 specifie substrates to the resulting nueleotide. 111C nssays were earried out at 25"C in a

94 reaction mixture 01' 500 J1L containing the following reagents: 100 mM Tris-HCI pU 7.4,

95 100 Jt>.1PRI)P and 5 mM MgCh. lhe APRTassay contaíned 50 .~ Adcnine, HGPRT 40

96 J:tMguanine, and the X"PRT assa)' 50 ~f xanthine and no MgCh was added. Ali PRTase

97 reactíons were initiated by the addietion of ~nzyme to n final concentration of 2•.•.g!mL and

98 monitored during 1 mio for APRT and HGPRT and 30 seconds for XPRT assay,99 1110 screeníng 01' natural products with inhibitory activity against lhe Leishmania

100 Pltrases was perfonned in triplicate using the standard aetivity assay deseribed. The

101 illhibitors stock solutíons were prepared til dimethyl sultoxide (DMSO) at I mg/mL.

102 Further dilutions were performed in the assay reaotion buffer inunediately prior to use. Tbe

3

126

103

104105

106

107

108

109no111

112113

114

115

Il6

117

118

119

120

121

122

123124125

126

127

128129130

131

132

133

final conccntratron 01" DMSO in lhe enzymatic rcaction did not exceed 5% (v/v), a

concentration at which lhe solvem did not affect lhe activities of the PRTases tested,

Cell culture and inhibition assClJ'S. L. major promastigotes were grown in Ml99 (Gibco

Laboratories) supplemented with 10% heat inaetivated fetal bovine serum (FBS), 10 mM

adenine, 10 mg/ml, penicillin, 10 mg/ml, streptomycin, 0.25% haemin chloride, 0.1%

biotin and 1.0 M Hepes pI ( 7.5 at 26"C. '111einhihitory effect of each compound was tested

ín promastigote cultures at 1.5xI04 cells/ml, with and without inhibitors in 12 well plates, 2

mlJwell. 111e concentrations of inhibitor tested were 2.0, 5.0, 7.0. 10.0 and 15.0 I1g/mI.•.

Cells were counted in a Newbawer ehamber in six independent experiments after 4811

ineubation at 26"C. In ali experiments lhe final conc'Cntration of DMSO was kept lowcr

than 0.5% (v/v), a concentrarion that doesn't show evidence of affecting the parasite growth

rate, mobility or morphology 21.

Human U937 promielocytes (,,'0118 were used to test the seleetivity of the inhibítors, The

cells were cultured ín RPMI1640 media at 37°C in a 5% C{}zatmosphere. A concentration

of L5xlOs cells/ml, were ineubated in the presence or absence of ínhíbitors and DMSO in

12 well plates, 2 mlJwell, and counted in a Newbawer chamber after a period of 48b.

Growtb inhibition protection experiments were carried out as deseribed for L. majorpromastigote assays. lu each culture, in triplicate, were added 50J.lM and 500J.lM of each

purine (adenine, guanlne, xanthine and hypoxanthine) as weíl as lhe ínhíbitor

(skimmianinc. dietamine, 1'-fagarine and isopimpinellin) at the LDso concentration of each

compound. Controla without inhibitors with added purines and with inhibitors in the

absence of'purines were performed in parallel.

Docking procedure. Docking simulations were performed with the (',oLD 2.1

software 22. which does flexible doeking lISing li genetic algorithm, 111eparameters used in"this algoritlnn were originally optimized from a set of 305 complex struetures with

coordinates deposited in tbc Protein Data Bank (PDB). Among lhe pararneters llvailable in

the programo we used a population equivalem 100000 operations, 95 mutatións and 95

crossovers, Docking ealculations were done in the interior of spheres of 15 A radiua with

origine at: AlaS() (Cj3 atom) of lhe APRT strueture; Asp126 (001 atom) of the HOPRT

4

127

134 structure and ValI21 (C'{J atom) of the XPRT model. The ten orientations of highest score

135 for each compound W':"'fC then selected using the score Iunction denominatcd Goldêcore.

136 On lhe basis 01' this function, lhe program classifies the oricntations 01' lhe moleeules in a

137 decrea sed order 01'affinity (score) with me Iigand site ofthe receptor.

138 Before the docking calculations and after remova! of ligands aud the

139 crystallographic waters from the active sites ofthe APRT and HGPRT structures, as well as

140 the XPRT model, we added and oriented hydrogens of the side chains aflita residues of the

14 J respeetive aetive sites. Charges and atomic potentials were assigned to me protein

142 structures and model using the Insight 11program 23.

143144 Results145

146 Eifocl of isolated compounds on lhe inhibtnon of Leishmanta PRTases. The recombinant

147 APRT enzyme from Letshmania tarentolae was used to guide the purifícatíon of novel

148 PRTase inhibitors In this approaeh we screened lhe inhibitory activity of 1.126 extractss

149 from Brazilian plants, the best four inhíbítors selected from Adiscanthus fusctfloru«

150 (Rutaceae) are shown in figure 1. '111e inhibitors selected using the Leishmanta APRT were

151 then tested for their inhíbitory capacity in nGPRT and XPRT enzymatic assays sinee it will

152 be interestíng from the standpoint of a lead compound to be able to inhibit all three

153 enzymes simultaneously. 111e inhibitory activity of each seleeted compound (Figure 1) on

154 the three PRTases and on lhe L. major promastigotes are shown in table I,

155 The eflect of eaeh compound 'isolated from A. fuscifloms 011 the Letshmanta PRTases is

156 shown in Figure 2. Ali 4 ínhibirors exhibited a clear linear concentration dependem effect.

157 ln comparison wíth the control experimenta with solvem (DMSO) alone the compounds

158 showed a signíficant eflbct 011 the PRTases activity (p<O.05).

159 A correlation of dictarnine, r-fagarine and isopimpinellin inhibitory effect OVer each

160 PRTuses ís observed. Skímmianíne however'showed a distinct seleotivity for both XPRT

161 and HGPRT. whereas it inhibíted APRT activity at a similar level asthe other three

162 cornpounds,

163 The leso calculated for each inhibitor agaínst lhe PRTa.'les was caleulated and is shown in

164 Table1. The inhibitory effect of skimmianine 011 I1GPRT and XPRT activity is 100 fold

5

128

165 higher as its activity with APRT. Ali other ccmpounds show a similar inhibitory activity

166 over eaeh PRTase, reflecting a low selectivity of'those inhibitors for lhe enzymes.

167

168 ElTéc( (I' isolated compounds on lhe in-vttro growth cfLeishmania 11/(90r promastigotes

169 and human promyeloctte cells. Figure 3 shows the effeet of the alkaloids and lhe cumarine

170 on the ín-vitro growth of L. major promastigotes. Ali four compounds exhibited a clear

] 71 concentration-dependent inhibitory effect, III comparison with lhe control, the compounds

172 showed a significant inhibitory effect on the in-vitro growth of L. major promastigotes at

173 concentraíion of20 pg/ml, and above (P<0.05).

174 Table I shows the U)SQ values of the four compounds 01\ the in-vitro growth of L. major

175 promastigotes and human promielocytc cells. The LD5fJ values on the prornastigote and

176 human cells are equal, reflecting a lack of oellular selectivity. A small difference is though

177 observed on the effect 01' skimmianine, that shows a redueed eífeet ou L major

178 promastigotes (LD5O""98~M) wen oompan ..•d to the human cells (245Jl~f).

] 79 Control experimenta have been performed to evaluate the effect of DMSO on the growth of

180 lhe L. major promastigotes and human promielocyte cells. No significant Ievel of growth

181 inhibition was detected at the concentrations used in the tests as well as no morphological

] 82 alterations were observed by phase contrast microscopy (Data not shown),

183

184 Effcct of lhe addttton o[ purines to lhe Letshmama eu/fure. The observed bíochemícal and

185 eell culture eífeets of the eopounds is not obviously a linked phenomeaon, To ínitíally

186 idcntify anycorrelation we used lhe addition of purines (adenine, guanine, hypoxanthine

] 87 and xarahine) to lhe cuhure media in an nttempt to identify a possible protection or survtvo!

188 rescue that could be suggestive of a correlation between the bioehemical and cellular

189 observations.

]90 Table 2 shows the inhibitory effect (iu % gro'\\1h inhibition) of each a1akaloid and cumarine

191 in the presence of two differentcolllXntralions 01' puriues, 50plof and 500pM cacho Except

192 for dictamine; the other compounds (skimmianíne, isopimpinellin and r·fagarine) aífected

193 less severely tllegrowth ofthe parásites, The data is preliminary, but reveals an interesting

194 possibility of correlation.

195

6

129

196

197

198

199

200201

202203

204205206207208209210

211

212

213

214215216217218

219

220

221

222223

224225

226

Molecular fitness of tbe isolated compounds in the PRTase acttve site. To obtain a

molecular understanding of the type of interactions occurring between the alkaloid and

cumarinc compounds and lhe targetcd enzymes, molccular docking cxperiments werc

perforrned. Those experiments used as targct molecules lhe molecular structurcs of lhe

Leishmania APRT and HGPRT and lhe molecular model of lhe Leishmania XPRT

determined in our group 16.11. lu general, lhe docking results obtained with GOLD 2.1

(Table 1) for lhe compounds here studied agree with the enzymatic inhibition experimente

shown in 'fabio 1.

Clear interactions of each inhibitor with amino acid side ehains are observed from

this analysis. The top scoring interactions are shown io figure 4a-c.

Discus..'Iion

Scientífic evolution of medicinal plants has, in the past, provided lhe basis of

modem medicíne. Several compounds from higher plants are currently being evaluated in

various laboratories as potential antiparasitic agents for malária, trypanosomiasis and

leismaniasis 24. The search for bioactive molecules normally begins with the sereening of

severa I plant extraets, isolation of bioactive fractions and identification of the active

componente when feasible 25. MOl>1 of lhe studies directed toward the detection of plant

secondary metabolites with lcisbmanicidal activity have been done using the promastigote

form of the parasite due to the facility to maintain under in vttro condítious 16. In spite of

that one of the critica! points of the Ieishmaníasis phytotherapeutical research is the lack of

good and rapid sereening methods to find potential plants and to evaluate them 27. For a

rational drug desígn approach il is paramountto understand lhe molecular target enzyme

whose inhibition is intended, The enzymes of the purine salvage pathway have been

considered as appropriate targets by different laboratories 9-12. lu this context, the inhibition, . .

01' the three phosphoríbosyl transferases (PRTases) of the pathway; adenine, guanine-

hypoxanthine and xanthine PRTases, is necessery, We present in this paper four nCW L.

major prornastigotea inhibitors with bíoactivíty similar at Pentostam, a commercial

leishmanicida 21. Although of moderare inbibition capaeity 26, their selection process

represents a novel approaoh, This strategy permitted usthe selection alld isolation of

7

130

227 alkaloids and a cumarine, whieh are the most importam group 01' natural compounds with

228 antileishmanial activity 24. In recent years a few attempts for screening medicinal plants

229 uscd for lhe treatment 01' leislunaniasís havc been carried out in Spain, Sudan and Guinea-

230 Bissau. These studies have confirmed lhe irnportance 01' mau)' plam species as potcntial

231 source for the isolation 01'novel compounds with leishmanicidal activity 26.

232 All four compounds (Figure 1) selected from our screening approach showed an inhibitory

233 activity against the Leishmania PRTases in a concentration dependem manner (Figure 2).

234 The inhibition effect ou eaeh individual PRTal>c ís very similar for dictamine.

235 isopirnpinellin and y.fagarine and varies from an IC~ of 260J.11'vf ror dictarnine against

236 APRT to 80llM for y-fagarine against HGPHT (Table I). The inhibitor skimmianine

237 however, presented a marked seleetivity for XPRT and HOPRT (1.1 J.lM and 1.8 ~IM.

23& respectively) over APRT inhibition (142 f.lM).

239 This selectivity 1S also revealed, although to a Iesser extent, in lhe in-vitro Leishmania

240 promastigote and human promyelocite culturc assays. From the four inhibitors selected,

241 only skimmianine has shown a small selectivity (2.5 fold) egainst Leishmania cells (LD50

242 of98 ~IM) over human promyelocite cells (LD50 of245 ~lM) as shown in table 1. This result

243 doesn't mean that the compounds are acting specifically 01\ the PRTases in-vivo, but it

244 representa a first indication that they may be good starting eompounds, In an attempt to

245 understand if there is a correlation between the biochemical inhibition of the PRTases and

246 tbe growth inhibhíon of promastigotes severa I experiments must be performed in the future.

247 An initial experiment trying to proteet lhe promastigote cells from the purified compounds

248 using a mixture 01' purine nucleotides in the eulture media revealedthat with lhe exception

249 of dictamine, the other alkaloids (skimmianíne, and y-fagarine) and the cumarine

250 isopímpinellín, affected Iess severely lhe growth of the psrashes (Table 2). lhe data is

251 preliminary, but reveals an interesting possibility of correlation.

252 Ali three alkaloids and the cumarine represent lead compounds that can be interesting

253 starting poínts ín a ratíonal based drllg d~ign approaeh, For this sim, we used lhe

254 molecular docking teehnique to address the imeraetíon of'eaoh inhibiror with each PRTasc.

2SS III general, lhe docking resulta obtained with C'JOLD 2.1 for lhe eompounds here studied

256 agree with the enzymatic inhibition experimente shown in Table I,

8

131

257 Concerning APRT. thc experimental affinity order for the activc site is thc following:

258 skimmianine » isopimpinellin > y-fàgarine » dictamine. In other words, skimmianine and

259 isopimpinellin have similar leso valucs and lhe)' are above lhe values obtained for 1-

260 fagarine and dictamine, This last compound has the lowest and far IC5(j "alue amongst ali

261 the inhibitors, From the Table ]) the Goldxcore of lhe compounds concerning lhe APRT

262 strueture is very similar to the order obtained in the experimental work, lhe fitness of both

263 the skimmianine (46.11) and isopimpinellin (45.97) with the enzyme 1S very similar and

264 they are higher than lhe scores obtained for y-fagarinc (44.28) and dictamine (42.42).

265 Analyzing thetop-ranked solutions obtained with C'JÜLD for these 4 compounds inside ale

266 APRT active site, dictamine is the only molecule that does not perform any strong

267 hydrogen bond with residues of APRT, theoretically. Skimmianine is hydrogen bound to

268 both the conserved Lys102 and Lys105 residues, Similarl)', isopimpinellin has strong

269 hydrogen bonds with the side chain of Arg316 as welí as lhe side chain of Lys 102. Ou the

270 other hand, the GOLD result obtaincd forj-fagaríne suggests that this molecule interaet by

271 hydrogen bond with the LyslO2 side chain. Top-ranked solution of skimmianine inside the

272 APRT active silo is shown in Figure 4a.

273 Concerning HGPRT, the experimental ICso values (Table 1) reveal skimmianine and

274 dietamine as the best and the worse inhibitofS, respeetively. Our theoretícal resulta (Table

275 1) agree with the enzymatic inhibition experiments, suggesting skimmianine as the ligand

276 with highest Goldâcore (37.91). Ou the other hand, dictamíne has the lowest score (34.93)

277 and could be theoretically lhe worse Inhíbitor, Analyzing the top-ranked solutíons obtained

278 with GOLD for these 2 alkaloids inside the HGPRT active site, skimmianine is strongly

279 hydrogen bound to lhe nitrogen atom of'the ASPI29 main chain (Figure 4b).

280 Concerning XPRT, our docking resulta (Table 1')suggest skimmianine as the best inhibitor

28t (Goldâcore = 49.95). ln fact, the experimental IC~o value obtained from the XPRT

282 inhibition with this alkaloid is the lowest (1.1 ILM) amongst ali the 4 inhibitors (Table 1).

283 TIw GOLD top-ranked solutions for skimmi~nine iriSidc the XPRT actíve site suggests a

284 strong hydrogen bond between the nitrogen atom of'tbe ASP123 main chain of the enzyme

285 and lhe oxygcn atom of'the furane rins of'the inhibitor, whieh are separated by a distance of

286 2.3 A (Pigure 4c). 'file results obtained with GOLD for XPRT must be analyzcd with a

9

132

287 certain caution because we have used a homology model and not a structure obtained by

288 single crystal Xvray diffraction techniques.

289 lu couclusion, three alkaloids and li cumarine havê bcen selected by biochemical assays

290 directcd towards lhe Leishmania Pk Tascs and furthcr characterized by theír ability to

291 inhibit the growth of L. major promastigotes in culture. A parallel experiment testing their

292 selectivitywas performed with human promyelocite cells,

293 The correlation of'the bioehemical data withthe culture data has been preliminary obtained

294 by demonstratíng 11 protecting effect of li mixture of purines in the presence of lhe

295 inhibitors.

296 Furthermore, a rnolecular doekíng analysis has been performed to access the struetural

297 elements involved in lhe binding of eaeh inhibitor to lhe active site of each Pk'Iase,

298 indicating the structural elements involved in selectivity and binding for further exploration

299 ín a rational drug enhancement program,

300 Those compounds isolated from a Brazilian plant show prormsmg results as lead

301 compounds for future studies toward the development of an effective antileishmanial

302 compound.

303

304 Acknowledgmcnt

305 This work was supported in part hy a researeh grant 99/02874-9 to O. H. Thiemann and

306 98/14138-2 to G. Olivs (FAPESP). MS receíved a scholarship from FAPESP (# 00/14709-

307 1). Wc would Iike to thank U1C members of lhe Protein Cryslallography and Struetural

308 Biology Group (lFSC-USP) for helpful discussions in the course ofthis work,

309

310 Referellces311312 1. UNDp/WB!WHO (1989). The Leihmaniasis. In Tropical Diseases: Progress in313 IntemationaI Research, 1987-1988. WHO speeial prognun for research and traíning314 in tropical diseases ninth program report, World Hcalth Organizatioe, Geneva,315316 Z. Olliaro, P. L. & Bryceson, A. D. M. (1993). Practical progress and new drugs for3 I 7 ehangil1g pattems of leisbmaniasis, Parasitology Today. 9, 323·8.318319 3. Alvar, 1.. Gutierrez-Solar, B., Pachon, I., Calbacho, E., Ramirez, M., Valles, R. et320 ai. (1996). AIDS and Letshmonia infantum: new approaches for a new321 cpidemiologica1 problem, Clouos 111 Dermatol<fgY. 14, 541,..6.

10

133

I F S ( U S P SEHVIÇO DE BIB~IOTECl'.• INFORMAÇAO

322323 4. Enserink, M., (2000). nas leishmaniasis becornc endemic in the US? Sctence. 290,324 1881-1882.325326 5. Modabber, F. (1993). Leishmaniasis. In Tropical Disease Research. Progress327 J991- 92. (UNDPíWorld BaukfWHO special programme for research and training328 in tropical diseases), pp. 77-87. World Health Organization, Geneva.329330 6. Croft, S.L, Urbina, 1./\.& Brun, R. (1997). Chemotherapy ofbuman Icishmaniasis.331 lu Typanosomiasts and Leishmantasis CAB InternationaI24S-S7.332333 7. lwu, M.M., Jackson, 1., E. & Seuster, B.G. (1994). Medicinal plants ín the fight334 against leishmaniasis. Parasitology Today. 10, 65-ft335336 8. Simon, C., L. (2001) Monitoring drng resistance in leishmaniasia, Tropical337 Medicine and International Health. 6,899-905.338339 9. Hyde,J.,E. (1990) lu lIydc,J.E. (ed.), Molecular Parasitology, Vau Nostrand340 Reinhold, New York, pp. 181-228.341342 10. Hassan, H., F. & Coombs, O., H. (1986). A comparative study of the purine- and343 pyrimidine-metabolising enzymes of a range of trypanosomatids, Comparative344 Biochemistry and Physiology Part B: Biochemistry and Molecular Btology. 84B,345 217·223.346347 11. Berens, R., L., Drug, E.C. & Mau, 1., J. (1995). Bioehemistry of Parasitíe348 Organisms and Its Molecular Foundations (1.1. Msrr, M. Muller, eds), Academic349 Press Limited, London, 89-117.350351 12. Ullman, 13. & Carter, D. (1997). Molecular and blochemical studíes OU the352 hypoxanthíne-guaníne phosphoribosyltransferases of the pathogenic353 haemoflagellates. Intemauonal Journal of'Parasitology. 27, 203-13.354355 13. Ullman, B. & Carter, D. (1995). Hypoxamhine-Guanine Phosphoribosyltransferase356 a.s a Therapeutio Target in Protozoal Infections, Irfectious Agents and Disease. 4,357 29-40.358359 14. Hochstadt, J. (l978)Methods Enzymol; 51,558-67.360361 15. Palella. T., D. & Fox, 1., H. (1989)' In Scnver,C.S,. Bcaudct,AL, Sly,\V.S. and362 Valle,D. (eds.), The metabolic basis of ínherited diseases, MacGraw-Hitl, New363 York, pp. 965-1006.364365 16. Silva, M., Silva, C., H., T., P., Iulek, 1., Oliva, O. & Thiemann, O., H. (2003).366 Crystal structure of adenine phosphoribosyltransferase (APRT) from Leishmania367 tarentolae: potential ímplicanons for APRT catalytic mechsnism, Blochlmlca et368 BíophysicaActa.16%.31-9.

11

134

369370 17. Monzani, P .• S., Alfonzo, J.. D. Simpson, L., Oliva, G. & Thiemann, O .• H. (2002).371 Cloning, characterization and preliminary crystallographic analysis of Leishmania372 hypoxanthine-guanine phosphoribosyltransfcrasc, Biochimtca et Biophysica Ael.373 1598,3-9.

374375 18. Napolitano, H., R., Silva, M., Ellena, J., Rocha, W. C., Vieira, r.C., Thiemann, O.376 H. & Oliva, G. (2003). Redetermination of skimmianine: a IlCW inhibitor against the377 Leishmanla APRT enzyme, Aera A era Crystallographica. r'..59, 1503-5.378379 19. Napolitano, H., B., Silva, M., Ellena, J., Rocha. W. C., Vieira, P. C.• Thiemann, O.380 H. & Oliva, O. (2003). Redetermination and comparative structural study of381 isopimpinellin; a new inhibitor agaínst the Leishmanta APRT enzyme, Acta382 Crystallographica.E59 .•1506-8.383384 20. Tuttle, J.,V. & . Krenitsky, T.A. (1980). Purine phosphoribosyltransferases from385 Leishmanta donovani, Journal of Biological Chemistry. 255, 909-16.3&6387 21. Zhai, L.. Chen, .M., Blom, J., Theander, 1'. O., Christensen, S. B. & Kharazmi, A.388 (1999). 11w antileishmanial activity of nove! oxygenated chaleones and their389 mechanism of action. Journal of 'Antimicrobial Chemotherapy. 43, 793-803.

390 22. Verdonk, M. L., Cole, J. C., Hartshorn, M. J.. Mulrray, C. W. & Taylor, R. D.391 (2003). Improved Protein-Ligand Doeking Using COLO. Proteins. 52.609-623.

392

393 23.!n!{ÍghtlI User Guide, (1997). Aceelrys Scientific Support. 97, 1-103.

394

395 24. Akendengue, R., Ngou-Milama, E., Laurens, A. & Hocquemiller, R. (1999). Recent396 advances in the figbt against Ieishmaniasis with natural products, Parasne. 6,3-8.397398 25. Zerehsaz, F., Salmanpour, R.. Handijani. F. et ai. (1999). A double-blínd399 randomized clinical trial ofa topícal herbal extraet (Z-HE) V5. systemic meglumine400 antimoniate for the treatment of cutaneous Ieishmaniasis in lran. Imemational40 t Journal of'Dermatology. 38, 610-12.402403 26. Manuel. J. C-B. & Luis, M. poR. (2001). Plant natural products with Ieishmanicidal404 activity. Natural Products Reports. 18, 674-88.405406 27. Paulo, R. C. & Elizabeth • I. F. (2001). Leishmaniasis phytotherapy namre's407 Ieadership agaillSt a11ancíenr disease. Fttoterapia: 72, 599-618.408

12

135

409410 FIGURES411412

413414415416

B OCH3

~

'<:::::

~

OCH)

O OCH3

Figure 1. Chemical structure of'isolated compounds. (A) Dictamine (B) y-fagarine (C)isopimpinellin (D) skimmianine.

13

136

417

1001901

i=jl.5 50-ç. ~()

:iO~~·~~~~~~·~~~~~O~S~~

Oictamine V·F~ $kí_ •.•• lsopimp"*n

XPRT Contro! - DMSO

2o~~1.~1~a~so~n~~~~~~~~10~1~,~"~n~

Al'ItT XPRT HGI'RT

418419 Figure 2. Effeet ofthe four oompounds on the Leishmania PRTases. The results are from420 six experimenta in triplicate and are given as percentage 01' inhibition. The vertical lines421 represem the amplitude of the standard deviation from the statistical analyses of the422 obtained menu. DMSO-Control: Control experiment of inhibitory effect of DMSO on the423 enzyme activity, showing a much reduced effect even at the higher concentration of70 11M.424 The numbers in each bar indicate the concentration of the compound tested, 10 ~IM, 25 11M.425 50 ft!vf and 70 fl~t

14

137

426

100

90

~ 80_!:1l'lil 70

[60•...[50..j 40c

.Q;ê30s:.\;;-- 20t.

10

- r+- ri-

~

.ri-1- J + ri- +1

t rI- ri-- ,+ri- ri- r+-..

i i i i m i i .. I i i i i iI J \a :,! 2 ~ ~ 2 :e ~ .. l! :,! 2 :!! ~oIsopImpinellin Sklmnuanine

427428 Figure 3. Effect of the four isolated compounds on lhe in-vitro growth of L. major429 promastigotes. Promastigotes (1.5 x 104 cellsání.) were incubated ín the presence of430 compounds for 48 h. The resulta are Irem six experiments in triplicate and are given as431 percentage of inhibition. 'file vertícal lines represem the amplitude of the standard deviation432 from the statistical analyses of'the obtained menu.

15

138

433

434435

436437

438439440 Flgure 4. Top-ranked solntíon obtained with GOLD for (A) slómnúanine-APRT complexo Selected441 residues ofthe active si1eare shown, with the hydrogen bonds represented by tÜlShedtines in yellow442 with theLysl02 and Lys105 residues. (B) skimmianine-HGPRT complexo The.hydrogen bonds are443 represented by dashed tines in yellow with the Asp129 and Lys157 residues and (C)skimmianine-444 XPRT complex. Hydrogen bonds represented by dashed lines ín yellow with the TytS9 and Asp123445 residues,

16

139

446 TABLES447448 Table 1. Effect of 4 compounds on the enzymatic activity of PRTases, L. major449 promastigotes, human ecll and top-ranked solutions obtaine ..ed with GOLD 2.1 interactions.450451 "111e results of lhe enzymes inhibition are from three independent experiments in triplicate452 and measured by spectrophotometric method at the wavelength 259, 255 and 254

• Enzymes IC5(I(JlM) Enzymes Gold..score Cell cultures L050(JlM )Compounds 1---===-..,....,=

APRT X HGPRT APRT PRTT5ictã!;line 262 "2Sõ'-" '''42AfIsopimpmellin 142 142 45.97 46.76 35.64 25 20

Skimmianine 142 2 46.11 49.95 37.91 245 98

y-fugarine 151 120 82 44,28 43.18 35.02 70 69

453 respectively .454 b The results 01' the in-vitro inhibition of mammal cells are from two independent455 experiments in tríplicate and measured by Newbauer chamber,456 c The resulte of lhe in-vitrc inhibition of L. major promastigotcs are from six independent457 experiments in triplicate and measured by Newbauer chamber,458459460461462463464465466467468 Table 2. Effect of'the additionof'purines (adenine, guanine, hypoxanthinc and xanthine) ou469 the protection ofL major promastigotes against the four selected compounds,470

PUMe concentration Sklmmlanlne Isopimpinellln y.Fagarlne DictamlneOIJM O a o o

5O\JM -8 -55 -220 7.4500IJM -650 -122 ·80 o..471 The resulte are presented m % inhibition oí' gro\\-1h oompared to the no punnes added

472 experiment, The negative numbers represem â stimuletion of growth.473

17

140

510 J ,vat Prod 2()().1,67 51()-522

Reviews

ChaIlenges and Rewards of Research in Marine Natural Products Chemistry inBrazilJi

RobClto C. S. Borltnck."! Eduardo I Iqjdu,' Rosana M. da Rocha! .Jaíno H. H. L de Ohveíra.!Isara L. C, lIernandez.lMírna J L R. Seleghtrn.' Ana Claudia Cranato.! Éríka V. R. de Aímelda.'Cecília V. Nunez.1 Guilherme Munry.' Solange Peíxtnho.! Claudia Pessoa,' Manoel O. Moraes,"Bruno C. Cavatcantt," Glsleuc G. F. Nasetmeuro.» Otavio Tluernann.v Mareio Sllva.'-' Ana O. Souza.Celto L. Stlva.? and Paulo R. R. Mmaruu"

Instituto de QulmJc~ de Silo Cnrlos. Unínusidad", de Suo Paul". CP 780. CEP 13560·970. Silo Cerlos; SP. Bruzit. MuseuNttt:i<lluj!, t.tlli\:rl'sfrJo(/t" Ft!dI!Y'i1l da RkJ lk~ .hJlud,.o~ (Jr.IÍTitit rtn 8wJ Fí.sl.U.!~/fI# 20940·tJ4t1. Ria dt:' .Innelro, RJ"8nuilDeparunncmo do Zoologi«. !../nÍversi<fad.,f«k'mJ dtJ Paauu». Cemro P<l}j(C<;I1Í(:<l. 8J .531 .!)!J(). CP /fJ(12l1.Curitib«. Pal"illlà.Bmzil. Deperuunano de Biologia. Urüvorsidode F<-d""aJ t:R4 &!JhkJ, Sall'ad(q~ BA. Breri). L,~bcràtbd<l de OJ'loo[ogíaE'xpeâmet1rn1. Universided« FM#'aJ do C•••••rã. Foruslez«; CE. 8J-aziJ,Faculdade de CR-t'JCJJ.sda Saude. Ullivl.'NiwUR-Al(fwdi.ff,' de Pír:u:ícab.1, PiJ'àt:.'JblJ. oSP, Bmzi). Insrituto * Fit.ica di' São C.lrlos, lJnil't-l'Sld:uk de $."10 Paulll .• Sâo Carlo;;. SI'.Br.3ZiJ, eod J:Jep.1l'Uimcnto *Bioquunica t' lmufloJogia. P'<>c.Jda<k *Af<.dicln., de Ribcirac Preto. Unil'crsídadc' de Sào Paulo,Ribciráo PI'C!W. SI'. BJ-aziJ

J«,ai\"f!'d Sli'ptli'mbcr 25. 2003

BrôzjJ ts hlessed wtth a great btodtverstry. whtch consttrutes one of fhe mosr unportanr sourees ofblllloglcalJy actlve cempounds, even If I1has bf.én laffle1y underexplored, As ls the case ti! the Amazonand Auanuc ramforesrs. the Braztltan martne fauna rernatns praeueally unexpíored In me searrh fornew btologlcally uctive: natural products. Constderíng 111mmaríne organlsms have been shewn to be oneof lhe mos! promtsfng sources <Ir IlClWblrlllniw rmnp<lllllds ror the trentment of dtfferern 11uman dt~N1SL"',rhe 80!Xl km of rhe Brazíltan roi\stlln" represents a gmat pctentlaí for flndlng new pharrnacotogícallyactlVí, secóndalY rnetabollres. Tbls I'"vi"w presants lhe starus nf martne natural products chenusrry ínBraztl, tncludlng results reportod by dilT•.reut research groups wuh ernphasls 011 lhe tsolauon, structuruelUCldallon, anel evaíuauon ar bíologlcaí acuvtues of natural products tsotated Irorn sponges. aseídtans,oeroeorats. and Opísrobranch mollllsks. A brief'uvcrvíew ofrtw. Iírst Brazífían progrnm on rhe isolatlon ofrnaríne baerería and fung!. dírected toward the producuon ar blologlcally acnve compounds, ts alsodtscussed, The curtem muludíscípünery collaboratíve program under development at the Universidadede São Paulo proposes to establísh a new paradígm roward the managomcnt of tho Brazílían marínebíodlversíty, integrating research 011 lhe spectes drversíty, ccelogy, taxonomy, and biogoography of marínctnvertebrates and rnlrroorganlsll1s, Thts pmgram also includes a broad sereeníng program of Brallll<lIlmartne btoresources. W search for ecuve compounds uiar may be of ínterest for the deveíopment of newdrug leads.

IntrodudionFrem •• hlstortcal perspectíve, 8t'rgrrl<uU\'s reports on

sponge sterols! and nucleosldes2 are eonstdered rhe startlngpotnt of martne natural products chermsrry, However,Tahara's studícs on the nature of Tntraodonudae nshpotson (tetrodowxlns).l the mvesttganon cf'sterols from thekíngdom Antrnalta by Dorée4 end Henze,s and the studyof caretenotds from marlne animais by Lederer' cannor beoveríooked, But ít WU$ (111)'durtng the 1960:>(hal conunu-

•n...w OQ •.!t" M.tthcw Suffn••• :\wa"llocWr" presemed a, lhe 43rdAMual M<HtI"8 De u •• Amori<.n Sotkoly "'1'1""''''''''11',0»' •••<1Úse l.<lMon_ W.U S)'IIl"""lum.N_Brun~'kk. NJ. July27~31. 2002,D<dk.tooto tlw 50 ",a~ of tbe c"ntro <Icl3lolog!. M",inb. or til. Unlv••.•kb<lc <IcSão P""lo.

'To ",1_, ••••.•.••".._ • .n....ldbe .ddt,,_. r.l: +55·\lh?1399S4.p",,! -+55162739®Z. E"'''''II: '8.t.o'11••ck<1Jqoc••••pbl'.

, tn.uru<" do Qtdlt'Ka do $1. c....to>, U••I' •••••ld'.Ododo s•••P.uIG., 1>"._ N ••••"'nAl.tJnlv ••.• kbd> Podor.! dó RI<>do 1'''''''0.t ~"t1t~tu()tk ~~. Un'wnid8:c~ PMltwál d!:.PlultuA.i Depattam •••to do 1'l1<>1<>@l. lint""hkIodo 1".",,,,,,1 do 00111>.',,.,.J,.n.,.1<lrJo do>~ &"",1" •••.•"'1. U,d""",ld.d. 1'•••• ,.1 do <:00.10.* •.•"",1<1••.1. do>Ciê(.<!,..d. &tldó.I.J •• ,,,,,I<I,koclo M.loo;••,. do>1'I""d ••••• ,Q In,(.l(Qtq ck f'l •.k_ • $,", C:UIOl~Uulwr:J:ltf* do »~P.-.•.•lo.9 o.p;oru>m~nto"" .BIoqufmk •• Imvncolotlta. P.<uld."" "" "~<In. ""

Rft>tlit-iío·Pt'~I-4.

OI.lS research oí manne natural products began, maínly dueto the advanees in the tnstrumenrarton for srructureeíncídatíon auá ísolauon techníques as well as lhe avalioablllty of scuba for ccllectten of maríne organtsms, Hígh-llghrs of lhe achievNnents 111manne natural producrs havebeen rccently revíewed and tllu$ll'nte the structural CQUI-plmdry and potenr bíologícal aenvtnes of Ilwny naturalproduets tsotared from dl1:'furent urganlslllS of the martneenvtronment.! Although Brazll has the second mos! éXW~l$I\<" coastltnc aftcr Australía, üw development of theehomístry af martne orgatúsms from Brazíl has beenhampered for many years beeause lhe maín Iocus ofBraztlían natural products chcnusts has been dírec ted wlhe study of medíctnal plants and plant chemoraxonomy.

ChalJéngésBt'azilian Geógt'3(1by: The Impact on Mal'lne Bi6di

vel',sity. Bl'n:r.U 11I',r;3 roast ulXllIl 80!Xl 15m ill lengtl'l.adJaccnt W o\'el' 800 000 kn~ orcolltlnenlal shelf, sproadingtrem 4" N ar Cape Oran.ge w 3••° S at Chu1. A dMslon (:IrthiS "tiSt MM [nu. !\e('tórs 11lI$ bef,n pmp<lSkl baS«! ()Il

I'rilnarUy geologlc and geographle Cril:l!ria.M w(, haw

#I 2004 A",,,r"',,,, Cht>ffilcal Somty and Ameri<wl Sodc!ty Ili Pharrna«>gl105Yl'ubli$hoo on Web OIJ2mOO~

tO.I021/np030·1316 CCC: $27.50

141

Para acesso ao artigo completo entre em contato com o

autor ou com o Serviço de Biblioteca e Informação -

IFSC - USP (bib@ifsc.usp.br)

Capitulo V

Conclusões

Os trabalhos apresentados nesta tese são referentes a uma das linhas de

pesquisa que eu coordeno. Esta linha de pesquisa visa o emprego da estrutura

molecular e da busca por inibidores na biodiversidade brasileira. Essa busca tem

como objetivo obter novos inibidores das enzimas alvo que possam ser estudados

por processos de Docking e técnicas de química medicinal.

Os trabalhos se iniciaram com a clonagem e caracterização das três PRTases de

Leishmania de interesse para o projeto, a APRT, HGPRT e XPRT. Foi iniciada em

paralelo a clonagem e caracterização da APRT humana, visando não somente

obter o conhecimento de sua estrutura, mas também para ser utilizada em testes

comparativos de inibição com a APRT de Leishmania major.

Desse esforço resultou a publicação da estrutura cristalográfica das APRTs de

Leishmania e Humana, a obtenção e resolução da estrutura da HGPRT e a

modelagem molecular da estrutura da XPRT de Leishmania. A analise da

estrutura da HGPRT de L. tarentolae se encontra em fase de redação do artigo

para submissão.

Essas enzimas forma empregadas em testes de rastreamento por inibidores em

ensaios bioquímicos empregando extratos de plantas, animais marinhos e da flora

microbiana. Uma serie de compostos foram obtidos desses ensaios e diversos

154

puderam ser cristalizados e tiveram sua estrutura resolvida em colaboração com

o Prof. Dr. Javier Ellena (IFSC - USP). Desse trabalho resultaram três publicações.

Os trabalhos de ensaios com inibidores foram estendidos, visando testar a sua

eficácia sobre o parasito e as células de mamíferos. Com isso foi implantada e se

encontra em funcionamento, uma sala de cultivo de parasitas e células de

mamíferos. Os testes celulares foram realizados com diversos inibidores e

resultaram na identificação da atividade celular de quatro compostos. Este

trabalho foi recentemente submetido para publicação.

Esta abordagem representa uma linha inovadora implantada no laboratório e com

potencial de ser aplicada a outras enzimas e inibidores, aprofundando a

investigação e caracterização de compostos de interesse.

Uma linha de investigação paralela levou aos estudos com a enzima glucose-6-

fosfato isomerase (PGI) de Leishmania. Essa enzima foi donada e caracterizada.

Assim como foi feito para a APRT de Leishmania, também iniciamos a

investigação da PGI humana.

) Obtivemos com sucesso a resolução da estrutura da PGI humana que resultou na!

publicação de dois trabalhos. Estes trabalhos contribuíram com o conhecimento

geral do mecanismo catalítico das PGIs.

A PGI de Leishmania mexicana foi donada a partir de dois fragmentos genicos

cedidos por nosso colaborador, Prof. Dr. Paul A. M. Michels (Research Unit for

Tropical Diseases and Laboratory of Biochemistry, Christian de Duve Institute of

Cellular Pathology, Bruxelas, Belgica). Com a donagem dessa enzima e a

obtenção da proteína recombinante iniciamos ensaios de inibição com quatro

155

compostos desenvolvidos pelo Prof. Or. Laurent Salmon (Laboratoire de Chimie

Bioorganique et Bioinorganique, Orsay Cedex, França) e ensaios de cristalização.

Resultou deste trabalho a publicação de dois artigos, descrevendo a clonagem,

cristalização e atividade inibitória dos compostos testados. O segundo artigo

descreve a estrutura cristalográfica da PGI de Leishmania e características

peculiares do sitio ativo da enzima.

Estas linhas de pesquisa continuam ativas e representam uma modesta

contribuição a área de Parasitologia Molecular e Estrutural

156

Referencias:

[1] Garrett, L. (1994) em "The Coming Plague"

[2] UNDP/WB/WHO (1989). The Leishmaniasis. In Tropical Diseases: Progress in

International Research. 1987-1988.

[3] http://www.who.intltdr/

[4] Woese, C et aI. (1987) Microbiol. Rev. 51:221-227.

[5] Simpson L, Aphasizhev R, Gao G, Kang X. (2004) RNA. 10(2):159-70

[6] Hannaert V, Saavedra E, Duffieux F, Szikora JP, Rigden DJ, Michels PA, Opperdoes FR

(2003) Proc Natl Acad Sci U S A.;100(3):1067-71.

[7] Belli, A., Zeledon, R, de Carreira, P., Ponce, C., and Arana, B. (1993). Arch. Inst. Pasteur

Tunis. 70, 489.

[8] Momen, H. (1998). Emerging infectious diseases - Brazil. Emerg. Infect. Dis. 4, 1-3.

[9] Ashford, RW., Desjeux, P., and deRaadt, P. (1992). Parasitology Today 8,104-105.

[10] Lainson, R, Braga, RR, de Souza, A.A., Povoa, M.M., Ishikawa, E.A., and Silveira, F.T.

(1989). Ann. Parasito!. Hum. Comp. 64, 200-207.

') [11] Lainson, R and Shaw, J.J. (1972). Br. Med.;'BulI. 28, 44-48.

[12] Lainson, R and Shaw, J.J. (1979). Therole of animais in the epidemiology of South

American Leishmaniasis. In Biology of the Kinetoplastida. W.H.R Lumsden and D.A. Evans,

eds. (London and New Yourk: Academic Press), pp. 1-116.

[13] Lainson, R and Shaw, J.J. (1987). Evolution, classification and geographical distribution.

In The Leishmaniases in Biology and Medicine. W. Peters and R Killick-Kendrick, eds.

(London: Academic Press), pp. 1-120.

[14] Lainson, R and Shaw, J.J. (1989). Ann. Parasito!. Hum. Comp. 64, 3-9.

157

[15] Desjeux, P. (1992). World Health Stat. 0.45,267-275.

[16] Schnur, L.F. and Greenblatt, C.L. (1995). Leishmania. In Parasitic protozoa. J.P. Kreier,

ed. (London: Academic Press), pp. 1-160.

[17] Momen, H., Pacheco, R.S., Cupolillo, E., and Grimaldi Junior, G. (1993). Biol. Res. 26,

249-255.

[18] Lu, H.G., Zhong, L., Guan, L.R, Ou, J.O., Hu, X.S., Chai, J.J., Xu, Z.B., Wang, C.T., and

Chang, K.P. (1994). Am. J. Trop. Med. Hyg. 50, 763-770.

[19] Strelkova, M.V., Shurkhal, AV., Kellina, 0.1., Eliseev, L.N., Evans, D.A, Peters, W.,

Chapman, C.J., Le Blancq, S.M., and van Eys, G.J. (1990). Parasitology 101 Pt 3,327-335.

[20] Alencar, J.E. and Neves, J. (1987). Leishmaniose visceral (Calazar). In Doencas

Infecciosas e Parasitarias. R Veronesi, ed. (Rio de Janeiro: Guanabara), pp. 724-738

[21] Mardsen, P.D. and Arruda, Z. (1987). Leishmaniose tegumentar americana

(Leishmaniose cutaneo-mucosa). In Doencas infecciosas e parasitarias. R Veronesi, ed. (Rio

de Janeiro: Guanabara), pp. 739-752.

[22] McGreevy, P.B. and Marsden, P.D. (1986). Protozoan Infections of Man: American

Trypanosomiasis and Leishmaniasis. In Chemoterapy of Parasitic Diseases. W.C. Campbell

and RS. Rew, eds. (New York: Plenum Press), pp, 115-127.!

[23] Geary, T.G., Edgar, A., and Jensen, J.B. (1989). Drug Resistance in Protozoa. In

"Chemoterapy of Parasitic Diseases. W.C. Campbell and RS. Rew, eds. (New York: Plenum

Press), pp. 209-238

[24] Kubinyi, H. (1998). Curr. Opino Drug. Disc. Dev. 1,4-15.

[25] Hyde, J.E. (1990). The Molecular Approach to Rational Chemotherapy. In Molecular

Parasitology. J.E. Hyde, ed. (New York: Van Nostrand Reinhold), pp. 181-228.

[26] Hollar, L., Lukes, J., and Maslov, D.A (1998). J. Eukaryot. Microbiol. 45, 293-297.

158

[27] Maslov, D.A., Nawathean, P., and Scheel, J. (1999). MoI. Biochem. Parasitol, 99, 207-

221

[28] Marr, J.J. and Berens, RL. (1983). MoI. Biochem. Parasitol. 7, 339-356.

[29] Marr, J.J. and Ullman, B. (1995). Concepts of Chemoterapy. In Biochemistry and

Molecular Biology of Parasites. J.J. Marr and M. Muller, eds. (London: Academic Press), pp.

323-336.

[30] Lafon, S.W., Nelson, D.J., Berens, RL., and Marr, J.J. (1982). Biochem. Pharmacol. 31,

231-238

[31] Berens, RL., Krug, E.C., and Marr, J.J. (1995). Purine and pyrimidine metabolism. In

Biochemistry of Parasitic Organisms and its Molecular Foundations. J.J. Marr and M. Muller,

eds. (London: Academic Press),

[32] Musick, W.D. (1981). CRC Crit. Rev. Biochem. 11, 1-34.

[33] Victor, J., Greenberg, L.B., and Sloan, D.L. (1979). J. Biol. Chem. 254, 2647-2655.

[34] Natalini, P., Ruggieri, S., Santarelli, 1., Vita, A., and Magni, G. (1979). J. BioL Chem. 254,

1558-1563.

[35] Giacomello, A. and Salerno, C. (1978). J. Biol. Chem. 253, 6038-6044.

) [36] Yuan, L., Craig, S.P., McKerrow, J.H., and Wang, C.C. (1992). Biochemistry 31, 806-810.

[37] Hassan, H.F. and Coombs, G.H. (1986). Comp. Biochem. Physiol. 84B, 217-223.!' '.

[38] Ullman, B. and Carter, D. (1995). Infect. Agents Dis. 4, 29-40.

[39] Ullman, B. and Carter, D. (1997). Int. J. Parasitol. 27, 203-213.

[40] Marr, J.J. (1991). J. t.ab. Clin. Med. 118, 111-119.

[41] Palella, T.D. and Fox, LH. (1989). Hyperuricemia and gout. In The metabolic basis of

inherited diseases. C.S. Scriver, A.L. Beaudet, W.S. Sly, and D. Valle, eds. (New York:

MacGraw-Hill), pp. 965-1006.

[42] Martinez, S. and Maar, J.J. (1992). N. Engl. J. Med. 326, 741-744.

159

[43] Gallerano, RH., Sosa, RR, and Marr, J.J. (1990). Am. J. Trop. Med. Hyg. 43, 159-166.

[44] Craig, S.P. and Eakin, AE. (1997). Parasitology Today 13, 238-241.

[45] Michels, P.AM.; Hannaert, V. & Bringaud, F. (2000) Parasitol. Today, 16,482-489.

[46] Verlinde, C.L.M.J.; Hannaert, V.; Blonski, C.; Willlson, M.; Périe, J.J.; Fothergill-Gilmore,

L.A; Opperdoes, F.R; Gelb, M.H.; Hol, W.G.J. & Michels, P.AM. (2001) Drug Resist.

Updates, 4, 50-65.

[47] Hannaert, V. Bringaud, F. Opperdoes, F. & Michels, P. (2003). Kinetoplastid Biol. Dis., 2,

11-41.

[48] Cowman, A & Crabb, B. (2003) Trends in Parasitoloqy, 19,538-543.

[49] Croft, S. & Coombs, G. (2003). Trends in Parasitology, 19,502- 508.

[50] Ullu, E. Djikeng, A Shi, H. & Tschudi, C. (2002). Phil. Trans. R SocoLond. , 357, 65-70.

[51] Nyame, K; Do-Thi, C.D.; Opperdoes, F.R. & Michels, P.AM. (1994) Moi Biochem

Parasitol, 67, 269-279.

[52] Cragg GM, Newman DJ, Snader KM. (1997) J Nat Prod.; 60 (1):52-60 ..

[53] Newman DJ, Cragg GM, Snader KM. (2000) Nat Prod Rep.; 17 (3):215-34.

[54] Newman DJ, Cragg GM, Snader KM. (2003) J Nat Prod.; 66 (7):1022-37.

[55] Hoet S, Opperdoes F, Brun R, Quetin-Leclercq J: (2004) Nat Prod Rep.; 21 (3):353-64.

[56] Coukell AJ, Brogden RN (1998) Drugs; 55 (4):585-612.

"[57] Croft SL, Coombs GH. (2003) Trends Parasitol.;19 (11):502-8.

[58] Sundar S, Rai M. (2002) Curr Opin Infect Dis.;15 (6):593-8.

160