especiação ecológica mediada pelos tipos de água em um
Post on 01-Aug-2022
7 Views
Preview:
TRANSCRIPT
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - INPA
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA DE ÁGUA DOCE E PESCA INTERIOR
TIAGO HENRIQUE DA SILVA PIRES
Tese apresentada ao Programa
Integrado de Pós-Graduação em
Biologia Tropical e Recursos
Naturais – INPA, como parte dos
requisitos para obtenção do título
de Doutor em CIÊNCIAS
BIOLÓGICAS, área de
concentração em Biologia de Água
Doce e Pesca Interior.
Manaus, Amazonas
Agosto, 2017
Especiação ecológica mediada pelos tipos de água
em um peixe amazônico
INSTITUTO NACIONAL DE PESQUISAS DA AMAZÔNIA - INPA
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA DE ÁGUA DOCE E PESCA INTERIOR
TIAGO HENRIQUE DA SILVA PIRES
Orientador: Dr. Jansen A. S. Zuanon
Instituto Nacional de Pesquisas da Amazônia – INPA
Manaus, Amazonas
Agosto, 2017
III
Sinopse
Estudou-se uma espécie de peixe sexualmente dimórfica como modelo para
entendimento de processos de diversificação em ambiente aquático amazônico. Foram
apresentadas características da autoecologia, comportamento e filogeografia. Com base
em experimentos controlados, sugere-se que diferenças no ambiente químico relacionado
aos tipos de águas amazônicas constitui importante força reguladora de isolamento
reprodutivo e medeia a formação de novas espécies.
IV
AGRADECIMENTOS
Ao CNPq pela bolsa de pesquisa e à CAPES pela bolsa durante o doutorado
sanduíche (PDSE). À JST/JICA que, por meio do projeto SATREPS e Museu na
Floresta, financiou grande parte dos equipamentos presentes no nosso laboratório.
A realização desta tese só foi possível por meio da boa vontade e felicidade
em ajudar ao outro que encontramos em pessoas ao redor do mundo. A jornada que
iniciou as investigações sobre especiação, comportamento e seleção sexual usando
Crenuchus spiulurus como modelo não se iniciou com esta tese e nem provavelmente
terminará com ela. Ao mencionar apenas as pessoas que me ajudaram durante os
últimos quatro anos, sinto pesar em deixar de fora algumas pessoas que foram
centrais para o início dessa jornada.
Ao meu orientador Jansen Zuanon, que me deixou livre e apoiou em fazer o
que acreditava ser a melhor forma de conduzir a pesquisa. Este trabalho contou com
auxílio financeiro específico apenas um ano antes de sua conclusão. Durante os
períodos anteriores, o Jansen por vezes fez uso de recursos próprios para que a
pesquisa não ficasse estancada por falta de material.
Ao Elio A. Borghezan, que foi certamente o motor do laboratório por boa parte
do tempo. A presença do Elio tornou possível a existência de um programa de
pesquisa e constituição do que hoje chamamos de LECE. Sem ele, esta tese não
seria possível.
À professora Izeni Farias, que permitiu e financiou o estudo molecular
apresentado aqui, que lançou luz e mudou substancialmente a direção dos estudos
no LECE.
À Valéria Machado, que conduziu o trabalho de bancada no estudo molecular
(Capítulo 2) com imensa maturidade e competência.
V
Ao professor Gil Rosenthal, que me aceitou como visitante em seu laboratório
e me estimulou a pensar várias questões sobre seleção sexual. Tanto a forma de
manutenção de peixes quanto as técnicas implementadas atualmente no LECE são
resultado dessa visita e conversas com o Gil e seus alunos. Devo a um deles um
agradecimento especial.
Dan Powell e eu temos o mesmo entusiasmo por aquarismo e ciência, o que
resultou em boas discussões sobre comportamento e evolução. Essas discussões
geraram ideias e formaram a base de novos estudos.
Ao Chris Blazier, que me mostrou como dar os primeiros passos em análise
de dados moleculares e por vezes supervisionou espontaneamente meu progresso,
o que me ajudou imensamente.
Ao Kalebe Pinto, por ajudar a manter o laboratório e por executar com muita
responsabilidade suas atribuições.
Aos meus amigos David Saenz e Luke Bower, por corrigirem os textos em
inglês e pelos questionamentos sobre ecologia e evolução de peixes.
Ao futuro papai Bruno Barros, que fez várias coletas de Crenuchus em Porto
Velho, superando dificuldades logísticas e burocráticas para tal.
Ao Rafael Leitão pelas ótimas discussões sobre ecologia e evolução de
peixes neotropicais.
Ao Ikeda-san, por viabilizar nossa parceria com o Museu na Floresta, e ao
Taku-san por sua imensa competência e simpatia em administrar os recursos do fish
team do Museu na Floresta.
Ao Sérgio Santorelli e Camila Anjos por estarem sempre disponíveis em
ajudar nos momentos que demandaram uma “força tarefa”.
VI
Ao Sérgio L. R. Cunha por seu excelente trabalho de conclusão de curso, que
mostrou em números as diferenças em ornamentos entre as linhagens de Crenuchus.
Ao Gabriel Stefanelli por sua dedicação em mostrar em mais detalhes as
características liminológicas que afetam a reprodução de C. spilurus.
À Elisa Garcia pelo entusiasmo contagiante com a ciência.
À minha querida Cristhiana Röpke por ter contribuído para o meu
desenvolvimento profissional e sempre ajudado nos momentos difíceis ao longo dos
últimos sete anos.
Por fim, devo um agradecimento especial à minha família pelo apoio
incondicional, mesmo que não compreendendo claramente o que eu faço.
VII
RESUMO
A Amazônia possui a maior rede de drenagens do mundo. Em seus corpos
d’água há uma imensa diversidade de habitats, como os inúmeros igarapés, canais
de grandes rios, vegetação flutuante, floresta inundada e águas com diferentes
composições físicas e químicas. Esses ambientes são lar da maior diversidade de
peixes de água doce existente. Muitas espécies podem ser facilmente reconhecidas
por diferenças morfológicas, porém outras formam complexos de espécies crípticas
cuja distinção é difícil. Esse cenário sugere que diversos mecanismos tenham
contribuído para a formação de novas espécies. Contudo, poucos estudos
investigaram diretamente os processos que medeiam a formação de espécies como
delimitadas pelo conceito biológico de espécies. De fato, estudos sobre a origem e
manutenção do isolamento reprodutivo em peixes amazônicos são virtualmente
inexistentes. Esta tese se propôs a investigar o processo de diversificação ao analisar
características ecológicas e evolutivas de Crenuchus spilurus (Characiformes:
Crenuchidae), uma espécie com imensa abrangência geográfica (mais de três
milhões de quilômetros quadrados), que engloba rios da bacia Amazônica, bacia do
rio Orinoco e rios costeiros das Guianas. Por meio de observações diretas em
ambiente natural, análise de dieta e análise de parâmetros reprodutivos, levantamos
quais características intrínsecas da espécie poderiam contribuir com a expansão da
área de ocorrência e quais características parecem ressaltar que existe um forte
conservadorismo morfológico na espécie. Com base em sequenciamento de
marcadores genéticos, encontramos uma distinção bastante marcada entre duas
linhagens que ocorrem com distribuições ecogeográficas parapátricas. Uma das
linhagens está restrita às águas pretas do Rio Negro, que são ácidas e pobres em
nutrientes, e uma segunda linhagem ocorre ao longo do restante da distribuição
VIII
amostrada, majoritariamente dentro de bacias de drenagem de águas brancas.
Apesar da baixa distinção morfológica, essas linhagens estão isoladas
reprodutivamente, sendo que águas ácidas e pobres em nutrientes penalizam a
aptidão da linhagem que não ocupa naturalmente este tipo de ambiente. Tais
resultados sugerem que as linhagens possuem adaptações locais às diferentes
condições químicas das águas amazônicas. A baixa aptidão dos indivíduos de águas
brancas quando em águas pretas resulta em isolamento reprodutivo entre as
linhagens, o que sugere fortemente que os tipos de águas restringem o fluxo gênico
entre as duas linhagens e, portanto, medeiam o processo de especiação ecológica.
Nossos resultados estão em consonância com estudos recentes que sugerem para
outras espécies que os tipos de água formam um importante componente da
diversificação de peixes na Amazônia.
ABSTRACT
The Amazon harbors the largest river drainage in the world. Within its water bodies
lies an immense diversity of habitats, with several forest streams (igarapés), large river
channels, floating vegetation, flooded forest and water with very distinct physical and
chemical properties. Such environments are home to the greatest diversity of
freshwater fish on Earth. Several species can be readily recognized by morphological
characteristics, however, other form cryptic species complex whose identification is
very difficult. Such scenario suggests that several diversification mechanisms can
have contributed to the formation of new species. However, few studies have directly
investigated the processes that mediate the formation of new species as distinguished
by the biological species concept. In fact, studies on the origin and maintenance of
reproductive isolation in Amazonian fish are largely absent. The present thesis aimed
IX
at investigating diversification process by analyzing ecological and evolutionary
characteristics of the sailfin tetra Crenuchus spilurus (Characiformes: Crenuchidae),
a species that occurs over a huge geographical range (over three million squared
kilometers), encompassing rivers of the Amazon basin, Orinoco basin and coastal
rivers of the Guianas. Using direct field observations, diet analysis and analysis of
reproductive parameters, we raised which intrinsic and extrinsic characteristic of the
species could contribute to the expansion of geographical range and which
characteristics could point toward a morphological conservatism in the species. Based
on sequencing of genetic markers, we found a clear distinction between two linages
that occur at ecogeographical parapatric distribution. One of the lineages is restricted
to the blackwaters of the Rio Negro, an environment that is acidic and nutrient poor;
the second lineage occurs throughout the remainder of the distribution, mostly within
drainages that flow to whitewater rivers. Although possessing little morphological
distinction, such lineages are reproductively isolated, with acidic and nutrient poor
waters penalizing the fitness of the lineage that does not occur in such environment.
These results suggest that the two lineages developed adaptations to the local
chemical conditions. The low fitness of individuals from whitewater drainages that
were exposed to blackwater-like conditions result in reproductive isolation between
the lineages, which strongly suggests that distinct water types hampers gene flow
between the lineages, thus mediating the (ecological) speciation process. Our results
are aligned with recent studies that suggest, for other species, that amazon water
types represent an important component in the formation of new species in the
Amazon
X
Conteúdo
INTRODUÇÃO GERAL ......................................................................................... 1
OBJETIVOS ..................................................................................................................... 14
Geral: ................................................................................................................................................... 14
Específicos: ........................................................................................................................................ 14
BIBLIOGRAFIA CITADA ................................................................................................. 15
CAPÍTULO 1: TRAITS OF A LINEAGE WITH EXTRAORDINARY
GEOGRAPHICAL RANGE: ECOLOGY, BEHAVIOR AND LIFE-HISTORY OF THE
SAILFIN TETRA CRENUCHUS SPILURUS ............................................................ 18
ABSTRACT ...................................................................................................................... 18
INTRODUCTION .............................................................................................................. 19
MATERIAL AND METHODS ........................................................................................... 21
Geographical range ........................................................................................................................... 21
Abiotic factors and abundance ........................................................................................................ 22
In situ observations ............................................................................................................................ 23
Reproductive strategy and size at maturity .................................................................................... 24
Stomach content analysis ................................................................................................................. 25
RESULTS ......................................................................................................................... 26
Geographical range ........................................................................................................................... 26
Abiotic factors and abundance ........................................................................................................ 27
In situ observations ............................................................................................................................ 29
Eggs, larvae and growth ................................................................................................................... 32
Reproductive parameters ................................................................................................................. 33
Diet ....................................................................................................................................................... 34
DISCUSSION .................................................................................................................... 35
XI
Sexual selection ................................................................................................................................. 39
ACKNOWLEDGEMENTS ................................................................................................ 40
REFERENCES ................................................................................................................. 41
CAPÍTULO2: TESTING WALLACE'S INTUITION: WATER TYPE,
REPRODUCTIVE ISOLATION, AND DIVERGENCE IN AN AMAZONIAN FISH ... 48
Acknowledgements ........................................................................................................................... 49
Author contributions .......................................................................................................................... 49
ABSTRACT ...................................................................................................................... 50
INTRODUCTION .............................................................................................................. 51
MATERIAL AND METHODS ........................................................................................... 54
RESULTS ......................................................................................................................... 62
Reproductive isolation ....................................................................................................................... 63
DISCUSSION .................................................................................................................... 66
BIBLIOGRAPHY .............................................................................................................. 70
SUPPORTING INFORMATION ....................................................................................... 78
Considerações finais ........................................................................................ 84
PERSPECTIVAS FUTURAS ............................................................................... 87
1
INTRODUÇÃO GERAL
Com mais de três mil espécies válidas e cerca de uma centena de novas
espécies sendo descritas a cada ano, a Amazônia possui a maior diversidade de
peixes de água doce do mundo. Nesse cenário de extraordinária riqueza, é esperado
que uma grande variedade de fatores tenha contribuído como processos de
diversificação. Características simples como o enorme volume de água (relação
espécie área, MacArthur & Wilson 1967) e elevada incidência de energia solar (teoria
metabólica, Rohde et al. 1992) podem ter constituído importantes componentes ao
permitir a acumulação de espécies ao longo do tempo. Situada na região equatorial,
a bacia amazônica é o maior sistema de água doce do mundo (Gould et al. 2003) e
os corpos d’água que a compõem não são estruturalmente homogêneos.
Características do terreno se modificaram com o tempo e afetam diretamente os tipos
de habitats disponíveis para os peixes (Lundberg et al. 1998, Albert & Reis 2011).
Além da evidente diferença em volume de água existente entre os pequenos
riachos e os canais principais dos grandes rios, o acúmulo de água dos inúmeros
tributários gera uma importante variação ambiental no gradiente hidrológico
longitudinal (i.e. da cabeceira até a foz). Temporalmente, as variações sazonais
afetam as condições ambientais dos grandes rios, possuindo ciclo unimodal de
acúmulo de água, incluindo um período de cheia e período de seca ao longo do ano.
Esse ciclo unimodal observado nos grandes rios é previsível, o que não se observa
nos pequenos riachos, onde as condições mudam rapidamente em resposta às
chuvas locais (Vannote et al. 1980). Condições intermediárias de variação temporal
ocorrem em corpos d’água situados entre os grandes rios e os pequenos riachos. De
forma similar, a importância relativa da produção primária e secundária se modifica
2
conforme os sistemas fluviais acumulam água (Vannote et al. 1980). Ainda, os canais
principais são grandes e pouco numerosos quando comparados aos pequenos
riachos, que ocorrem em um número incontável ao longo de toda a Amazônia.
As diferenças topográficas e geográficas da Amazônia possibilitam a
formação de diversos ambientes aquáticos e habitats para peixes. Três formações
principais do terreno parecem ser de especial relevância: a cordilheira Andina, os
escudos cristalinos Brasileiro e das Guianas, e as terras baixas da planície central
amazônica (Albert & Reis 2011, Fig. 1A-C). Como consequência de suas diferentes
histórias geológicas, essas formações possuem composição do solo e declividade
distintos, que determinam, dentre outras características, a composição florística
(Janzen et al. 1974) e a susceptibilidade a inundações periódicas.
3
Fig. 1. Modelo esquemático mostrando as principais características do terreno e tipos
de habitat para peixes e outros organismos aquáticos na Amazônia. As cores dos rios
representam os tipos de águas (águas brancas = marrom, águas pretas = cinza, e
águas claras = verde). A forma em sino dos rios representa tanto o aumento do
volume d’água a medida em que os rios se aproximam da foz quanto um aumento
gradual da previsibilidade das estações do ano. A estabilidade dos ambientes (i.e. o
tempo sem modificação estrutural) é alta em rios e riachos que correm nos escudos
e baixa nos rios próximos aos Andes e na região baixa amazônica. Por exemplo,
riachos de baixa temperatura são observados apenas nas regiões altas dos escudos
e da cordilheira andina (1). Esses riachos carregam sedimento suspenso da região
andina formando rios de águas brancas. Riachos que cortam terreno com muitas
corredeiras e cachoeiras ocorrem tipicamente na região dos escudos (2), que
possuem solo podzólico. Esse tipo de solo favorece o crescimento de vegetação rica
em compostos secundários que levam à geração de águas pretas. Quando estes rios
4
ocorrem próximo ao canal principal de rios de águas brancas (3) formando os
chamados “encontro das águas” (8). Solos não podzólicos abrigam diferente
composição florística, formando rios de águas claras (4). Canais principais são
formados a medida em que os rios acumulam água em seus cursos (5). As margens
desses canais possuem menor velocidade de corrente, que permite o crescimento de
vegetação flutuante (9), especialmente durante as inundações sazonais. Nas
margens onde ocorre deposição do sedimento transportado há formação de praias.
Quando as margens são desprovidas de vegetação, há formação de praias (8), mas
quando a inundação atinge a floresta circundante, igapós e várzeas são formadas
(10). Regiões de baixa corrente de água (chamadas localmente de "lagos") podem
ser formadas como consequência do afundamento do terreno lateral dos canais dos
rios (6a) ou por meio da acumulação de sedimentos no canal principal (6b).
As formações geográficas mencionadas acima também diferem quanto à
estabilidade ambiental ao longo do tempo. Em decorrência da subdução da placa de
Nazca sob a Placa Sul Americana, a região andina é geologicamente mais recente e
está em constante movimento. Nela, rios e riachos próximos às montanhas e regiões
adjacentes mudam de curso constantemente, o que pode até mesmo ser observado
no intervalo de décadas (veja https://earthengine.google.com/timelapse). Ao longo de
uma longa escala temporal, portanto, é esperado que ambientes aquáticos tenham
sido isolados e reconectados diversas vezes (Wilkinson et al. 2006). O oposto ocorre
para corpos d’água situados nos escudos Brasileiro e das Guianas, regiões de baixa
atividade geológica em que reconexões de drenagens devem ter ocorrido com
frequência muito menor (Lima & Ribeiro 2011). Uma situação intermediária é
encontrada nos corpos d’água localizados nas terras baixas amazônicas, que sofrem
apenas efeitos indiretos da dinâmica geológica da região andina. Essa região mais
baixa, contudo, sofreu diretamente os efeitos das variações do nível do mar que
5
ocorreram em função de variações climáticas globais (López-Fernández & Albert
2011).
Por fim, observações tão antigas quanto aquelas feitas por Alfred Russel
Wallace (1853) já relatavam uma grande diferença na coloração dos rios da
Amazônia. Essas diferentes cores vistas de fora da água resultam não apenas de
diferenças nos comprimentos de onda de luz absorvidos e no grau de iluminação do
ambiente subaquático, mas também de características físicas e químicas das águas
(Sioli 1984).
Apesar da grande quantidade de características do terreno gerando
diversidade de ambientes, nenhuma outra característica ambiental chamou tanto a
atenção dos pesquisadores sobre diversidade biológica quanto as barreiras físicas
(Bernardi 2013). Uma vez que todo o sistema hidrográfico amazônico é
intrinsecamente conectado, descontinuidades representadas por cachoeiras e
corredeiras são consideradas barreiras físicas dentro das bacias (Dias et al. 2012).
Cachoeiras e corredeiras ocorrem tipicamente em rios e riachos que cortam os
escudos cristalinos (Fig. 1B) e são raros nos demais ambientes aquáticos da Bacia
Amazônica. Segundo a "hipótese de museu" (Henderson et al. 1998 inspirado em
Fjeldsa 1994), espécies aquáticas são formadas em regiões elevadas dos escudos
(onde cachoeiras e corredeiras são mais abundantes) e se acumulam nas regiões
mais baixas da bacia amazônica. Essa hipótese, no entanto, não explica
satisfatoriamente a maior riqueza encontrada na região do sopé andino em relação
às regiões a jusante no rio Amazonas (Zuanon et al. 2008). Além disso, o foco em
processos neutros falha em acomodar vários tipos de adaptações comumente vistas
em peixes amazônicos. Por exemplo, uma grande quantidade de espécies comuns
ou exclusivas da região baixa amazônica exibe adaptações relacionadas a habitats
6
típicos dessa região, como os ambientes anóxicos, que selecionaram repetidamente
adaptações para obtenção de oxigênio em baixas quantidades (Val et al. 1998), ou o
hábito bentônico nos canais de grandes rios que, por serem completamente escuros,
favorecem meios sensoriais outros que não os visuais, incluindo o uso de campos
elétricos e pistas químicas.
A perspectiva de analisar o papel de barreiras pretéritas na diversificação da
fauna amazônica foi alavancada por análises de dados de sequenciamento de DNA,
que foram refinadas e permitiram datações de forma cada vez mais precisas. Isso,
aliado ao avanço quase simultâneo no conhecimento do passado geológico da
Amazônia (Albert & Reis 2011), propeliu o desenvolvimento de vários programas de
pesquisas em biogeografia histórica que buscaram concatenar a história de
drenagens com aquelas de linhagens evolutivas de diferentes grupos de organismos.
Essencialmente esses estudos buscam concordâncias entre divisões de
agrupamentos de dados moleculares com divisões pretéritas de drenagens,
frequentemente sem considerar o papel de características ecológicas dos ambientes
em que as linhagens habitam.
Embora originalmente gerados de forma conjunta (e.g. Lowe-McConnell
1967), estudos de processos evolutivos parecem ter gradualmente se distanciado dos
estudos ecológicos. Esse aparente divórcio entre ecologia, evolução e biogeografia
pode ser visto como uma consequência natural do refinamento e demandas cada vez
mais complexas de cada abordagem das disciplinas científicas individuais. Contudo,
a falta de comunicação entre essas disciplinas da biologia dificulta a avaliação da
importância relativa dos diferentes mecanismos de diversificação para a riqueza de
espécies amazônicas. Para estudos históricos, a conclusão de que barreiras físicas
constituem as principais características pretéritas a serem consideradas para se
7
entender processos de diversificação parece emergir do simples fato de esta ser
frequentemente a única característica do ambiente que é considerada nos estudos.
Essa abordagem simplista parece conflitar diretamente com questionamentos feitos
por biólogos evolutivos. Sobel et al. (2009), por exemplo, questionam “quando a
especiação não é ecológica?” e versam sobre a importância quase ubíqua de
características ecológicas no processo de formação de novas espécies.
Uma interface entre os pontos de vista de diferentes disciplinas da biologia
parece tomar forma quando a diversificação é vista pela ótica do fluxo gênico, pois
barreiras físicas são mais eficientes em impedir o fluxo gênico do que barreiras
ecológicas. Ao impedir o fluxo gênico entre populações, a barreira física permite que
as diferenças ecológicas (mesmo que sutis) entre os ambientes que abrigam
populações isoladas propulsionem a diversificação (Coyne & Orr 2004). Contudo, o
entendimento do processo de diversificação naturalmente demanda o entendimento
do quanto os ambientes separados pela barreira devem divergir em suas condições
ecológicas para que a especiação ocorra. Salvo a existência de uma característica
ambiental que bloqueie a colonização (i.e. ausência de variação genética que permita
invadir ambiente distinto), é intuitivo que ambientes semelhantes irão gerar pressões
de seleção divergentes mais fracas do que ambientes mais distintos. Isso acarreta
em um menor número de modificações genéticas sendo acumuladas com o tempo
nas populações separadas por uma barreira física que vivenciam ambientes similares
quando comparado ao número de modificação acumuladas por populações
separadas em ambientes distintos. Além disso, a forte especialização no uso de
certos tipos de habitat pode fazer com que a colonização de habitats distintos seja
improvável, efetivamente tornando a migração entre habitats uma barreira ao fluxo
gênico. Nesse caso, a distinção entre os ambientes pode exercer pressão de seleção
8
divergente ― condição algumas vezes nomeada como especiação micro-alopátrica
(Tobler et al. 2009). O baixo número de estudos considerando a especiação micro-
alopátrica parece indicar que a contribuição deste mecanismo na geração de novas
espécies de peixes na Amazônia é possivelmente subestimada, em favor de
mecanismos envolvendo barreiras físicas (frequentemente tratados como casos de
especiação alopátrica).
Da mesma forma que o mecanismo de especiação micro-alopátrica depende
do grau de especialização no uso de habitat, barreiras físicas afetam organismos de
maneiras diferentes em sua efetividade como bloqueadoras do fluxo gênico, sendo
estas também dependentes de características intrínsecas aos organismos aquáticos.
Por exemplo, um evento geológico que gere uma elevação do terreno em um trecho
de rio e que ocasione a diminuição da coluna d’água de alguns metros para poucos
centímetros será uma barreira importante para peixes de grande porte, mas não deve
representar uma barreira para peixes pequenos. Inversamente, apenas peixes de
grande porte (tipicamente) conseguem vencer a corrente de água e ultrapassar
corredeiras ou cachoeiras formadas a partir de elevações abruptas do terreno.
A efetividade de barreiras físicas em impedir migrantes pode variar conforme
o tempo. No modelo de especiação vicariante tradicional, a barreira física se torna
cada vez mais eficiente em impedir migrantes com o tempo, até que atinja valor de
zero. Entretanto, esse processo não é determinístico e interrupções ou reversões no
processo de formação da barreira podem existir, fazendo com que a efetividade da
barreira à migração seja diferente de zero por longo tempo. Outra possibilidade é que
a barreira gradualmente se desfaça e permita mais migrantes do que em momentos
anteriores. Sob os modelos de especiação não ecológica, tais como os modelos de
"ordem de mutação" (Nosil 2012) e "deriva genética" (Langerhans & Riesch 2013), a
9
barreira física precisa ser mantida por muito tempo para que haja acúmulo suficiente
de modificações que possam gerar distinção entre linhagens. Portanto, a especiação
deve depender tanto da efetividade da barreira em bloquear migrantes com o tempo,
quanto da divergência ecológica entre os ambientes, que proporcionaria um
impedimento aos migrantes e uma força de pressão de seleção divergente (Fig. 2).
Fig. 2. Contínuo de formas possíveis de especiação em relação à efetividade das
barreiras físicas e ao grau de divergência ecológica entre ambientes por elas
separados. A especiação simpátrica está restrita aos casos em que não ocorre uma
barreira física e, por conta do fluxo gênico, irá apenas ocorrer quando diferenças
ecológicas fortes proporcionem tanto uma força seletiva divergente quanto uma
barreira ao fluxo gênico. Formas de especiação não ecológicas (ordem de mutação e
deriva genética) podem ocorrer apenas em ambientes idênticos que estejam
separados por uma barreira física que bloqueie completamente o fluxo de migrantes.
Esses dois casos representam apenas dois pontos do contínuo que pode envolver
barreiras físicas fortes ou fracas ao fluxo de migrantes (eixo X) e que delimitam
ambientes com graus distintos de dissimilaridade (eixo Y).
10
Na Bacia Amazônica, limites entre drenagens podem se mover com o tempo
como consequência dos sedimentos que são carreados (Hoorn et al. 2010).
Simultaneamente, o aumento no volume d’água decorrente de aumento da
precipitação ou aumento do nível do mar podem promover a conexão de habitats e
fazer com que barreiras físicas sejam superadas. Essas modificações decorrem em
especial de orogênese e mudanças climáticas, respectivamente, e parecem ser
importantes para explicar padrões regionais de diversidade e de distribuição de
espécies (Albert & Reis 2011). Barreiras que desconectam e reconectam ambientes
são consideradas necessárias para poder explicar, em conjunto, a alta diversidade e
grande abrangência geográfica observada em muitas espécies de peixes (Albert &
Reis 2011). Nesse cenário de constantes reconexões de ambientes sugerido por
dados geológicos da Bacia Amazônica, é esperado que o contato entre populações
previamente desconectadas tenha ocorrido com frequência (Wilkinson et al. 2006),
sugerindo que os efeitos de barreiras físicas atuando sob larga escala de tempo
estejam restritos aos ambientes geologicamente estáveis, tais como os escudos (Fig
1B).
Muitas espécies de peixes amazônicos possuem abrangência geográfica
surpreendentemente ampla, inclusive para espécies de pequeno porte (Albert & Reis
2011, Pires et al. 2014). Essas espécies podem ter sido transportadas passivamente
como consequência da dinâmica fluvial, um processo de especial importância para
espécies que possuem características intrínsecas tipicamente associadas com baixa
propensão em colonizar novas áreas, como a baixa vagilidade e elevada
especialização de habitat. Muitas espécies possuem forte estrutura genética
geograficamente delimitada e um grande número de modificações (provavelmente
neutras) observadas a partir de dados de sequenciamento de marcadores genéticos
11
(Cooke et al. 2009, Schneider et al. 2012), o que sugere o isolamento dessas
populações por longos períodos de tempo. Esse padrão também sugere que
isolamentos antigos têm pouco influência sobre a morfologia externa, uma vez que a
grande maioria das espécies de peixes amazônicas tem sido delimitada com base em
características morfológicas.
O cenário de especiação alopátrica, que tem sido considerado a principal
explicação para a diversificação de peixes na Bacia Amazônica, contrasta com aquele
observado para peixes dos grandes lagos do rift africano e outros ambientes
confinados e recentes, como os lagos de cratera da Nicarágua. A ausência de
barreiras físicas em ambientes confinados e recentes, aliada à menor variabilidade
de habitats, permitem salientar muitos casos em que características intrínsecas dos
organismos desempenham papel como facilitadoras da diversificação. Tais
características são conhecidas como “inovações-chave” e podem ser definidas como
características que modificam o regime de seleção da linhagem em que evolui (sensu
Baum & Larson 1991). Esforços foram especialmente alocados na busca de variações
nos sistemas de comunicação sexual, que parecem ter especial relevância na
aceleração da diversificação por atuarem diretamente na reprodução (Wilson 2003).
Alguns poucos pares de espécies de ciclídeos dos grandes lagos africanos variam
bastante no sistema de comunicação sexual e pouco em outras características
ecológicas e morfológicas. Essa descoberta teve forte impacto no debate sobre a
existência de especiação simpátrica (Seehausen et al. 1999) e salientou a
possibilidade de união entre as duas grandes teorias de Darwin: a seleção natural e
a seleção sexual poderiam se combinar e gerar diversidade.
A perspectiva de que a seleção sexual pode propelir a formação de novas
espécies se apoia tipicamente no modelo Fisher-Lande-Kirkpatrick, conhecido como
12
seleção sexual desenfreada (runaway sexual selection). Esse modelo sugere que
variações no regime de seleção natural podem permitir que a seleção sexual gere
diversificação morfológica rápida (tipicamente nas características sexuais
secundárias), atingindo novos valores rapidamente por meio do acoplamento
genético entre a preferência da fêmea e a evolução da característica preferida pela
fêmea (Andersson 1994). Esse poder sinergético entre os processos de diversificação
foi buscado em muitos estudos de biologia comparada, com resultados inconclusivos
(Ritchie 2007). Até mesmo o arrazoado para se esperar uma maior diversidade em
grupos nos quais há forte pressão de seleção sexual também se mostrou frágil. A
elevada diversidade de ciclídeos dos lagos africanos também é acompanhada por
grande variação morfológica, em especial na boca e dentes faríngeos (Liem 1973),
de forma que, mesmo em grupos nos quais há forte pressão de seleção sexual, a
diversificação só ocorre quando acompanhada de variação ambiental e seleção
ecológica divergente (Maan & Seehausen 2011).
A presente tese de doutorado faz parte de um programa de pesquisa que visa
investigar o processo de especiação em ambientes aquáticos amazônicos. Esse
programa de pesquisa foi definido em grande parte considerando o cenário resumido
nos parágrafos anteriores. Para abranger a diversidade de fatores e características
mencionados acima e poder confrontar os potenciais mecanismos de diversificação,
escolhemos focar esforços sobre uma espécie de peixe que tivesse características
biológicas e ecológicas adequadas ao seu uso como modelo experimental.
Escolhemos, portanto, uma espécie com as seguintes características: (a) forte
dimorfismo sexual, permitindo a investigação do potencial papel da seleção sexual no
processo de especiação/diversificação; (b) que fosse possível ser encontrada em
abundância na natureza, permitindo a obtenção de amostras para experimentação;
13
(c) que ocorresse na região próxima de Manaus, de forma que as condições
laboratoriais fossem próximas às encontradas pela espécie; (d) que tivesse grande
abrangência geográfica, o que sugeriria exposição a uma grande diversidade de
ambientes e barreiras atuais e pretéritas e (e) cujas características biológicas e
ecológicas potencialmente favorecessem o processo de diversificação. A espécie
escolhida foi Crenuchus spilurus Gunther, 1863 (Characiformes: Crenuchidae) e
investigamos características ecológicas, diferenças genéticas e isolamento
reprodutivo entre indivíduos de populações distribuídas por uma enorme área
geográfica da Bacia Amazônica.
O Capítulo 1 apresenta aspectos gerais da ecologia e comportamento de C.
spilurus. Consideramos o conjunto de características ecológicas e comportamentais
da espécie e sua enorme abrangência geográfica, fizemos a pergunta: quais das
características são mais prováveis em explicar a enorme abrangência geográfica de
C. spilurus? Após a obtenção dos dados, diversas características ecológicas e
comportamentais analisadas apontavam para a hipótese de que a espécie nominal
C. spilurus era composta de diversas sublinhagens geograficamente isoladas. O
Capítulo 2, portanto, reporta a grande diversidade genética que ocorre na espécie e
investiga os potenciais fatores envolvidos no processo de diversificação dessa
linhagem de peixes amazônicos. Para isso, sequenciamos três marcadores
mitocondriais e dois nucleares em 84 populações dentro de quase toda a abrangência
geográfica da espécie. Além da grande diversidade genética esperada, ficou evidente
a distinção de dois grandes grupos, consistentemente identificados a partir de todos
os marcadores: um restrito à Bacia do Rio Negro (aqui chamado de linhagem “Rio
Negro”) e outro ocorrendo no restante da Bacia Amazônica (chamado linhagem
“Amazonas”). Embora esse padrão sugira que a diferença no tipo de águas (pretas e
14
brancas) seja importante na diferenciação das linhagens, o padrão encontrado
também poderia ser explicado por uma conexão pretérita. Em face da ausência de
diferenças morfológicas conspícuas entre indivíduos das duas linhagens
(Campanario 2002, mas veja Cunha 2016) e da possibilidade de que as duas
linhagens pudessem estar adaptadas aos tipos de água predominantes nessas duas
bacias principais, também perguntamos se existe isolamento reprodutivo entre as
linhagens e se tal isolamento poderia estar relacionado com diferenças nas
características físico-químicas das águas. Ao final desta tese, apresentamos uma
breve síntese dos resultados obtidos e apontamos alguns possíveis caminhos para
pesquisas futuras sobre o processo de especiação e diversificação de linhagens de
peixes na Bacia Amazônica.
OBJETIVOS
Geral: Avaliar a contribuição de potenciais mecanismos de diversificação na especiação
em ambientes aquáticos amazônicos usando a espécies Crenuchus spilurus como
modelo de estudo.
Específicos:
Capítulo 1: (a) Descrever o sistema de estudo usando dados de história natural e
dando ênfase para as características relacionadas à grande abrangência geográfica
da espécie; (b) Investigar quais características da espécie podem ajudar a explicar e
15
quais se destacam como improváveis em estar relacionadas com a amplitude
geográfica da espécie.
Capítulo 2: (a) Verificar a distribuição da diversidade ao nível molecular e suas
possíveis relações com processos neutros e de seleção; (b) Testar
experimentalmente a existência de isolamento reprodutivo entre populações
pertencentes às diferentes linhagens reveladas por dados moleculares.
BIBLIOGRAFIA CITADA
Albert, J. & Reis, R. E. (2011). Introduction to Neotropical freshwaters. In: Historical
biogeography of Neotropical freshwater fishes (ed. Albert, J. & Reis, R. E.), pp. 3–
19. University of California Press, CA.
Andersson, M. B. (1994). Sexual selection. Princeton University Press, Princeton, NJ.
Campanario, C. M. (2002). Revisão taxonômica do gênero Crenuchus Günther
(1863), com uma hipótese sobre a filogenia de Crenuchinae (Characiformes:
Ostariophysi).
Coyne, J. & Orr, A. (2004). Speciation. Sinauer Associates, Sunderland, MA.
Goulding, M., Barthem, R. & Ferreira, E. (2003). The Smithsonian atlas of the Amazon.
Smithsonian Institution Scholary Press, Washington, DC.
Henderson, P. A., Hamilton. W. D. & Crampton, W. G. R. (1998). Evolution and
diversity in Amazonian floodplain communities. In: Dynamics of tropical
communities (ed. Newbury, D. M., Prins, H. H. T. & Brown, N. D.), pp. 385–419.
Blackwell Science.
16
Liem, K. F. (1973). Evolutionary strategies and morphological innovations: cichlid
pharyngeal jaws. Systematic Biology, 22(4), 425–441.
Lima, F. C. T. & Ribeiro, A. C. (2011) Continental-scale tectonic controls of
biogeography and ecology. In: Historical biogeography of Neotropical freshwater
fishes (ed. Albert, J. & Reis, R. E.), pp. 145–164. University of California Press,
CA.
López-Fernández, H. & Albert, J. (2011) Paleogene radiations. Historical
biogeography of Neotropical freshwater fishes (ed. Albert, J. & Reis, R. E.), pp.
105–117. University of California Press, CA.
Maan, M. E. & Seehausen, O. (2011). Ecology, sexual selection and speciation.
Ecology Letters, 14(6), 591–602.
MacArthur, R. H. & Wilson, E. O. (1967). The theory of island biogeography. Princeton
University Press, Princeton, NJ.
Nosil, P. (2012). Ecological speciation. Oxford University Press, Oxford, UK.
Pires, T. H. S. (2012). O papel da seleção sexual na manutenção de linhagens
evolutivas: evidências baseadas no comportamento e ecologia de Crenuchus
spilurus Günther, 1863 (Characiformes: Crenuchidae). Dissertação de Mestrado.
Programa de Pós-graduação em Biologia de Água Doce e Pesca Interior, Instituto
Nacional de Pesquisas da Amazônia, Manaus, AM, Brazil. 205 pp.
Pires, T. H. S., Campos, D. F., Röpke, C. P., Sodré, J., Amadio, S. & Zuanon, J.
(2014). Ecology and life- history of Mesonauta festivus: biological traits of a broad
ranged and abundant neotropical cichlid. Environmental Biology of Fishes, 98,
789–799.
17
Ritchie, M. G. (2007). Sexual selection and speciation. Annual Review of Ecology,
Evolution, and Systematics, 38(1), 79–102.
Sioli, H. (1984). The Amazon and its main affluents: hydrography, morphology of the
river courses, and river types. In: The Amazon: limnology and landscape ecology
of a mighty tropical river and its basin (ed. Sioli, H.). pp. 127–165. Springer
Tobler, M., Riesch, R., Tobler, C. M., Schulz-Mirbach, T. & Plath, M. (2009). Natural
and sexual selection against immigrants maintains differentiation among micro-
allopatric populations. Journal of Evolutionary Biology, 22(11), 2298–2304.
Wilkinson, M. J., Marshall, L. G. & Lundberg J. G. (2006). River behavior on megafans
and potential influences on diversification and distribution of aquatic organisms.
Journal of South American Earth Sciences, 21(1-2), 151–172.
Zuanon, J., Py-Daniel, L. R., Ferreira, E. J. G., Claro Jr, L. H. & Mendonça, F. P.
(2008). Padrões de distribuição da ictiofauna na várzea do sistema Solimões-
Amazonas, entre Tabatinga (AM) e Santana (AP). In: Conservação da várzea:
identificação e caracterização de regiões biogeográficas (org. Albernaz, L. K. M.),
pp. 237–285. Ibama, Manaus, AM.
18
CAPÍTULO 1: TRAITS OF A LINEAGE WITH EXTRAORDINARY GEOGRAPHICAL RANGE: ECOLOGY, BEHAVIOR AND LIFE-HISTORY OF THE SAILFIN TETRA CRENUCHUS SPILURUS
Tiago H. S. Pires, Tathyla B. Farago, Daniele F. Campos, Gabriel M. Cardoso and Jansen
Zuanon
Instituto Nacional de Pesquisas da Amazônia – INPA, Cx. Postal 2223, 69080-971,
Manaus, AM, Brasil. thspires@gmail.com; farago.thatyla@gmail.com;
danielefcampos@gmail.com; gabriel_bio@hotmail.com; jzuanon3@gmail.com
ABSTRACT
Current broad geographical distributions of species can only exist because individuals
dispersed from their natal sites. The Amazon’s sailfin tetra Crenuchus spilurus has a
geographical range of over 3 million km2, an area 5.7 times larger than France, which includes
regions of very distinct abiotic and biotic conditions. What traits may aid in explaining such a
broad geographical range, and which make the range exceptional? Here we investigate the
species’ ecology and behavior using several approaches: direct field observations, ecological
surveys, analyses of reproductive parameters, and diet. Broad trophic niche and frequent
reproduction may help explain the wide geographical range, whereas most other traits are
typical of short-ranged species: small body size, specific habitat requirements, small
populations, low mobility, site-fidelity, low fecundity, and large relative size at maturation. We
propose that the broad geographical range of C. spilurus is better explained by passive
processes related to river dynamics. Interestingly, this species is one of few strongly
dichromatic species of Amazon fish, having mutual signaling during courtship, and males
exerting exclusive parental care of eggs and early larval stages. While the combination of such
19
behavioral and ecological characteristics should promote differences among lineages and
(eventually) speciation, populations far apart are remarkably morphologically similar. We
suggest that ecology along with sexual selection may interplay and contribute to the inter-
population morphological similarity, criterion on which Crenuchus is considered a monotypic
genus.
KEYWORDS: behavior, sexual selection, distribution, Amazon, dispersal, niche
INTRODUCTION
Understanding patterns of abundance and distribution of organisms is a central
endeavor of ecology. The causes related to geographical range of lineages depend on
processes of range expansion, which is contingent on the organism’s traits (Laube et al. 2013).
Indeed, several attributes related to dispersal, niche, and life history have been demonstrated
as important in explaining geographical range and range expansions (Brown and Lomolino
1998). Moreover, geographical range is influenced by species-specific factors, which requires
knowledge on the natural history of organisms (Ricklefs 2012).
The large range of an organism may depend on morphological traits as intuitive as
body size, with large organisms occupying larger areas (Van Valen 1973; Reaka 1980;
Jenkins et al. 2007), or simply how more mobile individuals of certain species are (Baguette
and Schtickzelle 2006; Pöyry et al. 2009). Alternatively, broad ranges may be a consequence
of passive dispersion, which is often achieved alongside more mobile organisms or structures,
such as drifting macrophyte rafts (Jokiel 1990; Pires et al. 2014). The breadth of niche traits,
especially those related to habitat use and diet, are also of central importance, as generalist
ecological strategies might increase the likelihood that individuals will find suitable resources
(Gregory and Gaston 2000; Angert et al. 2011). In addition, certain life-history traits may aid
in the establishment of populations in newly colonized areas during range expansion. High
fecundity, frequent reproduction, and reduced size at maturation can reduce generation time
20
and allow for rapid population growth in newly colonized regions to undergo rapid growth (Holt
2003; Perry 2005; Böhning-Gaese et al. 2006; Lenoir et al. 2008).
Evolutionary processes may interact with ecological traits and influence geographical
ranges. Tobias and Seddon (2009) and Östman and Stuart-Fox (2011) found a positive
correlation between sexual selection and ecological generalism, supporting to previous
theoretical expectations (Proulx 1999). Also, widespread organisms are more likely to
diversify, as they are more likely subjected to opportunities for allopatric speciation (Owens et
al. 1999). The likelihood of allopatric speciation, in turn, depends on landscape characteristics.
For example, populations inhabiting spatially heterogeneous environments populations may
not be strongly connected, rendering gene flow scarce (Wright 1932; Losos and Schluter
2000). Under this scenario, a widespread lineage may be either resistant to change, or more
frequently, subdivided into smaller locally adapted populations (Soberón and Peterson 2005).
Given the complex interplay among ecological and evolutionary characteristics,
understanding an organism’s geographical range requires knowledge from different sources
and methodologies. Moreover, data should be made sense of across fields of biology and
related disciplines.
The Neotropical region has the highest diversity of freshwater fish species, and the
Amazon stands out with circa 2,600 described species (Reis et al. 2003) with many new ones
being described every year (Ota et al. 2015). This high diversity is mostly recognized by the
variety of forms (i.e. morphology, as opposed to other phenotypic traits), as most species have
been described based predominantly on morphological characteristics. Though the
mechanisms that generated such diversity are still under debate, it is commonly agreed that
allopatric speciation must be prevalent (Albert et al. 2011). River dynamics is a central part of
the complex geological past of Amazon, with many shifts in river courses occurring through
time (Hoorn et al. 2010). These, in turn, connected and isolated water bodies which increased
the opportunities for allopatric speciation (Albert et al. 2011). The geographical range of many
lineages, however, does not agree with the current pattern of drainages and, in many cases,
21
must be interpreted under the light of ancient connections and general ecological traits of the
lineages (Lima and Ribeiro 2011).
In this study we provide information on the behavior and ecology of what we consider
one of the most interesting lineages of Amazon freshwater fishes: the sailfin tetra, Crenuchus
spilurus (Characiformes: Crenuchidae). This lineage has a surprisingly wide geographical
range (including the Orinoco basin, coastal rivers of Guianas and all major tributaries of the
Amazon River) and unique ecological and behavioral traits that stand out from other members
in its family or order, being more similar to members of the non-related family Cichlidae. Its
sister taxa, genus Poecilocharax, has a much more restricted geographical range, being
confined to the Rio Negro and drainages of the Guianas. Although this paper is focused on
the geographical range of C. spilurus, the detailed description of the natural history here
should have bearings on conservation studies. There is a pressing need for detailed
knowledge of organismal natural history, which is unfortunately lacking for most species
(Angert et al. 2011), and is especially scant for Amazon freshwater fishes.
MATERIAL AND METHODS
Geographical range
Geographic coordinates of occurrence of Crenuchus spilurus were acquired from
Global Biodiversity Information Facility (www.gbif.org) and limited to include only preserved
specimens deposited in museums to filter out possible misidentifications (sampling years from
1958 to 2012). This information was complemented with data from our ecological surveys
(Projeto Igarapés; www.igarapes.bio.br, 427 surveyed streams from 2007 to 2012), as well as
from preserved specimens from Rondônia Federal University’s Ichthiology Lab (LIP-UNIR),
and ethanol preserved tissue samples from the Laboratório de Biologia e Genética de Peixes
of the State University of São Paulo in Botucatu (LBP - UNESP). All records were plotted on
a map and the geographical range was calculated using the Minimum Convex Polygon (MCP)
22
set to include all sampling points (N=727). Area was measured using the package
adehabitatHR (Calenge and Fortmann-Roe 2006) using R version 3.1.1 (R Core Team 2014).
Abiotic factors and abundance
Abundance of C. spilurus in forest streams was assessed through ecological surveys
performed using a standardized methodology, with information stored on the database of
Projeto Igarapés (Amazon Forest Stream Project), a large-scale project maintained by the
senior author of this paper (JZ). Briefly, a 50 m forest stream stretch is blocked using nets of
5 mm mesh size and fish are captured using a variety of non-lethal devices such as hand nets,
dip nets, and seine nets. The abundance (here presented only for C. spilurus) and several
physical and chemical parameters of the environment are taken. The limnological parameters
considered in this study were: pH, dissolved oxygen (mg l-1), conductivity (μS cm-1),
temperature (oC), water velocity (cm s-1), stream width (m), water depth (m) and discharge (m3
s-1). The first four measures were taken using probes (YSI Inc. USA); velocity was measured
as the time taken by a floating plastic disc to drift across 1m, a procedure conducted five times,
with the average kept; width and depth were taken using a 50m tape at four different points,
the average was kept; discharge was measured as the average cross-sectional area (width
by depth from the four measured points within the stretch) multiplied by the average water
velocity. The variable discharge was square root transformed to reduce the influence of
extreme values. No other independent variable was transformed. In total, 78 sampling sites
were considered for analysis. Their geographical extent along with information on abundance
can be found in Fig 2B.
Only sites where at least one individual of C. spilurus was captured were considered
for analysis. This zero truncated dataset was analyzed using a Generalized Linear Model
(GLM) following a negative binomial distribution and a logarithmic link function. The negative
binomial distribution was chosen due to overdispersion in the data (O’hara & Kotze 2010). The
few very high values that generate the overdispersion in abundances were kept for analysis,
23
since as in our personal field observations, this truly reflects the steep imbalance in some
natural populations. Independent variables were filtered out using the backwards stepwise
variables selection procedure (Zuur et al. 2009). The initial model included all variables without
interactions and Akaike Information Criterion (AIC) scores were used to select the best fitting
variables; a variable was dropped when an increase in goodness of fit was detected after its
removal. The same procedure was conducted for an initial model that included all possible
pairwise interactions. The final models were validated checking for the lack of patterns on a
plot of Pearson residuals vs. observed values (Zuur et al. 2009). Interactions were analyzed
separately and were only used to classify the relationship among variables as synergistic,
antagonistic, or buffering. Synergistic interactions occur when both independent variables
affect the response variable in the same direction, and their combined effect is stronger than
additive. Antagonistic interactions occur when both variables affect the response variable in
the same direction (i.e. have the same sign), but their combined effect is lower than additive;
buffering interactions are composed by two predictors of opposite signs so that increase of
one predictor weakens the effect of the other (Cohen et al. 2003).
In situ observations
Naturalistic observations were carried out in the Aldolpho Ducke natural reserve,
located near Manaus, in a first order stream (02°55´ N, 59°59´ W). This stream was partially
dammed up, creating a large (circa 8 m) and shallow (circa 70 cm) area of low discharge that
harbors a large population of C. spilurus under favorable conditions for naturalistic
observations. The data were obtained through direct observations during nearly 90 hours of
monthly snorkeling performed between January 2011 and February 2012. Behavioral
sequences were recorded using a video camera coupled to an underwater case.
Since natural nesting sites are usually out of sight (e.g. covered by the dense
vegetation, tree branches and leaf litter near the banks), ½ inch wide PVC pipes were attached
to sunken tree branches. This facilitated observation of courtship and reproductive behavior
24
in the wild. Males remained inside them for long periods of time inside them. However,
reproductive behavior was rarely observed in the natural environment and was, therefore,
complemented by observations in captivity. Couples were kept in forty-five 40x30x30cm tanks,
under 12:12 light-dark cycle, and a controlled temperature of 23oC. The tanks contained a
filter, a 10cm long and ½ inch wide PVC pipe and an artificial plant. Ad-libitum observations
were conducted with the observer behind a blind (dark cloth) and the interior of the PVC pipes
was checked daily for the presence of eggs. Upon observation of eggs, a video camera was
mounted in front of the tank and videos of about two hours were taken. This procedure was
repeated daily until the nest became empty, either because the male preyed the eggs or
because the fry achieved free swimming phase.
Reproductive strategy and size at maturity
In order to conduct reproductive and diet studies (see below), specimens of C.
spilurus were sampled from five blackwater forest streams near Manaus (coordinates:
02°55´S, 59°59´W; 2°56'S, 59°58'W; 3° 6' S, 59°58'W; 2°56'S, 60° 0'W; 2°23'S, 60°10'W).
After being euthanized and dissected, female reproductive phases were visually evaluated
and categorized following procedures defined by Brown-Petersen et al (2011). Ovaries from
ripe females were immersed into Gilson solution to dissociate the oocytes and conserved in
ethanol solution (70 %) thereafter. Thirteen females had all oocytes counted and measured
under stereomicroscope. The oocyte size distribution was pooled for all females and a density
plot was used for visual inspection of the number of modes, which represent the number of
potential batches. For one additional female (totalizing 14) fecundity was estimated by
counting oocytes of the most developed batch (batch fecundity = BF) using the gravimetric
method (cf. Duponchelle et al. 2007; Mérona et al. 2009). The relative fecundity was obtained
from the ratio between the batch fecundity by the standard length of the fish (mm).
Size at maturity (L50) was calculated using information from 184 specimens (72
females, 74 males, 38 juveniles; size range 9.3 - 45.4 mm; mean 31.6. mm). The number of
25
size classes was calculated following Sturges’ rule (Sturges 1926). A logistic model (run as a
Generalized Linear Model) was carried out using the number of adults and juveniles as a
binary response variable. The coefficients were extracted from the model and used to
calculate size when the proportion of adults was set to 0.5 (i.e. size at which 50% the
population is composed by adults).
Stomach content analysis
One hundred ninety-six specimens obtained at the five aforementioned sampling sites
had stomach contents analyzed (minimum 30, maximum 46 individuals per site). Food items
were identified using a stereoscopic microscope to the most precise taxonomic level possible
and later pooled into the following categories for analysis: Coleoptera, Trichoptera,
Ephemeroptera, Diptera (Chironomidae), Ostracoda, Algae, Detritus, and Plant Material.
Underrepresented items such as sponge spicules and fungi were not considered in the
statistical analysis.
The contribution of each food item was assessed in two steps. Initially, stomach
fullness was assessed as a percentage of the total volume of the stomach (0%, 10%, 25%,
50%, 75% and 100%). After that, the relative volume of each food item was visually assessed
as a percentage of the total volume of stomach content (considered as 100%). This later value
(item contribution) was relativized to the stomach fullness (Goulding et al. 1988). For instance,
when a stomach content was only 50% full and its contents was composed of 50% Coleoptera,
the final value to represent the importance of Coleoptera for that given individual was the
multiplication of these values: 0.25. To test for population (different streams) diet differences
a statistical analysis was conducted using a linear mixed model based on individual
information. A boxcox power transformation (Box and Cox 1964) was used to linearize data.
Fish identity nested within locality was set as the random slope variable to account for
dependency of data, as multiple pieces of information were acquired from the same fish
(different food items). Maximum likelihood estimation was used and the resulting model was
26
compared against a null model that included only the intercept. These two models were
compared using likelihood ratio test. Analysis was conducted in R software using the nlme
package (Pinheiro et al. 2014).
The Alimentary Index (Iai) (Kawakami and Vazzoler 1980) was used to classify the diet
of each population. This index combines the frequency of item occurrence into a single metric
and is widely used to assign trophic categories to species (e.g. Ropke et al. 2014). Population
was designated as specialist in a given food item when its consumption was equal to or higher
than 50%. For cases where no item reached the 50% threshold, similar items with the highest
percentages were pooled, and the local population was classified in a broader trophic category
(e.g. omnivorous).
RESULTS
Geographical range
The total geographical range of the species as calculated by the Minimum Convex
Polygon is 3,131,243 km2 and includes basins of all major water types of the Amazon: white
(turbid) water, blackwater, and clear water (cf. Sioli 1984) (Fig. 1). It is important to highlight
that, while a component of whitewater basins, streams are never as turbid as the main
channels. We refer to this terminology in allusion to the different limnological and geological
characteristics of these water bodies.
27
Fig 1. Geographical range of Crenuchus spilurus. Red dots represent locations where C.
spilurus was sampled; based on combined data from Global Biodiversity Information Facility
(GBIF), Projeto Igarapés, fish collection of Rondônia Federal University (LIP-UNIR), and
Laboratório de Biologia e Genética de Peixes of the State University of São Paulo in Botucatu
(LBP - UNESP); N=727. Dashed line represents the Minimum Convex Polygon (MCP) of
3,131,243 km2, an area roughly 4.5 times larger than Texas (USA), 5.7 times larger than
France and slightly larger than India.
Abiotic factors and abundance Projeto Igarapés’ database comprises of 427 sampled streams, 99 (23%) of which
included at least one individual of C. spilurus. Table 1 shows summary statistics of abiotic
characteristics of these streams. Most populations are small, only a few are very large (Fig 2).
The best model relating abundance and abiotic measures included pH, temperature, and
water velocity as main effects (Table 2). Model selection only considering variable interactions
retained the interaction between water velocity and temperature (Estimate = -0.006; Z= -3.127,
28
P < 0.01). In main effects, water velocity and temperature have opposite signs, indicating a
possible buffering interaction between them.
Fig 2. Abundance of Crenuchus spilurus in ecological surveys in forest streams. A) histogram
of abundance in sampling sites: most populations are small, and only a few are very large. B)
Combined information of location of sampling sites where C. spilurus was found (center of
circles) and local abundance (represented by the size of circles). Seventy-eight sampling sites
were plotted, many overplotted due to proximity. Transparency of larger circles was increased
for clarity. Smallest circles represent localities where only one individual was captured.
A)
B)
250 km
Manaus
Belem
PortoVelho
Iquitos Leticia
Bogota
Georgetown
BoaVista Cayenne
29
Table 1. Summary statistics of measured abiotic variables from 78 streams (surveys from
2007 to 2012) where individuals of C. spilurus were captured.
Abiotic variable Mean ± SD Min - Max
pH 4.59 ± 0.44 3.82 - 6.02
Dissolved Oxygen (mg l-1) 4.65 ± 1.56 0.20 - 8.08
Conductivity (μS cm-1) 15.39 ± 7.9 3.39 - 32.6
Temperature (oC) 25.05 ± 1.04 23.4 - 29.4
Water velocity (cm s-1) 14.75±12.01 0.00 - 50.68
Discharge (m3 s-1) 0.11 ± 0.18 0.00 - 1.10
Stream width (m) 2.33 ± 1.17 0.49 - 6.05
Water depth (m) 0.25 ± 0.13 0.02 - 0.71
Table 2. Summary of main effects of generalized linear model relating abundance of C.
spilurus to environmental abiotic characteristics. Variables were selected based on AIC scores
and optimum model included pH, temperature, and water velocity. Model follows a negative
binomial distribution with log link function. Standardized coefficients (b), unstandardized
coefficients (Estimates), Standard Error (St. Error), 2.5-95% confidence interval, Z-statistic,
and P values are presented. Dispersion parameter was 1.05. N.S. = Not significant.
Term b Estimate St. Error CI (95%) Z P
Intercept -1.862 3.259 -8.07, 3.78 -0.571 0.567
pH -0.022 -0.832 0.285 -1.43, -0.21 -2.916 < 0.01
Temperature 0.020 0.325 0.119 0.12, 0.55 2.724 < 0.01
Water Velocity -0.027 -0.036 0.010 -0.05, 0.01 -3.407 <0.001
In situ observations
Individuals of Crenuchus spilurus spend most of the day sheltered under shaded areas
among structures such as dead leaves and branches, roots and plants. To inspect potential
refuges or approach some object or prey, they use oscillatory movements of the posterior
30
portion of the dorsal fin and pectoral fins; caudal fin movements are used only during larger
displacements, which do not occur often. A common movement is backwards swimming, also
driven by oscillatory movement of the dorsal fin. Most of the time, the movements are restricted
to very short displacements (a few centimeters) then reassuming a stationary position.
Although these movements can be performed sequentially. Seven individuals (recognized by
size and color pattern) were observed staying in areas of nearly one square meter during
seven consecutive days, suggesting site fidelity, or at least that individuals do not move far
from shelter. Feeding occurs during daylight and includes mainly particulate organic matters
that sink slowly through the water column; the fish rarely go to the surface to pick on food
items. Dead tadpoles of Hypsiboas geographicus (Hylidae), fruits of “buriti” palm tree (Mauritia
flexuosa), allochthonous insects (mainly Formicidae), other aquatic invertebrates
(unidentified), and flowers of Thurnia sphaerocephala (Thurniaceae) were seen being
consumed. Feeding events were seldom witnessed. With the exception of sinking particles
and palm tree fruits, the consumption of other feeding items was observed on only one
occasion each.
Courtship receptive females show a darkened abdominal region (Fig. 3). Although
this coloration does not seem to be a necessary requisite for courtship (two courting females
observed in the field did not show this coloration), males courted more vigorously (faster
approach and more conspicuous movements), and fought for females in this condition.
Courtship normally begins when a female with darkened ventral region approaches a male.
Thereafter, the male spreads his dorsal and anal fins and, after a few seconds, he touches
her body with his snout (Fig. 3A). When receptive, females adopt a sinusoidal (S-shaped)
position with the caudal fin positioned on the opposite direction of the male, ending the
movement with her body straight in a quick movement. The male then swims in circles above
the female, a movement that is conspicuously faster than the ordinary swimming movements.
After some bouts of the circular movement the male swims some centimeters towards a
nesting site. In some cases, the male is followed, but more often the female swims away from
31
the male. If not immediately followed, the male usually repeats the movements trying to drive
the female to a sheltered nesting site.
Fig. 3. Part of the courtship sequence of Crenuchus spilurus. A) Female signals receptivity by
darkened abdominal region, male displays fins and swims towards her, touching the side of
her body. B) Female adopts sinusoidal position with mouth open and the caudal fin in the
opposite direction of the male; she proceeds by closing the mouth and ending the movement
with its body in a straight position (lower drawing). C) Male swims in circles, often breaking
the movement when above (left male fish drawing) and in front of (right male drawing) the
female. Arrows indicate direction of the movement.
Spawning and parental care was not observed in the field because inspection of the
nesting sites clearly disturbed the fish. The following description is based on observations of
14 pairs carried out in captivity. After entering the nesting site, the male performs oscillatory
movements with the body and fins while keeping himself stationary inside the nest (in this
case, a section of PVC pipe), in a similar way to the fanning activity, but made without eggs
or larvae (see below). The female enters the nest afterwards and stays side-by-side with the
male. Still oscillating the body, the male pushes the female sideways against the nest wall
where the eggs will be laid. These movements push the female’s body sideways against the
32
upper lateral portion of the shelter, driving her to an upside down position. The eggs are laid
in a single layer at the upper lateral part of the PVC pipes and fertilization occurs immediately.
The courtship behavior may be interrupted at any moment before egg laying and later
resumed.
Courtship behavior seen in the field was often paused by disturbances such as the
approach of a larger fish, presence of predatory species nearby, objects falling on water
surface, and especially, intervention by other (usually larger) males. A couple that was
observed during seven consecutive days in the field did not spawn, even after several courting
acts.
Under captive conditions, no female spawned at the first (observed) time entering a
nesting site with a male (N=14). However, the lack of spawning during the first attempts does
not imply rejection of the male, so that courtship behavior could last over a week (also reported
by Freyhof 1988).
After fertilization of the eggs, the male stays inside the nest and performs vigorous
lateral movements of its body and fins (i.e. fanning), equalizing the thrust force of the caudal
fin with reverse movements of the pectoral fins. During the lateral body oscillation, the male
often adopts an upside down position to fanning the eggs close to the roof of the nesting site,
which usually lasts less than three seconds before returning to an upright position. These
movements are performed during day and night and increase in frequency as the eggs
develop.
The time until the first larvae reaches the free-swimming phase takes anywhere
between six and eight days, during which parental care ceases. During this period, males stay
sheltered and do not feed. The female takes no direct part in the parental care, but is tolerated
(not attacked) by the male near the nest.
Eggs, larvae and growth
33
The only clutch observed in the field had eggs at different developmental stages, but
it is unclear if one or more females had laid them. The eggs are deposited on existing hard
substrate and are reddish-orange and adhesive, measuring circa 1.7 mm. After hatching, the
larvae keep adhered to the substrate through the ventral region of the yolk sack. After one or
two days the larvae start to move erratically inside the nest until the fanning movements push
them away. The larvae then lay at the nest bottom while still feeding on yolk. After the yolk
consumption (about four days after hatching) the larvae have a gape big enough to feed on
large food items such as brine shrimp nauplii (offered under captive conditions), when they
become free-swimming juveniles.
Reproductive parameters
Size at maturity (L50) considering all adults and juveniles was 25.73 mm (Fig. 4A). L50
estimative was higher for males than females; 28 mm and 27.47 mm respectively (n=195).
The oocytes size distribution showed two batches (see modes on Fig. 4B), indicating
that females retain a second batch of oocytes under maturation after spawning. The first
spawning batch was composed of oocytes measuring 1.8 - 2.4 mm of diameter; the mean size
of largest oocyte for each female was 1.64 mm. Mean size of all oocytes ranged from 0.3 to
1.5 mm. Mean batch fecundity was 68 oocytes (± 23.58 SD, min-max: 38 – 109) and mean
relative fecundity was 1.96 oocytes/mm (± 0.58 SD, min-max: 1.12 – 3.05) (n= 10 observed
egg batches).
34
Fig. 4. Reproductive characteristics of the sailfin tetra Crenuchus spilurus. A) Logistic
regression plot of size at maturity (L50) based on 184 sexed individuals. Points represent
proportion of adults in each size-range category and line represents logistic model. Size at
maturity was estimated 25.7 cm, approximately half the maximum size of the species. The
L50 considering only females is 27.47 mm (N=111; 73 mature females and 38 juveniles) and
considering only males is 28.0 mm (N=113; 75 mature males and 38 juveniles). B) Density
plot of oocyte diameter of ten Crenuchus spilurus ripe ovaries. The two modes (near 1.2, and
2.1 mm) indicate asynchronous oocyte development.
Diet
Of the 196 fish analyzed for stomach contents, 41 (21%) had empty stomachs, so
that 155 fish were considered for statistical analysis. The population (different streams) with
the lowest number of individuals with stomach contents had 15, and the maximum was 43.
Variation in diet across the five sampled blackwater streams was pronounced. Regarding
trophic categories of the five populations, one was classified as algivorous (Iai = 57%), two
were classified as detritivorous (Iai = 58% and 71%), and the other two as omnivorous (Iai =
65% and 64%). The two populations assigned as omnivorous differed in relation to the
predominant item: detritus (46%) and insects (24%), respectively. Regarding individual diet,
no food item showed a clearly higher volume when controlling for locality, as evidenced by the
non-significance of the likelihood-ratio test comparing the linear mixed model relating volume
35
of food item to a null model including only the intercept (Likelihood-ratio test: 9.86, P= 0.19).
This can be seen in Fig. 5, where only Ostracoda stands out as a less important item in the
sailfin tetra diet.
Fig. 5. Percentage contribution of food items on stomach contents of Crenuchus spilurus,
highlighting the broad diet of the species. Although ostracods appear to be less represented,
there was no statistically significant difference in food item volumes when accounted for
sampling locality (see results). Horizontal bars represent medians, upper and lower hinges
are first and third quartiles, whiskers represent inter-quartile range; points represent outliers.
Y axis represent volume of items, measured as percentage of total volume of the stomach
and transformed using a boxcox power transformation to achieve normality. Data based on
155 individuals from five streams (minimum 30, maximum 46 individuals per site).
DISCUSSION
Many attributes of organisms can influence their geographical ranges (Angert et al.
2011). The recent growth of interest in biological invasions and range shifts due to climate
36
change has contributed to the study of biological characteristics that may facilitate the
colonization and establishment of populations into newly colonized areas. What emerges from
these studies is that more detailed information on species natural history are necessary,
however scant for most species of Amazon fish. Many lineages of Neotropical freshwater
fishes have wide distributions (often surpassing current barriers to dispersal, Lima and Ribeiro
2011). These geographical patterns are sometimes readily explained by ancient connections,
however such patterns more frequently lack knowledge of ecological information (such as
habitat preferences) to be adequately interpreted. Many of these species have traits that can
aid in explaining such wide ranges, such as close association with vectors for passive
dispersal (e.g. Pires et al. 2014), large body sizes, and broadcast spawning (Barthem et al.
1991). The geographical range of C. spilurus is very broad, especially when considering its
biological and ecological attributes. In this study we gathered information from different
sources and interpreted our results in an eco-evolutionary framework to understand the broad
range of the sailfin tetra.
Being a small-sized species, active dispersal over large distances is unlikely, which is
also indicated by the absence of individuals in the main channel of large rivers. Indeed, active
migration through open areas should be difficult for a small-sized, non-schooling fish in a
predator-rich environment such as the Amazon basin. The specialized use of the oscillatory
movements of the dorsal fin for fine-grained control of movements and the ability of backwards
swimming highlights the species’ close relationship with complex structures. Unlike most
members of the Characiformes, the sailfin tetra is not an active swimmer and rarely ventures
far from the marginal structures of the streams. As a hard substrate spawner, whose larvae
sink to the substrate, the possibility of passive larval dispersal is also reduced and suggests
philopatry. This is also in stark contrast to most species of its order, which is mostly composed
of broadcast spawners or species with little site selection for spawning (Queiroz et al. 2013).
The large egg size may also impose a hindrance to movement. As noted by Baguette and
Schtickzelle (2006), the smaller range of some species may be a consequence of egg load
37
inhibiting female mobility. Indeed, an ongoing parallel study using mtDNA markers detected
strong genetic structures within and between drainages, suggesting little levels of gene flow
among populations (T.H.S.P., in prep). In combination, these results suggest that the broad
range of C. spilurus may be better explained by passive dispersion, on which individuals were
exposed to new environments by the movement of the environment itself. River dynamics are
centerpiece in explaining both the diversity and the broad range of some species of freshwater
fish in the Neotropical region. Changes in the direction of the flow and the formation of new
connections to nearby basins occurring throughout time may have transported the fish fauna
with it and resulting in range expansion (Albert & Reis 2011).
Broad niche breadths may be either a consequence of microevolution in response to
local selective pressures or a general broad tolerance, factors that are often very difficult to
disentangle (Slatyer et al. 2013). Besides, local adaptations can occur for some niche aspects,
but be overall broad for others. This is apparently the case for C. spilurus, where pH tolerance
is apparently a consequence of local adaptation, and diet is most likely broad for the species
as a whole.
Although the presented data suggest a limitation in local abundances posed by low
values of pH, there is already reason to believe that water quality (possibly in relation to pH)
explains differences among lineages of C. spilurus, as based on our parallel mtDNA study. A
possible reason for the high values of abundance under higher pH is the higher productivity
of the nutrient-rich white water environments, which may have impacts on reproductive
parameters, and may result in accelerated population growth (Duponchelle et al. 2007).
Although occurring over a vast geographical area, the abiotic requirements for the
establishment of large local populations of C. spilurus are strict. Based on fieldwork
experience, we anticipated the relationship between abundance and water velocity, as it is
mostly in partially dammed up regions forming pools where high abundances of C. spilurus
were found. This type of pool condition is not common in pristine Amazon forest streams,
which may partially explain why most local populations on forest streams are not very
38
numerous. The buffering relationship between water velocity and temperature may help
explain why records of C. spilurus in floodplain lakes are scarce. For instance, a 15-year long
project sampling fish monthly using seine nets in a floodplain lake near Manaus captured only
three individuals of sailfin tetra, all in one occasion (J.Z. pers. obs.). This suggests that only
floodplain lakes with moderate water temperatures would be able to harbor large populations
of the sailfin tetra. Ria-like conditions naturally created by partial damming of the mouth of
streams and small rivers (Sioli 1984) may favor the establishment of large local populations,
as these environments are typically lotic with mild temperatures. We are unaware of records
of C. spilurus for large river channels. In fact, in relation to the hydrological continuum, most
populations of C. spilurus seem to be confined between headwaters (where temperatures are
lower) and the large channels downstream (higher temperatures). This creates a patchy
distribution of sailfin tetra populations that, while helping explain the genetic structuring,
renders the broad distribution of the species more puzzling when looked under a strict
ecological point of view.
The predictions of Winemiller & Rose (1992) for the association of life history traits
and habitat niche clearly meet those observed for the sailfin tetra. According to this theory,
small-sized fish with moderate size at maturation, low fecundity per spawning event and strong
investment in juvenile survivorship (parental care) typically inhabit constant environments. In
this sense, the semi-lentic conditions of environments inhabited by C. spilurus may buffer
water level variation due to rainfall and generate the locally stable conditions that favor the
species.
Size at maturity of Crenuchus spilurus is 57% of the maximum size captured during
this study (45.7 cm) and 45% of the maximum size registered for the species (5.7 cm)
(Planquette et al. 1996). Although batch fecundity is low, reproduction is apparently not
dependent of specific environmental triggers and may be frequent. Indeed, during laboratorial
experiments one female was able to spawn up to three times in a 45 day period (T.H.S.P
unpublished data). However, the same experiments showed that pair bond formation might
39
be especially restrictive. In the previously mentioned laboratorial experiment only 31 male-
female pairs (out of 336) successfully spawned. In fact, courtship is very complex, involving
mutual signaling between male and female (fin display and abdominal darkening) alongside
with complex movements. This, together with male-only parental care suggests that mate
choice should be mutual (Andersson 1994). Although we succeeded at breeding the fish in
captivity on many occasions, signaling by the female during courtship was directly observed
only during in situ observations. Intuitively, high mate selectivity may decrease the chance of
pair bond formation between two individuals. Given the conflicting pieces of evidence it
remains unclear how factors related to C. spilurus reproduction could affect population growth
and potentially facilitate range expansion.
In contrast, trophic niche stands out as the most explanatory factor that can be related
to the species’ broad range. The sailfin tetra has a proportionally large mouth, which suggests,
together with its small body size, the intake of a variety of food items. Putting together the
information from stomach contents with direct field observation, we confirmed this initial
conjecture. When considering individual-level diet, no food item predominated in stomach
contents, and consumption varied widely at the population level. This suggests an
opportunistic feeding behavior in which the fish will feed predominantly on items that are locally
abundant, not posing a severe diet restriction to colonization of new environments (Röpke et
al. 2014). Given the morphological similarity of C. spilurus populations across its geographical
range (Campanario 2002) we expect that the species’ dietary niche be generally broad,
instead of composed of many locally adapted populations.
Sexual selection
The recognition of Crenuchus as a monotypic genus is based exclusively on
morphological similarity. Campanario (2002) conducted a taxonomical review of C. spilurus
based on morphological data of 2,314 specimens from several sub-basins of Amazonas,
Orinoco and coastal rivers of the Guianas. The low morphological difference (or lack thereof)
40
among populations is surprising, as the species is one of the few Amazon freshwater species
to show both sexual dichromatism and sexual dimorphism. Sexual selection has been put
forward as a key force promoting diversification in many groups of fish (Endler and Houde
1995; Mank 2007), and is pivotal in explaining the high richness of cichlids of the great African
lakes (Doorn et al. 1998). The reasoning is that characteristics under sexual selection directly
affect mating patterns, which can reduce gene flow between incipient lineages (Kraaijeveld et
al. 2011). However, assortative mating may also be a stabilizing factor, by further punishing
rare phenotypes (Kirkpatrick and Nuismer 2004). Tobias and Seddon (2009) and Östman and
Stuart-Fox (2011) found a positive correlation between sexual selection and ecological
generalism, giving support to previous theoretical expectations (Proulx 1999). This raises the
interesting possibility of interplay of sexual selection and ecological generalism, which appear
to be important in explaining the geographical range of the sailfin tetra.
The wide geographical range of C. spilurus may mislead inferences of its ability to
withstand the future effects of ongoing climate change. Similar to many small-sized Amazon
species, populations of C. spilurus have high levels of genetic divergence (our unpublished
data), and are likely comprised of many locally adapted populations. Most of the traits
described here such as low population densities, habitat specialization, low fecundity, and
limited dispersal ability may increase extinction risk (McKinney 1997; Collen et al. 2006;
Walker and Preston 2006). Although the risk of complete extinction of C. spilurus lineage is
low given its broad geographical range, the extinction risk of lineages within the species must
be carefully considered.
ACKNOWLEDGEMENTS
This study was developed under strict observance of Brazilian laws for specimens’
collection and animal ethics (INPA’s institutional Committee for Ethics in Research with
Animals, #052/2012). Voucher specimens of C. spilurus were deposited at INPA’s Fish
Collection in Manaus, Amazonas State, Brazil. The authors are thankful to CNPq and CAPES
41
for providing scholarships and FAPEAM and CNPq for providing support to Projeto Igarapés.
We are grateful to Jefferson Sodré for the courtship drawing, Rafael Leitão, David Saenz,
Luke Bower and Cristhiana Röpke for useful suggestions and English review. JZ receives a
productivity grant from CNPq (#313183/2014-7). This is contribution # 45 of Projeto Igarapés.
REFERENCES Albert JS, Petry P, Reis RE, Albert JS (2011) Major biogeographic and phylogenetic patterns.
In: Historical Biogeography of Neotropical Freshwater Fishes. University of California
Press: Berkeley, CA, USA, pp 21–57
Andersson MB (1994) Sexual selection. Princeton University Press
Angert AL, Crozier LG, Rissler LJ, et al (2011) Do species’ traits predict recent shifts at
expanding range edges? Ecol Lett 14:677–689. doi: 10.1111/j.1461-0248.2011.01620.x
Baguette M, Schtickzelle N (2006) Negative relationship between dispersal distance and
demography in butterfly metapopulations. Ecology 87:648–54. doi: 10.1890/04-1631
Barthem RB, de Brito Ribeiro MCL, Petrere M (1991) Life strategies of some long-distance
migratory catfish in relation to hydroelectric dams in the Amazon Basin. Biol Conserv
55:339–345. doi: 10.1016/0006-3207(91)90037-A
Böhning-Gaese K, Caprano T, van Ewijk K, Veith M (2006) Range size: disentangling current
traits and phylogenetic and biogeographic factors. Am Nat 167:555–567. doi:
10.1086/501078
Box GEP, Cox DR (1964) An Analysis of Transformations. J R Stat Soc Ser B 26:211–252.
doi: 10.2307/2287791
Brown JH, Lomolino M V (1998) Biogeography (2nd edn). Sinauer Associate
42
Brown-Peterson NJ, Wyanski DM, Saborido-Rey F, Macewicz BJ, Lowerre-Barbieri SK (2011)
A standardized terminology for describing reproductive development in fishes. Mar Coast
Fish: Dyn, Manag, Ecosyst Sci 3:52–70
Calenge C (2006) The package adehabitat for the R software: tool for the analysis of space
and habitat use by animals. Ecol Modell 197:516-519
Campanario CM (2002) Revisão taxonômica do gênero Crenuchus Günther (1863), com uma
hipótese sobre a filogenia de Crenuchinae (Characiformes-Ostariophysi). Dissertation.
University of São Paulo
Cohen J, Cohen P, West SG, Aiken LS (2003) Interactions among continuous variables. In:
Applied multiple regression/correlation analysis for the behavioral sciences, 3rd ed.
Mahwah (NJ): Lawrence Erlbaum Associates. pp 255–301
Collen B, Bykova E, Ling S, et al (2006) Extinction risk: A comparative analysis of central asian
vertebrates. Biodivers Conserv 15:1859–1871. doi: 10.1007/s10531-005-4303-6
Doorn GS Van, Noest a. J, Hogeweg P (1998) Sympatric speciation and extinction driven by
environment dependent sexual selection. Proc R Soc B Biol Sci 265:1915–1919. doi:
10.1098/rspb.1998.0520
Duponchelle F, Lino F, Hubert N, et al (2007) Environment-related life-history trait variations
of the red-bellied piranha Pygocentrus nattereri in two river basins of the Bolivian
Amazon. J Fish Biol 71:1113–1134. doi: 10.1111/j.1095-8649.2007.01583.x
Endler J, Houde A (1995) Geographic variation in femlae preferences for male traits in Poecilia
reticulata. Evolution (N Y) 49:456–468.
Freyhof J (1988) Beobachtung bei der Zucht des Prachtsalmen Crenuchus spilurus Günther
1863. Die Aquarien und Terr Zeitschrift 41:209–211.
43
Goulding M, Carvalho ML, Ferreira EJG (1988) Rio Negro, rich life in poor water. SPB
Academic Pub.
Gregory RD, Gaston KJ (2000) Explanations of commonness and rarity in British breeding
birds: separating resource use and resource availability. Oikos 88:515–526. doi:
10.1034/j.1600-0706.2000.880307.x
Holt RD (2003) On the evolutionary ecology of species’ ranges. Evol Ecol Res 5:159–178.
Hoorn C, Wesselingh FP, ter Steege H, et al (2010) Amazonia Through Time: Andean Uplift,
Climate Change, Landscape Evolution, and Biodiversity. Science 330:927–931. doi:
10.1126/science.1194585
Jenkins DG, Brescacin CR, Duxbury C V., et al (2007) Does size matter for dispersal distance?
Glob Ecol Biogeogr 16:415–425. doi: 10.1111/j.1466-8238.2007.00312.x
Jokiel PL (1990) Long-distance dispersal by rafting: reemergence of an old hypothesis.
Endeavour 14:66–73.
Kawakami E, Vazzoler G (1980) Método gráfico e estimativa de incidência alimentar aplicado
no estudo de alimentação de peixes. Bol do Inst Oceanogr 29:205 – 207.
Kirkpatrick M, Nuismer SL (2004) Sexual selection can constrain sympatric speciation. Proc
R Soc B Biol Sci 271:687–693. doi: 10.1098/rspb.2003.2645
Kraaijeveld K, Kraaijeveld-Smit FJL, Maan ME (2011) Sexual selection and speciation: the
comparative evidence revisited. Biol Rev 86:367–377. doi: 10.1111/j.1469-
185X.2010.00150.x
Laube I, Korntheuer H, Schwager M, et al (2013) Towards a more mechanistic understanding
of traits and range sizes. Glob Ecol Biogeogr 22:233–241. doi: 10.1111/j.1466-
8238.2012.00798.x
44
Lenoir J, Gégout JC, Marquet P a, et al (2008) A significant upward shift in plant species
optimum elevation during the 20th century. Science 320:1768–71. doi:
10.1126/science.1156831
Lima FCT, Ribeiro AC (2011) Continental-scale tectonic controls of biogeography and
ecology. In: Historical Biogeography of Neotropical Freshwater Fishes. University of
California Press: Berkeley, CA, USA. pp 145–164.
Losos JB, Schluter D (2000) Analysis of an evolutionary species-area relationship. Nature
408:847–850. doi: 10.1038/35048558
Mank JE (2007) Mating preferences, sexual selection and patterns of cladogenesis in ray-
finned fishes. J Evol Biol 20:597–602. doi: 10.1111/j.1420-9101.2006.01251.x
McKinney ML (1997) Extinction Vulnerability and Selectivity: Combining Ecological and
Paleontological Views. Annu Rev Ecol Syst 28:495–516. doi:
doi:10.1146/annurev.ecolsys.28.1.495
Mérona B, Mol J, Vigouroux R, Chaves PT (2009) Phenotypic plasticity in fish life-history traits
in two neotropical reservoirs: Petit-Saut Reservoir in French Guiana and Brokopondo
Reservoir in Suriname. Neotrop Ichthyol 7(4): 683–692
O’Hara RB, Kotze DJ (2010) Do not log-transform count data. Methods Ecol Evol 1:118–122.
doi: 10.1111/j.2041-210X.2010.00021.x
Östman Ö, Stuart-Fox D (2011) Sexual selection is positively associated with ecological
generalism among agamid lizards. J Evol Biol 24:733–740. doi: 10.1111/j.1420-
9101.2010.02197.x
Ota RR, Message HJ, da Graça WJ, Pavanelli CS (2015) Neotropical Siluriformes as a Model
for Insights on Determining Biodiversity of Animal Groups.
45
Owens IPF, Bennett PM, Harvey PH (1999) Species richness among birds: body size, life
history, sexual selection or ecology? Proc R Soc B Biol Sci 266:933. doi:
10.1098/rspb.1999.0726
Perry AL (2005) Climate Change and Distribution Shifts in Marine Fishes. Science 308:1912–
1915. doi: 10.1126/science.1111322
Pinheiro J, Bates D, DebRoy S, et al (2016) {nlme}: Linear and Nonlinear Mixed Effects
Models.
Pires THS, Campos DF, Röpke CP, et al (2014) Ecology and life-history of Mesonauta
festivus: biological traits of a broad ranged and abundant Neotropical cichlid. Environ Biol
Fishes 98:789–799. doi: 10.1007/s10641-014-0314-z
Planquette P, Keith P, Le Bail P-Y (1996) Atlas des poissons d’eau douce de Guyane. INRA
Editions
Pöyry J, Luoto M, Heikkinen RK, Kuussaari, Mikko Saarinen K (2009) Species traits explain
recent range shifts of Finnish butterflies. Glob Chang Biol 15:732–743. doi:
10.1111/j.1365-2486.2008.01789.x
Proulx SR (1999) Matings Systems and the Evolution of Niche Breadth. Am Nat 154:89–98.
doi: 10.1086/303218
Queiroz LJ, Torrente-Vilara G, Ohara WM, et al (2013) Peixes do rio Madeira. Editora Dialeto
Reaka ML (1980) Geographic Range, Life History Patterns, and Body Size in a Guild of Coral-
Dwelling Mantis Shrimps. Evolution (N Y) 34:1019–1030. doi: 10.2307/2408010
Reis RE, Kullander SO, Ferraris CJ (2003) Check list of the freshwater fishes of South and
Central America. Edipucrs
Ricklefs RE (2012) Naturalists, Natural History, and the Nature of Biological Diversity. Am Nat
46
179:423–435. doi: 10.1086/664622
Röpke CP, Ferreira E, Zuanon J (2014) Seasonal changes in the use of feeding resources by
fish in stands of aquatic macrophytes in an Amazonian floodplain, Brazil. Environ Biol
Fishes 97:401–414. doi: 10.1007/s10641-013-0160-4
Sioli H (1984) The Amazon and its main affluents: hydrography, morphology of the river
courses, and river types. In: The Amazon. Springer, pp 127–165
Slatyer RA, Hirst M, Sexton JP (2013) Niche breadth predicts geographical range size: a
general ecological pattern. Ecol Lett 16:1104–1114. doi: 10.1111/ele.12140
Soberón J, Peterson TA (2005) Interpretation of models of fundamental ecological niches and
species’ distributional areas. Biodivers Informatics 2:1–10. doi: 10.1093/wber/lhm022
Sturges HA (1926) The Choice of a Class Interval. J Am Stat Assoc 21:65–66.
R Development Core Team (2014). R Core Team (2016). R: A language and environment for
statistical computing. R Foundation for Statistical Computing, Vienna, Austria.
Tobias JA, Seddon N (2009) Sexual selection and ecological generalism are correlated in
antbirds. J Evol Biol 22:623–636. doi: 10.1111/j.1420-9101.2008.01678.x
Van Valen L (1973) Body Size and Numbers of Plants and Animals. Evolution (N Y) 27:27–
35.
Walker KJ, Preston CD (2006) Ecological predictors of extinction risk in the flora of lowland
England, UK. Biodivers Conserv 15:1913–1942. doi: 10.1007/s10531-005-4313-4
Winemiller, K. O.; Rose KA (1992) Patterns of life history diversification in North American
Fishes. Can J Fish Aquat Sci 49:2196–2218.
Wright S (1932) The roles of mutation, inbreeding, crossbreeding and selection in evolution.
47
Proc. Sixth Int. Congr. Genet. 1:356–366.
Zuur A, Ieno EN, Walker N, et al (2009) Mixed effects models and extensions in ecology with
R. Springer Science & Business Media
48
CAPÍTULO2: TESTING WALLACE'S INTUITION: WATER TYPE, REPRODUCTIVE ISOLATION, AND DIVERGENCE IN AN AMAZONIAN FISH
T. H. S. Pires1, E. A. Borghezan1, V. N. Machado2, D. Powell3, C. P. Röpke4, C. Oliveira5, J.
Zuanon1 and I. P. Farias2
1 – Laboratório de Ecologia Comportamental e Evolutiva/LECE, Instituto Nacional de
Pesquisas da Amazônia/INPA. Av. André Araújo, 2936 - Petrópolis – PO Box 2223, Manaus
AM, Brazil
2 – Laboratório de Evolução e Genética Animal/LEGAL, Universidade Federal do
Amazonas/UFAM, Manaus, AM, Brazil
3 – Department of Biology, Texas A&M University. TAMU, College Station, TX 77843, USA
4 – Departamento de Ciências Pesqueiras, Faculdade de Ciências Agrárias, Universidade
Federal do Amazonas, Manaus, AM, Brazil
5 – Departamento de Morfologia, Instituto de Biociências, Universidade Estadual Paulista,
Botucatu, SP, Brazil
Keywords: ecological speciation, divergent selection, isolation by adaptation, sexual
selection, reproductive isolation, freshwater
Corresponding author: T. H. S Pires, 2936 Av. André Araújo, - Petrópolis, Manaus AM, Brazil,
thspires@gmail.com
Running title: Ecological speciation in amazon freshwaters
49
Acknowledgements
We would like to thank Dr. Henrique Lazzarotto de Almeida, Dr. Hérnán López-Fernadnez
and Dr. Carolina Doria for lending tissue samples from hard to reach sampling sites used in
this study. Molecular analyses were funded by FAPEAM/SISBIOTA and CNPq/SISBIOTA
Program (No. 563348/2010-0) to IPF. The authors are thankful to CNPq and FAPEAM for
providing scholarships and FAPEAM and CNPq for providing support to LEGAL. This is
contribution 55 of Projeto Igarapés. The authors declare they have no conflict of interest.
Author contributions
Interpretation of data was carried out by all of the authors. DNA extraction and
sequencing were executed by V.L.M. and I.P.F. The majority of the samples used in this study
were collected and maintained by C.O. Experiments of reproductive isolation was carried out
by E.A.B and T.H.S.P. Data analyses were conducted by T.H.S.P. and C.P.R. All authors
contributed to the writing.
50
Testing Wallace's intuition: water type, reproductive isolation, and divergence
in an Amazonian fish
ABSTRACT Alfred Russel Wallace proposed classifying Amazon rivers based on their color and clarity:
white, black and clear water. Wallace also proposed that black-waters could mediate
diversification and yield distinct fish species. Here, we bring evidence of speciation mediated
by water type in the sailfin tetra (Crenuchus spilurus), a fish whose range encompasses rivers
of very distinct hydrochemical conditions. Distribution of the two main lineages concord with
Wallace’s water types: one restricted to the acidic and nutrient-poor waters of the Negro River
(herein Rio Negro lineage) and a second widespread throughout the remaining of the species’
distribution (herein Amazonas lineage). These lineages occur over a very broad geographic
range, suggesting that despite occurring in regions separated by thousands of kilometers,
individuals of the distinct lineages fail to occupy each other’s habitats, hundreds of meters
apart and not separated by physical barrier. Reproductive isolation was assessed in isolated
pairs exposed to black-water conditions. All pairs with at least one individual of the lineage not
native to black-waters showed significantly lower spawning success, suggesting that the water
type affected the fitness and contributed to reproductive isolation. Our results endorse
Wallace’s intuition and highlight the importance of ecological factors in shaping diversity of the
Amazon fish fauna.
51
INTRODUCTION Understanding the formation of species is a central aspiration of evolutionary biology.
Models and empirical evidence under both natural and controlled conditions have supported
the evolutionary importance of a multitude of factors (Coyne & Orr, 2004). Darwin (1859)
envisioned that differences in ecological conditions would drive morphological variation and
ultimately the formation of new species. The recent frameworks termed “ecological speciation”
(Schluter & Conte, 2009; Nosil, 2012) and “speciation by divergent selection” (Langerhans &
Riesch, 2013) have further developed this idea. These concepts posit that evolution of
reproductive isolation between populations result from ecologically based divergent selection,
irrespectively of spatial proximity in the moment when ecological differences between the
lineages develop (Schluter, 2000a; b; Rundle & Nosil, 2005; Forister, 2004; Schluter & Conte,
2009). The recognition of the importance of ecological factors as major contributors to the
formation of new species is increasing, with many studies supporting this phenomenon in a
great variety of organisms (Funk, 1998; McPeek & Wellborn, 1998; Nosil et al., 2002;
McKinnon et al., 2004; Langerhans et al., 2007; Tobler et al., 2008; Amado et al., 2011; Cooke
et al., 2012a, b; Beheregaray et al., 2015).
Local adaptations represent an important way in which natural selection can shape
diversity, as opposed to other evolutionary processes (Kawecki & Ebert, 2004). Reproductive
isolation mediated by local adaptation represents one of the simplest forms in which ecology-
based natural selection drives speciation (Schluter, 2001) and occurs when migrants are
maladapted and unable to reproduce in a non-native environment inhabited by a closely
related population (Hendry, 2004; Nosil et al., 2005; Eizaguirre et al., 2012; Peterson et al.,
2014). This scenario predicts that factors extrinsic to the individuals (i.e. environment) will
penalize the fitness of migrants and mediate reproductive isolation between migrants and
native individuals (Nosil, 2012).
Theory suggests that diversification resulting from divergent selection (e.g. in
allopatric environments with different abiotic and/or biotic conditions) can be facilitated when
individuals have low propensity for migration, and can be remarkable in species that are
52
composed by many small populations (Wright, 1946; Pellissier, 2015). Since colonists carry a
restricted sample of the genetic variation of the ancestral population and differing
environmental conditions can promote rapid adaptation, divergence in response to ecological
conditions can be facilitated by initial genetic drift, with reproductive isolation ultimately
evolving as a byproduct of the interaction between genetic drift and divergent selection
(Wright, 1986; Coyne & Orr, 2004).
The Amazon basin harbors the highest number of freshwater fish species in the world
(Reis et al., 2016). In addition to the number of species formally described, numerous studies
have shown that intraspecific diversity at the molecular level is remarkably high, with many
cases of cryptic species being reported (Amaral et al., 2013; Paz et al., 2014; Benzaquem et
al., 2015; Machado et al., 2018). Whether meriting (taxonomic) species status or not, this high
and widespread variation highlights that the freshwater environment of the Amazon harbors
lineages at different diversifying stages (incomplete speciation, Nosil et al., 2009), making it a
favorable environment for investigations into the processes influencing speciation.
As delimited by Alfred Russel Wallace (1853), Amazon’s freshwater habitats can be
categorized into black-, white-, and blue-waters (= clear, Sioli, 1984; Venticinque et al., 2016).
Wallace apparently also considered the importance of such environments in the formation of
new species of fish. When describing the fish fauna of the Negro River, the largest black-water
river in the Amazon basin, Wallace (1853, p. 467) wrote: “Being a black-water river, most of
its fishes are different from those found in the Amazon”.
The differences in water color are largely a consequence of the geochemistry of the
region and sediment load composition (Sioli, 1984). Most rivers classified as white-waters
have a neutral pH and result from headwaters originating at the Andean cordillera, a recent
geological formation marked by large amounts of dissolved solids. Clear and black-water
rivers differ from whitewater by having headwaters situated in old (cratonic) terrains, the
Brazilian and Guiana shields, respectively (Goulding et al., 2003; Hoorn et al., 2010). Thus,
their sediment composition and hydrochemistry are different from the fast and turbid Andean
53
white (= muddy) waters. Black-water is transparent yet stained by dissolved organic carbon
leached from vegetation and has remarkably low pH (∼5 or lower). Clearwater is largely
transparent, and have hydrochemistry ranging widely and falling in between black- and
whitewater. Although the idea that these water (habitat) types could promote speciation has
been repeatedly suggested (Hubert & Renno, 2006; Willis et al., 2007; Farias & Hrbek, 2008),
only recently has evidence stressing the role of water types as important source of divergent
selection and speciation begun to accumulate (Amado et al., 2011; Cooke et al., 2012a; b,
2014; Beheregaray et al., 2015). Furthermore, direct measures of reproductive isolation
between divergent populations are lacking.
In this study, we investigate phylogeography and reproductive isolation in the sailfin
tetra Crenuchus spilurus Günther 1863 (Characiformes: Crenuchidae), a small-sized and
widespread Amazonian fish species. This species has a geographical range of over three
million square kilometers that includes the Amazon and Orinoco basins, coastal rivers of
Guianas and Suriname, and throughout all major tributaries of Amazon, except the Xingu
River (Pires et al., 2016). As such, populations of C. spilurus is found in both black- and
whitewater basins. Adults of C. spilurus are territorial (Planquette et al., 1996), have reduced
abilities for active dispersal and tend not to swim far from their shelters (Pires et al., 2016).
Eggs are adhesive and are tended by males until detachment from the hard substrate they
are deposited on. This species occurs exclusively in small streams surrounded by forest
(locally termed igarapés). Its absence from main channels creates a patchy distribution of
populations, which is typical of fish living in this kind of environment (Crampton, 2011). Habitat
requirements of C. spilurus are rather strict, being mostly found in slow flowing, naturally
dammed stretches with mild temperatures (Pires et al., 2016). Perhaps as a consequence of
its restricted habitat and low dispersal capabilities, local population sizes are usually small
(Pires et al., 2016). Sexual selection appears to operate on this species, as evidenced by
pronounced sexual dimorphism, with males possessing hypertrophied dorsal and anal fins
that are ornamented with yellow spots and a red rim. These ecological and behavioral
54
characteristics make the sailfin tetra an ideal organism to study diversification in Amazon
region from an eco-evolutionary perspective
MATERIAL AND METHODS
Field samplings
A total of 95 samples of Crenuchus spilurus were collected for molecular analyses.
Samples were collected from 2006 to 2015 from 27 locations spanning almost the entire range
of the species (Fig. 2). Sample size for any given location ranged from one to 10 individuals
(Table S1). Imbalance in sampling size is expected since the species is rarely found in high
abundances, a possible byproduct of its strict habitat requirements (Pires et al., 2016).
Sampled individuals were euthanized using a lethal concentration of clove oil, and whole
specimens were stored in ethanol. Collections in Brazil were carried out under IBAMA
permanent license SISBIO 10199-1 to JZ, 13843-1 to CO, and 11325-1 to IPF. Samples from
Guiana were kindly donated by the Royal Ontario Museum (Toronto, Canada).
DNA extraction, amplification and sequencing
Total genomic DNA was extracted from muscle tissue using a Phenol/Chloroform
protocol (Sambrook et al., 1989). Primers used for DNA amplification are listed in Table S2.
Forward primers were added a M13-tail as a strategy to increase consistency of sequencing
results. All markers were amplified by polymerase chain reaction (PCR) in 15 µL reactions
containing 1.2 µL dNTPs (2.5 mM each), 1.5 µL 10X reaction buffer (75mM Tris HCL, 50 mM
KCL, 20 mM (NH4)2SO4), 1.2 μL 25 mM MgCl2, 1.5 µL of each primer (2 pM each), 0.5 µL of
Taq DNA polymerase, 1 µL of template DNA and 6.6 µL ddH2O. PCR conditions for
mitochondrial genes were as follows: 94 ⁰C (1 min), 35 cycles of 94 ⁰C (30 s), 50 ⁰C (35 s), 72
⁰C (1:30 min), followed by 72 ⁰C (5 min). Exon markers (Myh6 and Glyt) were amplified using
the following nested PCR step. First PCR amplification: 68 ⁰C (1 min), 30 cycles of 93 ⁰C (10
55
s), 50 ⁰C (35 s), 68 ⁰C (1:30 min), followed by a final extension at 68 ⁰C (7 min) for primer set
one. The mix of the second amplification was prepared in the same way as the first, however
adding 1uL of the product obtained from the first PCR amplification. PCR conditions were as
follows: 68 ⁰C (1 min), 35 cycles of 68 ⁰C (10 s), 55 ⁰C (35 s), 68 ⁰C (1:30 min), followed by
68 ⁰C (7 min) for the primer set 2. The PCR products were purified using EXO-SAP
(Exonuclease-Shrimp Alcaline Phosphatase) and cycle sequencing reaction products were
resolved on the ABI 3500 (ThermoFisher) automatic sequencer following the manufacturer’s
recommended protocol.
Alignment
Sequences were inspected by eye for any obvious misreading using the software
FinchTV v1.5.0 (Geospiza, Seattle, WA, USA). Consensus from forward and reverse
sequences were built on SeqTrace v0.9.0 (Stucky, 2012), exported as individual FASTA files
and arranged into a single file using TextWrangler (Bare Bones software, Inc.). Heterozygous
states of nuclear markers were inferred using the coalescent-based Bayesian method
implemented in Phase 2.1 (Stephens et al., 2001, Stephens & Donnelly 2003). Alignment of
consensus sequences was carried out using MUSCLE v3.8.31 (Edgar, 2004). Three datasets
were created and analyzed separately, one for each nuclear marker (Glyt and Myh6), and the
third using all concatenated mtDNA markers (COI, 16S and Cytb). Sequences were inspected
for the presence of stop codons and checked for contamination using Basic Local Alignment
Search Tool (BLAST) on the National Center for Biotechnology Information (NCBI) website
(www.ncbi.nlm.nih.gov).
We evaluated substitution saturation for concatenated mtDNA as well as for each
individual marker using the index of substitution saturation (Iss) and statistical significance
tests implemented in DAMBE (Xia & Xie, 2001) following guidelines from developers (Xia &
Lemey, 2009).
56
Haplotype networks
We constructed haplotype networks for sequences of the two nDNA markers using
TCS (parsimony) networks (Clement et al., 2000) implemented in the program PopART v1.7
(Leigh & Bryant, 2015).
Phylogeny
A phylogeny based on concatenated mtDNA data was constructed using Maximum
Likelihood (ML) procedure in the RAxML Blackbox web-server (http://phylobench.vital-
it.ch/raxml-bb/, Stamatakis et al., 2008). The RaxML analyses were run with a rapid Bootstrap
analysis using a random starting tree and 100 ML bootstrap pseudo-replicates. The ML tree
was later imported into R version 3.4.1 (R Core Team, 2017) using the package APE version
4.1 (Paradis et al., 2004). For clarity of visualization, branches with bootstrap value lesser than
50 and branches shorter than 0.003 were collapsed into polytomies. Following Calcagnotto et
al. (2005), we used two species of genus Poecilocharax (Crenuchidae family) as outgroups,
and Hepsetus (Hepsetidae family) and Hoplias (Erythrinidae family) were used as more distant
outgroups.
Experiment on reproductive isolation
Sampling and rearing of individuals
Based the results of molecular analyses, we sampled live individuals from four
localities that harbor the two different lineages of C. spilurus. All localities have distinct mtDNA
haplotypes: two sampling sites of natural occurrence of the Rio Negro lineage (Negro River,
localities D1 and N1 of Fig. 2) and two of the Amazonas linage (Amazonas and Madeira river,
localities M1 and U2 of Fig. 2). We transferred sampled individuals to several tanks at
Evolutionary Behavioral Ecology Lab at the National Institute for Amazonian Research,
Manaus, northern Brazil. Populations and sexes were strictly segregated into 92-liter tanks.
Tank water was provided by artesian aquifer pumping groundwater from the Negro River basin
57
at Manaus. Thus, limnologic condition of both stock and experimental tanks was similar to
black-water, saving for the absence of dissolved organic carbon.
We conducted experiments described below after an acclimation period of at least
two months. We measured pH and conductivity at three moments using a multiparameter
probe (U-50, Horiba Advanced Techno, Japan): (1) when the first group of fish was placed
into experimental tanks, (2) two months after the beginning of the first trials, and (3) when the
last couples were placed into the tanks. pH was consistently at 5.5 and conductivity at 20 µS
cm-1. Experiments were finished four months after placing the first couples. Tanks had a
constant temperature of 24 oC and a 12:12 h light:dark cycle, both artificially controlled.
Sunrise was simulated by using dimmer red lights that were automatically turned on for 30
min before the brighter white lights were turned on. The same procedure was utilized for
simulating the sunset.
In a previous study, we noticed that couples of similar sizes are more likely to spawn
(unpublished data). We controlled for this by using only size-matched couples in the
experiment. First, we introduced couples into experimental 30-liter tanks, with 40 x 30 cm
(base) and filled to a depth of 25 cm. Tank water was completely renewed each day via a flow
through system exchanging tank water with new water at a rate of 150 ml/h. Each tank
contained two pieces of brown PVC pipe 100 mm long and 20 mm in diameter, which fish
used as shelter and as a nesting site. Two plastic plants provided additional shelter. We
inspected the interior of the PVC pipes for the presence of eggs using a flashlight every day
during the morning for 20 days. After this period, we removed the couples and placed them
into stock tanks. Throughout the entire experiment, we fed the individuals commercial food
pellets (Sera® Vipagran, Germany) twice a day.
In total, we used 322 couples. To test for pre-zygotic reproductive isolation among
lineages (groups of individuals/populations with shared ancestry), couples were divided into
three treatments: (1) “Rio Negro treatment”, in which males and females were from the Rio
Negro lineage (n = 109 couples); (2) “Mixed treatment”, composed of individuals from different
58
lineages (n = 157 couples); (3) “Amazonas treatment”, in which males and females were from
the Amazonas lineage (n = 56 couples). In the two same-lineage treatments (Rio Negro and
Amazonas), individuals could both belong to the same population or to different populations.
Specifically, in the Rio Negro treatment, couples could be composed of male and female from
N1, male and female from D1 or a male from N1 and a female from D1 and vice versa; in the
Amazonas treatment, couples could be composed of male and female from U2, or a male
from U2 and a female from M1 and vice versa (Amazonas treatment). Due to limitations in the
number of individuals sampled, males and females from M1 could not be size-matched and,
therefore, the Amazonas treatment did not include M1 couples. In the different-lineage
treatment, males and females could belong to any of the two populations of each lineage. Size
of couples did not differ among treatments (one-way ANOVA, F = 2.462,319 P = 0.08), and no
couple was used more than once.
We conjectured four hypotheses based on the existence and relative strength of
reproductive isolation between couples composed of native individuals, transplanted
individuals, and mixed couples composed by a native and a transplanted individual. These
hypotheses represented the relative contribution of water types and other processes (e.g.
genetic drift) in the evolution of reproductive isolation. We call these hypotheses as scenarios
A, B, C and D for correspondence with Fig. 1. Scenario A considers that genetic differences
derive from accumulation of neutral mutations in relation to pre-zygotic isolation and absence
of local adaptation to the tested extrinsic characteristics (water type). As such, the observed
genetic differences would have no effect on either sexual communication (no influence of
intrinsic characteristics that could potentially be attributed to neutral processes) nor on the
fitness of migrants (no effect of extrinsic characteristics, i.e. water type, on fitness), resulting
in absence of reproductive isolation among lineages (Fig. 1A). Scenario B considers the
existence of reproductive isolation between the lineages stemming from processes not related
local adaptation to water type (extrinsic characteristics), such as differences in sexual
communication due to genetic drift (intrinsic characteristics). As such, migrants would suffer
59
no fitness decrease, so that couples composed of a transplanted and a native individual would
show lower spawning success (reduced fitness) in relation couples composed of males and
females of the same lineage (Fig. 1B). Scenarios C and D consider two possibilities in which
local adaptation affects migrants (transplanted individuals having lower fitness). Under
scenario C, the influence of local adaptation severely affects the fitness of migrants obscuring
differences in sexual communication in shaping reproductive isolation. As such, couples with
at least one transplanted individual would have reduced fitness in relation to native couples
(Fig. 1C). Scenario D also considers a negative effect of local adaptation on fitness of
migrants, but whose magnitude would not overshadow the potential importance of differences
in sexual communication. Thus, it would be expected that couples composed of transplanted
individuals would have lower fitness compared to couples composed of native individuals, and
that couples with one transplanted individual would have the lowest fitness due to a combined
effect of maladaptation of the transplanted individual and failure in sexual communication
between the different lineages (Fig. 1D). Scenarios A and B consider the effect of neutral
process stemming from geographical separation. In A, neutral processes generated genetic
diversity, but with no effect on (pre-zygotic) reproductive isolation. Scenario B is compatible
with speciation derived from processes neutral in relation to adaptation to water type.
Scenarios C and D represent cases of ecological speciation (environmental characteristics
mediating reproductive isolation) with different degrees of penalties fitness to migrants.
60
Fig. 1. Graphical representation of rival hypotheses considered in this study. Reproductive
isolation (or lack thereof) is represented by the percentage of couples successfully spawning
in three treatments of the conducted experiment. Lineages of the sailfin tetra were exposed to
a black-water environment (acidic and nutrient-poor water), to which the Rio Negro lineage is
native. Rio Negro refers to couples composed of a male and a female of the Rio Negro lineage.
Amazonas refer to couples composed by male and female of the Amazonas lineage, which
does not naturally occur in major black-water basins and were transplanted to black-water
condition. Mixed refers to couples composed of individuals of distinct lineages; i.e. a male
from the Rio Negro lineage and a female from the Amazonas lineage, or vice-versa. A)
Absence of reproductive isolation. B) Reproductive isolation owing solely to problems in
sexual communication (intrinsic characteristics). C) Reproductive isolation due to (non-lethal
but severe) penalty to the fitness of migrants (extrinsic characteristics), suggestive of distinct
local adaptations. D) Combined effect of local adaptation and problems in sexual
communication.
61
Fig. 2 Maximum likelihood phylogeny of the sailfin tetra Crenuchus spilurus based on 1435
bp of mtDNA sequence. Map of northern South America with sampling points. Dots and codes
represent sampling sites color coded to represent the two main lineages defined a posteriori
(orange: Amazonas lineage; gray: Rio Negro lineage).
Statistical procedures
First, we fit a simple logistic model using spawning success as the dependent
variable and a factor with three levels regarding the treatments as the independent variable:
Rio Negro treatment, Mixed treatment and Amazonas treatment. We then analyzed pairwise
differences among treatments using a post-hoc Tukey’s HSD test at the 95% significance
level. The same procedure was conducted to assess within-lineage reproductive isolation
(which would indicate a role of genetic drift in reproductive isolation), using local population
instead of lineage as an independent variable. Based on an observed increased likelihood of
spawning for larger Rio Negro couples (logistic regression, F1,321 = 20.93, P < 0.0001), which
would bias our results analysis, we included size of couples as a covariate in the logistic
regression with population as a factor. This model was comprised of three levels: couples with
both individuals from N1, couples with both individuals from D1, and mixed-population
couples. We conducted all analyses using the software R version 3.4.1 (R Core Team, 2017).
62
Ethical statement
Experiments were conducted following federal law 11.794/2008 and were approved
by local Ethical Committee for Animal Use in Experiments (CEUA 029/2016). No fish died
during or immediately after the experiment.
RESULTS
We obtained and aligned 1435 base pairs (bp) of mtDNA, composed of 459 bp of the
COI region, 568 bp of 16S and 408 bd of Cyt b. Only one sample failed to amplify for mtDNA
markers and was excluded from analysis (Pacaás River, PA on in Fig. 2). Individuals of 28
locations were sequenced, uncovering 34 unique haplotypes. The mtDNA dataset was
characterized by 229 segregating sites, of which 223 were parsimony-informative. The
nucleotide frequencies were A=29.3%, T=29.31%, C=20.69%, G=20.69%. Analysis in
DAMBE showed Iss significantly lower than Iss.sC (symmetrical) and Iss.cA (asymmetrical)
for all markers, suggesting that mtDNA sequences were not saturated and therefore
informative for analysis.
We obtained sequences of nDNA for all samples of all sampling sites. Sequences
were 666 bp long for Glyt marker, showing 27 segregating and 22 parsimony informative sites
and 18 unique haplotypes. The nucleotide frequencies were A=26.59%, T=26.59%,
C=23.41%, and G=23.41%. Sequences of Myh6 were 686 bp long, with 7 segregating sites,
all parsimony informative and 7 unique haplotypes. Nucleotide frequencies were A=28.62%,
T= 28.62%, C=21.38%, and G=21.38%. Sequences are available under Genbank accessions
KY982683-KY982762; KY982763-KY982842; MF062710-MF062787; MF062788-MF062865,
MF062866-MF062943, MG975977-MG976036.
Most groups formed by TCS analysis on Myh6 data were also present in Glyt
network, revealing congruency between the two nuclear markers (Fig. 3). Taken in
combination, these two networks support the separation of C. spilurus into two main lineages,
63
one confined to the Negro River (herein “Rio Negro lineage”) and another widespread in the
Amazon basin and the coastal rivers of Guianas and Suriname (herein “Amazonas lineage”),
without any clear signal of a third lineage (Fig. 3).
Fig. 3 Parsimony networks of Crenuchus spilurus sampled in this study. The networks are
based on haplotypes of two nuclear markers, Myh6 (left, 686 bp) and Glyt (right, 666 bp).
Circle sizes are proportional to the number of individuals sampled for each haplotype and the
number of mutational steps is indicated with dashes along branches. When no dashes are
shown, haplotypes are separated by a single mutational step. Colors represent the two main
lineages (gray = Rio Negro, orange = Amazonas). Colors correspond to those in Fig. 2. Black
circle represents inferred missing haplotype. A representation of these parsimony networks
and map color coded according to location can be found in Fig. S1.
Reproductive isolation
There was significant difference among treatments (�2 = 26.79, d.f. = 2, P < 0.0001),
rejecting the null hypothesis of absence of reproductive isolation between the two lineages.
The post-hoc test showed that couples composed of individuals that naturally occur in acidic
64
and nutrient-poor water (i.e. Rio Negro treatment) had higher spawning success relative to the
other treatments that contained at least one transplanted individual (Table 1). The high
percentage of couples that successfully spawned in the Rio Negro treatment contrasted with
the low percentage of the couples that successfully spawned in the Mixed and Amazonas
treatments (Fig. 4).
Table 1. Tukey’s HSD post hoc test showing pairwise comparison of spawning success
between treatments. Couples composed of at least one individual of the Amazonas lineage
(i.e. Amazonas and Mixed treatments) had a significant lower spawning success.
Comparison Differene 95% Confidence interval
P Lower Upper
Mixed x Rio Negro -0.209 -0.297 -0.121 <0.0001
Amazonas x Rio Negro -0.194 -0.310 -0.077 <0.001
Amazonas x Mixed 0.015 0.095 0.125 0.942
65
Fig. 4. Bar graph representing the percentage of spawning success for each treatment.
Spawning success of couples composed of at least one individual from the Amazonas lineage
(Amazonas and Mixed treatments) are lower when compared to couples composed of two
individuals of the Rio Negro lineage (leftmost gray bar).
Because populations within each lineage are not identical in mtDNA data,
reproductive isolation could also be present among populations of the same lineage, which
would favor more fine-grained environmental characteristics or neutral processes (not water
type as broadly defined) as the main factor influencing reproductive isolation. We tested this
hypothesis by investigating reproductive isolation among all studied populations. Couples
composed of both individuals of U2 had 5.55% (2 out of 36) successful spawning, the same
proportion of successful spawning of couples composed by individuals of U2 and M1 (1 out of
18), which suggests lack of reproductive isolation between these two populations.
Reproductive isolation between the populations of the Rio Negro lineage (N1 and D1) could
be more clearly assessed due to higher spawning success. There was no difference in
spawning success among these three levels after accounting for size of the couples (F = 1.69,
66
P = 0.18). Thus, we conclude that the studied populations within the Negro River basin are
not reproductively isolated despite the steep divergence in mtDNA.
DISCUSSION Unaware of the limnologic differences and classifying the rivers based only on their
appearance, Alfred Russel Wallace (1853) apparently envisaged that water color should be
indicative of important environmental differences to the fish fauna, making special reference
to the distinctiveness of black-waters in relation to other water types in the Amazon basin. Our
results corroborate Wallace’s intuition.
We found strong molecular signals of genetic structuring according to water types in
the Amazon basin, this major division was consistent for both nuclear and mitochondrial DNA,
suggesting ecologically based divergent selection as a major driver of molecular diversity in
the sailfin tetra Crenuchus spilurus. Parsimony networks based on nuclear sequence data
showed that the sailfin tetra is composed of two main lineages across its distribution, one
corresponding to populations living in the Negro River basin and a second widespread
throughout a large portion of the Amazon basin and including the coastal rivers of Guiana.
This pattern suggested that the black-water conditions of the Negro River posed an important
source of divergent selection in this species.
An additional line of evidence for ecological selection comes from the lack of shared
haplotypes between Rio Negro and Amazonas lineages and consequent lack of signal of
interbreeding between them, even in regions where distributions abut (meeting of the Negro
and Amazon rivers). The distributions of both lineages abruptly end where they encounter a
different water (habitat) type. This eco-geographical distribution indicates that the lineages are
prevented from mating in natural environments because of past exposure to different
ecological conditions (Nosil, 2012).
Using representatives of lineages demarcated by the molecular data we confirmed
that the lineages are reproductively isolated. Furthermore, one of the lineages failed to spawn
into the non-native environment, suggesting that the reduced fitness was mediated by extrinsic
67
factors. This finding further supports that ecological factors mediate reproductive isolation
among lineages of the sailfin tetra.
Speciation mediated by ecological factors occurs irrespectively of spatial proximity in
the moment when ecological differences between the lineages develop (Schluter, 2000b,
2001; Forister, 2004). However, because water type is a macroregional habitat characteristic,
its influence in mediating reproductive isolation most likely occurred in a scenario where
geographical separation acted in conjunction with divergent ecological selection. Regardless
of the mechanism that contributed to the initiation of the diversifying process, our results
suggest a strong influence of local adaptation on reproductive isolation. As such, our study
endorses the more recent shift in focus of evolutionary studies away from speciation models
based solely on allopatry (Ogden & Thorpe, 2002). Our results suggest a process similar to
the mechanism termed “immigrant inviability”, in which divergent selection generates locally
adapted lineages and consequently lower survival of migrants (Nosil et al., 2005; Nosil, 2012).
Unlike immigrant inviability, however, reproductive isolation in our experiment was mediated
by the fitness components related to reproduction, but not to survival, as no fish died before
and during the experiment. The lower fitness of transplanted individuals in our experiment
could have resulted from physiological stress affecting reproduction, which can occur through
several processes (Schreck, 2010). Because low levels of stress may have a positive effect
on reproductive processes (Schreck, 2010), transplanted individuals were probably suffering
high physiological costs to keep homeostasis in the black-water.
A putative source of selection on Amazon black-waters is its low pH, as this abiotic
characteristic has been long recognized to constitute a major physiological challenge for fish
(Nelson, 2015). A lack of adaptation to the low pH to which individuals of the Amazonas
lineage were exposed in the experiment could have constituted a stressing environment,
resulting in the low reproductive success. This seems to be occur for the discus cichlid (genus
Symphysodon), a genus composed of species of low vagility for which Amado et al. (2011)
found a relationship of pH and the distribution of lineages. The deep molecular divergence
68
observed in this study suggest that traits other than local adaptation to hydrochemical
conditions distinguish the two main lineages of C. spilurus. Uncovering such differences and
investigating their possible (and relative) contribution to reproductive isolation is a major
avenue for future research.
The very high levels of geographically structured genetic variation observed in this
study were already expected given the ecological characteristics of the sailfin tetra. The low
vagility of adults, site-fidelity, nesting behavior, and parental care, result in limited active
dispersal. This, in combination with the fact that populations of C. spilurus are confined to
small streams with specific habitat requirements, creates a patchy distribution of its
populations. Furthermore, this species is not commonly found in high abundances in nature
(Pires et al., 2016). Taken together, these factors should increase chances of genetic drift and
selection to create diversity and leave signatures of local population structures. Indeed,
reduced vagility, small (effective) population size, and ecological specialization have been
highlighted several times as important characteristics that facilitate diversification (Wright,
1946; Vrba, 1980; Ohta, 1992; Schluter, 2000b; Griffiths, 2015; Pellissier, 2015). However,
genetic drift alone might contribute little to the evolution of reproductive isolation (Sobel et al.,
2010). In this study, the lack of reproductive isolation between tested populations from within
the Rio Negro indicates that the observed variation in mtDNA is largely neutral in relation to
pre-zygotic isolation.
The sailfin tetra stands out as one of the few species of Amazon characiform fishes
with very strong sexual dimorphism, implying that sexual selection poses an important source
of selection. Sexual selection can accelerate divergence under modest levels of gene flow,
potentially generating divergence regardless of the environmental conditions (Mendelson et
al., 2014). This may be particularly relevant for sexual dimorphism manifested in ornaments,
as it is a primary target of sexual selection through female choice (Andersson, 1994), a
mechanism that can lead to genetic coupling, prompting divergence solely by male-female
interaction (Lande, 1981; Kirkpatrick, 1982; Ritchie, 2007), or driven by subtle differences in
69
natural selection (Pomiankowski & Iwasa, 1998). Our results, however, indicate a strong
relationship between molecular divergence and one of the starkest differences in
environmental conditions in Amazon freshwaters (water types). Whether sexual selection
contributes to increasing divergence in the sailfin tetra, the highest degree of variation was
observed for the different water types, supporting a scenario where sexual selection is coupled
to ecological selection. As such, our results further suggest that the contribution of sexual
selection to speciation is most clearly observed when in synchrony with natural selection,
which has been suggested to be the most common case in nature (Maan & Seehausen, 2011).
Divergence in sexually selected traits among lineages and potential role of mate choice in
maintaining lineage divergence have been tested and will be presented in a later study.
Despite the long-lasting perception that water types could be important agents in the
formation of biological diversity in the Amazon basin, information on species geographical
distribution accumulated in the last decades rendered it less relevant or uncertain. For
instance, analyses based on maps of occurrence points suggest that the distribution of many
nominal species correspond more closely to modern or ancient drainage basin boundaries
than characteristics of landscape or habitat (Albert & Reis, 2011). Indeed, the importance of
current drainages as well as past divides are commonly referred to in the literature on
diversification of Neotropical fish fauna (Hubert & Renno, 2006; Hubert et al., 2007; Tagliacollo
et al., 2015). However, analyses based on newer techniques are bringing ecology to the
spotlight. Models based solely on macroclimatic characteristics can predict with high accuracy
the distribution of many species, regardless of current basin boundaries (e.g. Frederico et al.,
2014). Moreover, several investigations based on molecular data have highlighted the
importance of Amazon water types in generating new species (reviewed in Beheregaray et
al., 2015).
The importance of adaptive divergence in response to different abiotic conditions is
mostly known from studies of plants cultivated on different soil types and at different elevations
(MacNair & Christie, 1983; Antonovics, 2006; Tobler et al., 2008). Our results provide
70
empirical data on the role of hydrochemical environments as agents of speciation in fish.
Furthermore, our findings highlight the importance of the surrounding forest and soil
composition to fish diversity in Amazon sub-basins. Black-waters are formed by the
incomplete decomposition of leaf litter from forests growing on podzolized white-quartz sand
soil. As such, the existence of black-water environments depends on the surrounding terrain
and vegetation. Consequently, deforestation is expected not only to have impact on the
terrestrial environment, but also to result in loss of biodiversity by means of extinction of
aquatic species (Brook et al., 2003; Nogueira et al., 2010).
BIBLIOGRAPHY
Albert, J. & Reis, R.E. 2011. Introduction to Neotropical Freshwaters. In: Historical
Biogeography of Neotropical Freshwater Fishes (R. Albert, J., Reis, ed), pp. 3–19.
University of California Press, Berkeley, CA.
Amado, M.V., Farias, I.P. & Hrbek, T. 2011. A molecular perspective on systematics,
taxonomy and classification amazonian discus fishes of the genus Symphysodon. Int. J.
Evol. Biol. 2011: 1–16.
Amaral, C.R.L., Brito, P.M., Silva, D.A. & Carvalho, E.F. 2013. A new cryptic species of South
American freshwater pufferfish of the genus Colomesus (Tetraodontidae), based on both
morphology and DNA data. PloS One 8: e74397.
Andersson, M.B. 1994. Sexual selection. Princeton University Press.
Antonovics, J. 2006. Evolution in closely adjacent plant populations X: long-term persistence
of prereproductive isolation at a mine boundary. Heredity 97: 33–37.
Beheregaray, L.B., Cooke, G.M., Chao, N.L. & Landguth, E.L. 2015. Ecological speciation in
71
the tropics: Insights from comparative genetic studies in Amazonia. Front. Genet. 5: 1–
19.
Benzaquem, D.C., Oliveira, C., Da Silva Batista, J., Zuanon, J. & Porto, J.I.R. 2015. DNA
barcoding in pencilfishes (Lebiasinidae: Nannostomus) reveals cryptic diversity across
the Brazilian Amazon. PloS One 10: 1–14.
Brook, B.W., Sodhi, N.S. & Ng, P.K.L. 2003. Catastrophic extinctions follow deforestation in
Singapore. Nature 424: 420–426.
Calcagnotto, D., Schaefer, S.A. & DeSalle, R. 2005. Relationships among characiform fishes
inferred from analysis of nuclear and mitochondrial gene sequences. Mol. Phylogenet.
Evol. 36: 135–153.
Clement, M., Posada, D. & Crandall, K.A. 2000. TCS: A computer program to estimate gene
genealogies. Mol. Ecol. 9: 1657–1659.
Cooke, G.M., Chao, N.L. & Beheregaray, L.B. 2012a. Marine incursions, cryptic species and
ecological diversification in Amazonia: The biogeographic history of the croaker genus
Plagioscion (Sciaenidae). J. Biogeogr. 39: 724–738.
Cooke, G.M., Chao, N.L. & Beheregaray, L.B. 2012b. Natural selection in the water:
Freshwater invasion and adaptation by water colour in the Amazonian pufferfish. J. Evol.
Biol. 25: 1305–1320.
Cooke, G.M., Landguth, E.L. & Beheregaray, L.B. 2014. Riverscape genetics identifies
replicated ecological divergence across an Amazonian ecotone. Evolution 68: 1947–
1960.
Coyne, J. & Orr, A. 2004. Speciation. Sinauer Associates, Sunderland, MA.
Crampton, W.G.R. 2011. An ecological perspective on diversity and distributions. In: Historical
72
Biogeography of Neotropical Freshwater Fishes (R. E. Albert, J., Reis, ed), pp. 165–189.
University of California Press, Berkeley, CA.
Darwin, C. 1859. On the Origin of Species. D. Appleton and Company, New York.
Edgar, R.C. 2004. MUSCLE: Multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Res. 32: 1792–1797.
Eizaguirre, C., Lenz, T.L., Kalbe, M. & Milinski, M. 2012. Divergent selection on locally adapted
major histocompatibility complex immune genes experimentally proven in the field. Ecol.
Lett. 15: 723–731. Wiley Online Library.
Excoffier, L. & Lischer, H.E.L. 2010. Arlequin suite ver 3.5: A new series of programs to
perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 10:
564–567.
Excoffier, L., Smouse, P.E. & Quattro, J.M. 1992. Analysis of molecular variance inferred from
metric distances among DNA haplotypes: Application to human mitochondrial DNA
restriction data. Genetics 131: 479–491.
Farias, I.P. & Hrbek, T. 2008. Patterns of diversification in the discus fishes (Symphysodon
spp. Cichlidae) of the Amazon basin. Mol. Phylogenet. Evol. 49: 32–43.
Forister, M.L. 2004. Oviposition preference and larval performance within a diverging lineage
of lyceanid butterflies. Ecol. Entomol. 29: 264–272.
Frederico, R.G., De Marco, P. & Zuanon, J. 2014. Evaluating the use of macroscale variables
as proxies for local aquatic variables and to model stream fish distributions. Freshw. Biol.
59: 2303–2314.
Funk, D.J. 1998. Isolating a role for natural selection in speciation: host adaptation and sexual
isolation in Neochlamisus bebbianae leaf beetles. Evolution 52: 1744–1759.
73
Goulding, M., Barthem, R. & Ferreira, E. 2003. The Smithsonian atlas of the Amazon.
Smithsonian Press, Washington DC.
Griffiths, D. 2015. Connectivity and vagility determine spatial richness gradients and
diversification of freshwater fish in North America and Europe. Biol. J. Linn. Soc. 116:
773–786.
Hendry, A.P. 2004. Selection against migrants contributes to the rapid evolution of ecologically
dependent reproductive isolation. Evol. Ecol. Res. 6: 1219–1236.
Hubert, N. & Renno, J.F. 2006. Historical biogeography of South American freshwater fishes.
J. Biogeogr. 33: 1414–1436.
Hubert, N., Duponchelle, F., Nuñez, J., Garcia-Davila, C., Paugy, D. & Renno, J.F. 2007.
Phylogeography of the piranha genera Serrasalmus and Pygocentrus: Implications for
the diversification of the Neotropical ichthyofauna. Mol. Ecol. 16: 2115–2136.
Hoorn, C., F. P. Wesselingh, H. ter Steege, M. A. Bermudez, A. Mora, J. Sevink, I. Sanmartín,
A. Sanchez-Meseguer, C. L. Anderson, J. P. Figueiredo, C. Jaramillo, D. Riff, F. R. Negri,
H. Hooghiemstra, J. G. Lundberg, T. Stadler, T. Särkinen, & A. Antonelli, 2010. Amazonia
through time: Andean uplift, climate change, landscape evolution, and biodiversity.
Science. 330: 927–931.
Kawecki, T. & Ebert, D. 2004. Conceptual issues in local adaptation. Ecol. Lett. 7: 1225–1241.
Kirkpatrick, M. 1982. Sexual selection and the evolution of female cho. Evolution 36: 1–12.
Lande, R. 1981. Models of speciation by sexual selection on polygenic traits. Proc. Natl. Acad.
Sci. U. S. A. 78: 3721–3725.
Langerhans, R.B. & Riesch, R. 2013. Speciation by selection: a framework for understanding
ecology’s role in speciation. Curr. Zool. 59: 31–52.
74
Langerhans, R.B., Gifford, M.E. & Joseph, E.O. 2007. Ecological speciation in Gambusia
fishes. Evolution (N. Y). 61: 2056–2074.
Leigh, J.W. & Bryant, D. 2015. Popart: Full-Feature Software for Haplotype Network
Construction. Methods Ecol. Evol. 6: 1110–1116.
Maan, M.E. & Seehausen, O. 2011. Ecology, sexual selection and speciation. Ecol. Lett. 14:
591–602.
Machado, V. N., Collins, R. A., Andrade, M. C., Ota, R. P., Farias, I. P., and Hrbek, T. 2018.
One thousand DNA barcodes of piranhas and pacus reveal geographic structure and
unrecognized diversity in the Amazon. Sci. Rep. accepted paper.
MacNair, M.R. & Christie, P. 1983. Reproductive isolation as a pleiotropic effect of copper
tolerance in Mimulus guttatus? Heredity (Edinb). 50: 295–302.
McKinnon, J.S., Mori, S., Blackman, B.K., David, L., Kingsley, D.M., Jamieson, L., et al. 2004.
Evidence for ecology’s role in speciation. Nature 429: 294–298.
McPeek, M.A. & Wellborn, G.A. 1998. Genetic variation and reproductive isolation among
phenotypically divergent amphipod populations. Limnol. Oceanogr. 43: 1162–1169.
Mendelson, T.C., Martin, M.D. & Flaxman, S.M. 2014. Mutation-order divergence by sexual
selection: Diversification of sexual signals in similar environments as a first step in
speciation. Ecol. Lett. 17: 1053–1066.
Nelson, J. 2015. Pickled fish anyone? In: Extremophile Fishes: Ecology, Evolution, and
Physiology of Teleosts in Extreme Environments, pp. 193–215. Springer International
Publishing.
Nogueira, C., Buckup, P.A., Menezes, N.A., Oyakawa, O.T., Kasecker, T.P., Neto, M.B.R., et
al. 2010. Restricted-range fishes and the conservation of Brazilian freshwaters. PloS One
75
5: 1–10.
Nosil, P. 2012. Ecological speciation. Oxford University Press.
Nosil, P., Crespi, B.J. & Sandoval, C.P. 2002. Host-plant adaptation drives the parallel
evolution of reproductive isolation. Nature 417: 440–443.
Nosil, P., Harmon, L.J. & Seehausen, O. 2009. Ecological explanations for (incomplete)
speciation. Trends Ecol. Evol. 24: 145–156.
Nosil, P., Vines, T.H. & Funk, D.J. 2005. Reproductive isolation by natural selection against
immigrants from divergent habitats. Evolution 59: 705–719.
Ogden, R. & Thorpe, R.S. 2002. Molecular evidence for ecological speciation in tropical
habitats. Proc. Natl. Acad. Sci. U. S. A. 99: 13612–13615.
Ohta, T. 1992. The nearly neutral theory of molecular evolution. Annu. Rev. Ecol. Syst. 23:
263–286.
Paradis, E., Claude, J. & Strimmer, K. 2004. APE: analyses of phylogenetics and evolution in
R language. Bioinformatics 20: 289–290.
Paz, F.P.C., Batista, J.D.S. & Porto, J.I.R. 2014. DNA barcodes of rosy tetras and allied
species (Characiformes: Characidae: Hyphessobrycon) from the Brazilian Amazon
basin. PloS One 9: 1–8.
Pellissier, L. 2015. Stability and the competition-dispersal trade-off as drivers of speciation
and biodiversity gradients. Front. Ecol. Evol. 3: 1–10.
Peterson, D.A., Hilborn, R. & Hauser, L. 2014. Local adaptation limits lifetime reproductive
success of dispersers in a wild salmon metapopulation. Nat. Commun. 5: 3696.
Pires, T.H.S., Farago, T.B., Campos, D.F., Cardoso, G.M. & Zuanon, J. 2016. Traits of a
76
lineage with extraordinary geographical range: ecology, behavior and life-history of the
sailfin tetra Crenuchus spilurus. Environ. Biol. Fishes 99: 925–937. Environmental
Biology of Fishes.
Planquette, P., Keith, P. & Le Bail, P.Y. 1996. Atlas des Poissons d’eau Douce de Guyane
(tome 1). Collection du Patrimoine Naturel, Paris.
Pomiankowski, A. & Iwasa, Y. 1998. Runaway ornament diversity caused by Fisherian sexual
selection. Proc. Natl. Acad. Sci. U. S. A. 95: 5106–5111.
R Core Team. 2017. R: A language and environment for statistical computing. R Foundation
for Statistical Computing, https://www.R-project.org/, Vienna, Austria.
Reis, R.E., Albert, J.S., Di Dario, F., Mincarone, M.M., Petry, P. & Rocha, L.A. 2016. Fish
biodiversity and conservation in South America. J. Fish Biol. 89: 12–47.
Ritchie, M.G. 2007. Sexual Selection and Speciation. Annu. Rev. Ecol. Evol. Syst. 38: 79–
102.
Rundle, H.D. & Nosil, P. 2005. Ecological speciation. Ecol. Lett. 8: 336–352.
Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989. Molecular cloning: a laboratoty manual, 2nd
ed. Cold spring harbor laboratory press, New York.
Schluter, D. & Conte, G.L. 2009. Genetics and ecological speciation. Proc. Natl. Acad. Sci. U.
S. A. 106: 9955–62.
Schluter, D. 2000a. Ecological character displacement in adaptive radiation. Am. Nat. 156:
S4–S16.
Schluter, D. 2000b. The Ecology of Adaptive Radiation. Oxford University Press, Oxford.
Schluter, D. 2001. Ecology and the origin of species. Trends Ecol. Evol. 16: 372–380.
77
Schreck, C.B. 2010. Stress and fish reproduction: The roles of allostasis and hormesis. Gen.
Comp. Endocrinol. 165: 549–556.
Sioli, H. 1984. The Amazon and its main affluents: hydrography, morphology of the river
courses, and river types. In: The Amazon, pp. 127–165. Springer.
Sobel, J.M., Chen, G.F., Watt, L.R. & Schemske, D.W. 2010. The biology of speciation.
Evolution (N. Y). 64: 295–315.
Stamatakis, A., Hoover, P., Rougemont, J. & Renner, S. 2008. A Rapid Bootstrap Algorithm
for the RaxML Web Servers. Syst. Biol. 57: 758–771.
Stephens, M., Smith, N.J. & Donnelly, P. 2001. A New Statistical Method for Haplotype
Reconstruction from Population Data. Am. J. Hum. Genet. 68: 978–989.
Stephens, M. & Donnelly, P. 2003. A Comparison of Bayesian Methods for Haplotype
Reconstruction from Population Genotype Data. Am. J. Hum. Genet. 73: 1162–1169.
Stucky, B.J. 2012. SeqTrace: A graphical tool for rapidly Processing DNA sequencing
chromatograms. 90–93.
Tagliacollo, V.A., Roxo, F.F., Duke-Sylvester, S.M., Oliveira, C. & Albert, J.S. 2015.
Biogeographical signature of river capture events in Amazonian lowlands. J. Biogeogr.
42: 2349–2362.
Tobler, M., DeWitt, T.J., Schlupp, I., García De León, F.J., Herrmann, R., Feulner, P.G.D., et
al. 2008. Toxic hydrogen sulfide and dark caves: Phenotypic and genetic divergence
across two abiotic environmental gradients in Poecilia mexicana. Evolution. 62: 2643–
2659.
Venticinque, E., B. Forsberg, B. R. Barthen, P. Petry, L. Hess, A. Mercado, C. Canãs, M.
Montoya, C. Durigan, & M. Goulding, 2016. An explicit GIS-based river basin framework
78
for aquatic ecosystem conservation in the Amazon. Earth Syst. Sci. Data. 8: 651–661.
Vrba, E. 1980. Evolution, species and fossils-how does life evolve. S. Afr. J. Sci. 76: 61–84.
Wallace, A.R. 1853. A narrative of travels on the Amazon and Rio Negro: with an account of
the native tribes, and observations on the climate, geology, and natural history of the
Amazon Valley, 1st ed. Reeve and Co, London.
Willis, S.C., Nunes, M.S., Montaña, C.G., Farias, I.P. & Lovejoy, N.R. 2007. Systematics,
biogeography, and evolution of the Neotropical peacock basses Cichla (Perciformes:
Cichlidae). Mol. Phylogenet. Evol. 44: 291–307.
Wright, S. 1946. Isolation by distance under diverse systems of mating. Genetics 31: 39–59.
Wright, S. 1986. Evolution: selected papers. University of Chicago Press.
Xia, X. & Lemey, P. 2009. Assessing substitution saturation with DAMBE. In: The phylogenetic
handbook: a practical approach to DNA and protein phylogeny, pp. 615–630. Cambrige
University Press, Cambridge.
Xia, X. & Xie, Z. 2001. DAMBE: Software package for Data Analysis in Molecular Biology and
Evolution. J. Hered. 92: 371–373.
SUPPORTING INFORMATION
Table S1. Sampling locations, number of individuals, and type of water of the basins where
samples Crenuchus spilurus used in this work were obtained. N = number of sequenced
individuals.
Location code
Water type of
Closest tributary2
Drains to N Coordinates
79
sub-basin1
CJ1 Black Coari River Amazonas River
4 4°7’1.67”S; 63°10’30.17”W
CJ2 Black* Igarapé Ting Ling
Amazonas River
3 0°47’27.33”S; 52°29’55.62”W
D1 Black Cuieiras River Negro River
3 2°23’25.52”S; 60°10’15.13”W
D2 Black Jaú River Negro River
3 1°52’27.40”S; 61°41’9.60”W
D3 Black Jaú River Negro River
3 2°1’45.90”S; 61°51’51.80”W
D4 Black Negro River Negro River
3 0°6’48.18”S; 66°48’44.64”W
G1 White** Demerara River Atlantic Ocean
2 6°42’25.17”N;58° 9’35.47”W
G2 White** Akawini River Atlantic Ocean
1 7°24’6.02”N; 58°41’58.68”W
L1 White Amazonas River Amazonas River
2 3°13’44.20”S;60°38’39.40”W
L2 White Igarapé do Alencar
Amazonas River
2 3°5’57.70”S; 58°27’18.00”W
L3 Clear Anapu River Amazonas River
10 1°45’49.49”S;51°19’59.96”W
L4 White Amazonas River Amazonas River
4 0°52’45.10”S; 48°35’35.90”W
L5 White Igarapé Taiassuí Amazonas River
5 1°56’19.70”S; 48°55’41.90”W
L6 White Igarapé São Sebastião
Amazonas River
2 1°37’59.50”S; 48°43’41.10”W
L7 White Igarapé Santa Isabel
Amazonas River
4 1°23’43.70”S; 48°14’57.60”W
L8 White Igarapé Miri Amazonas River
4 1°35’7.47”S; 48°10’9.90”W
L9 White Igarapé Cajueirinho
Atlantic Ocean
5 1°5’7.80”S; 46°51’44.30”W
80
M1 White Igarapé Belmont Madeira River
7 6°0’0.07”S; 60° 8’17.40”W
M2 Clear Aripuanã River Madeira River
5 8°39’1.99”S; 63°50’10.63”W
N1 Black Igarapé Jibóia Negro River
7 3°6’22.94”S; 59°58’42.48”W
N3 Black Negro River Negro River
5 2°48’47.10”S; 60°55’31.00”W
N4 Black Daraha River Negro River
3 2°9’33.30”S; 61°17’4.09”W
N5 Black Unini River Negro River
1 1°51’13.50”S;63° 4’25.10”W
N6 Black Unini River Negro River
1 1°47’58.30”S; 63°54’57.60”W
N7 Black Unini River Negro River
1 1°45’17.80”S; 63°52’5.60”W
PA White Pacaás River Amazonas River
1 10°53’18.20”S; 65°14’35.20”W
U1 White Marañon River Amazonas River
1 4°0’46.20”S; 73°27’47.70”W
U2 White Nanay River Amazonas River
3 3°50’25.30”S; 73°22’51.60”W
1Classification of large rivers into water type follow Goulding et al. (2003), unless noted otherwise.
2The name of the closest tributary is presented when the specific stream lacks a name. *PA sample failed to amplify for 16S and Cytb markers. *Jari River has a highly seasonal hydrochemistry and is here categorized as black-water based on minimum levels of pH, low conductivity and sediment load (Ussami, 2011). ** Classification into water type based on influence of the Amazon plume into nearby coastal rivers.
Goulding, M., Barthem, R. & Ferreira, E. 2003. The Smithsonian atlas of the Amazon.
Ussami, H. 2004. Estudos de Inventário Hidrelétrico, relatório final, Bacia hidrográfica do
rio Jari – PA/AP.
81
Table S2. PCR primer sets or cocktails used to amplify genetic markers used in this study,
with references.
Gene Primers Marker length (bp)
Reference
CO1 F280 5` CATAGCATTTCCGCGAATAAA 3` 459 Designed for this study
VR1d 5` CAGGAAACAGCTATGAC 3` Ivanova et al., 2007
16S 16Sa 5`CGCCTGTTTATCAAAAACAT 3` 568 Palumbi, 1996
16Sb 5`CCGGTCTGAACTCAGATCACGT 3` Palumbi, 1996
Cytb L14725 5` CGAAGCTTGATATGAAAAACCATCGTTG 3`
408 Päabo, 1990
H15149 5`AAACTGCAGCCCCTCAGAATGATA 3` Kocher et al., 1989
Myh6 Myh6 F459 5' CATMTTYTCCATCTCAGATAATGC 3' 1st PCR
686 Li et al., 2007
Myh6 R1325 5' ATTCTCACCACCATCCAGTTGAA 3' 1st PCR
Li et al., 2007
Myh6 F507 5' GGAGAATCARTCKGTGCTCATCA 3' 2nd PCR
Li et al., 2007
Myh6 R1322 5' CTCACCACCATCCAGTTGAACAT 3' 2nd PCR
Li et al., 2007
Glyt Glyt F559 5' GGACTGTCMAAGATGACCACMT 3' 1st PCR
666 Li et al., 2007
Glyt R1562 5' CCCAAGAGGTTCTTGTTRAAGAT 3' 1st PCR
Li et al., 2007
Glyt F577 5' ACATGGTACCAGTATGGCTTTGT 3' 2nd PCR
Li et al., 2007
Glyt R1464 5' GTAAGGCATATASGTGTTCTCTCC 3` 2nd PCR
Li et al., 2007
Ivanova, N., Zemlack, T. Z., Hanner, R. H., Herbert P. 2007 Universal primer cocktails for fish
DNA barcoding. Molecular Ecology Notes, 7.
Kocher T.D., Thomas W.K., Meyer A., Edwards, S.V., Pääbo, S., Villablanca, F. X. & Wilson,
82
A.C. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and
sequencing with conserved primers. Proceedings of the National Academy of Sciences
of the United States of America, 86, 6196–6200.
Li, C., Ortí, G., Zhang, G., Lu, G. 2007. A practical approach to phylogenomics : the phylogeny
of ray-finned fish ( Actinopterygii ) as a case study. BMC Evolutionary Biology, 7.
Pääbo, S. 1990. Amplifying ancient DNA. In: PCR protocols: A guide to methods and
applications (ed Innes, M. A., Gelfand, D. H., Sninsky, J. J., White TJ), pp. 159–166.
Academic Press, San Diego, CA.
Palumbi, S.R. 1996. Nucleic acids II: the polymerase chain reaction. In: Molecular Systematics
(eds Hillis DM, Moritz C, Mable BK), pp. 205 – 247. Sinauer & Associates Inc.,
Sunderland, Massachusetts.
83
Fig S1. Upper pane: Map of northern South America with sampling points. Dots and colors
represent sampling sites. Lower pane: parsimony networks of Crenuchus spilurus sampled in
this study. The networks are based on haplotypes of two nuclear markers, Myh6 (left) and Glyt
(right). Circle sizes are proportional to the number of individuals sampled for each haplotype
and the number of mutational steps is indicated with dashes along branches. When no dashes
are shown, haplotypes are separated by a single mutational step. Colors represent sampling
sites and correspond to those shown in the map. Black filled circle represents inferred missing
haplotype.
U1
U2
M1
M2
L1
CJ2
L3
G1
G2
L4
L5-8
L2
PA
D1
D2
D3
D4
N1N2N3
N4N5N6-7
L9
CJ1
PA
M2
M2M1
CJ1CJ2L2
L1L3
L3
L3G1G2
U2L5U1
L4L9
L9
L5L7
L6
L8
L5
D4D1D2
D3
D3N7
N2
N3
N4 N4N1
N1N1
N3N5N6N4
L3
L3
L2L1 CJ1
CJ1
CJ2
U2U1
G1G2
D4
N1
N7N6N5N4N3
N2D1
D2D3
L9PA
L4L5L6L7
L8
M1M2
L3
101
Samples
Myh6
GlytCJ1CJ2D1D2D3D4G1G2L1L2L3L4L5L6L7
L8L9M1M2N1N2N3N4N5N6N7PAU1U2
84
Considerações finais
Esta tese analisou o papel de características ambientais sobre a ecologia,
comportamento e evolução de Crenuchus spilurus. O primeiro capítulo buscou descrever a
ecologia da espécie, tendo como pano de fundo a sua excepcional abrangência geográfica.
Foi salientado que a maior parte das características da espécie indica baixo potencial para
dispersão ativa, de forma que a enorme distribuição parece ser melhor explicada por uma
combinação de dispersão passiva (associada à dinâmica do ambiente durante longos
períodos de tempo), juntamente com um baixo potencial de diversificação morfológica, que
pode advir de diversos fatores, como seleção purificadora ou canalização.
A baixa diversificação morfológica entre as população de C. spilurus indicava que a
espécie nominal poderia seria composta por diversas linhagens evolutivas localmente
estruturadas, o que se tornou evidente nas análises genéticas apresentadas no segundo
capítulo desta tese. O padrão de elevada diversidade encontrado aqui era esperado, visto
que ocorre para muitas espécies de pequeno porte que habitam pequenos corpos d’água na
Amazônia. O segundo capítulo não apenas confirmou a existência de um alta diversidade
críptica, mas também identificou outros padrões interessantes. O primeiro padrão, observado
para todos os marcadores moleculares utilizados, foi que existem duas linhagens principais
de C. spilurus, uma habitando a bacia do Rio Negro e outra ocorrendo em todo o restante da
área de distribuição amostrada da espécie. Com base na ampla concordância dos resultados
obtidos para marcadores nucleares e mitocondriais e na velocidade de mudança de cor
(Kalebe S. Pinto, dados não publicados), consideramos que a espécie é composta por duas
linhagens, chamadas de “Rio Negro” e “Amazonas”. Uma vez que diversas características
físico-químicas da água do Rio Negro são distintas dos demais corpos d’água amazônicos, o
padrão ecogeográfico encontrado aqui sugere que diferenças nas condições limnológicas
entre os rios Negro e Amazonas possam ser importantes em mediar a distribuição das duas
linhagens.
85
A baixa capacidade de dispersão ativa de C. spilurus aliada à especialização na
ocupação de habitat de igarapés de terra firme (reportadas no Capítulo 1 desta tese) nos
levaram a sugerir que o principal mecanismo de expansão geográfica das populações esteja
associado à dinâmica fluvial na Bacia Amazônica. Especificamente, prevíamos que eventos
históricos de captura de drenagem tivessem central importância na expansão geográfica da
espécie, enquanto que a possibilidade de dispersão por meio de canais de grandes rios seria
mais improvável. Contudo, o Capítulo 2 mostrou, por meio de evidências de isolamento por
distância, uma assinatura de expansão de abrangência geográfica por meio dos canais
principais dos rios Amazonas e Negro. Esse fato, juntamente com a baixa capacidade de
dispersão ativa da espécie, sugere que uma expansão seguindo o fluxo da água (i.e. rio
abaixo) seja mais a explicação mais provável para a ampla distribuição da espécie.
Surpreendentemente, a assinatura de isolamento por distância abruptamente desaparece
próxima à foz do rio Negro, junto ao rio Amazonas, sugerindo que a linhagem “Rio Negro”
falha em se estabelecer em corpos d’água mais próximos do rio Amazonas. Esse padrão
talvez possa ser explicado por diferentes adaptações locais ao tipo de água em cada uma
das duas linhagens descritas aqui.
Os resultados apresentados no Capítulo 2 mostraram uma baixa aptidão dos
indivíduos da linhagem “Amazonas” quando experimentam condições físico-químicas
similares às encontradas no Rio Negro, nomeadamente baixo pH e condutividade elétrica. Ao
testarmos o isolamento reprodutivo entre as linhagens que habitam diferentes tipos de água,
os resultados sugerem que a especiação ecológica é principalmente mediada pelo tipo de
água. Nosso experimento, porém, considerou um cenário menos provável de movimento de
indivíduos contra a corrente do rio, simulando a possibilidade de que indivíduos da linhagem
“Amazonas” viessem a encontrar indivíduos da linhagem “Rio Negro” em águas similares às
do Rio Negro ― o que implicaria em uma ocupação de ambientes localizados a montante da
confluência com o rio Amazonas. Dessa forma, o processo que gerou o padrão reportado no
86
Capítulo 2, ou seja, ausência de haplótipos da linhagem “Rio Negro” ao longo do Rio
Amazonas permanece incerto.
A melhor explicação para ausência de haplótipos da linhagem “Rio Negro” ao longo
do Rio Amazonas é indivíduos da linhagem “Rio Negro” são incapazes de se estabelecer no
Rio Amazonas por efeito direto do tipo de água na aptidão. Essa hipótese está sendo
formalmente testada em um experimento em andamento. Casais formados por machos e
fêmeas da linhagem “Rio Negro” expostos à água proveniente do rio Amazonas parecem não
ter a reprodução afetada negativamente (dados não publicados da dissertação de mestrado
em andamento de Gabriel S. Silva). Dessa forma, o efeito direto da condição limnológica na
aptidão das linhagens parece ser assimétrico e a ausência de indivíduos da linhagem “Rio
Negro” no rio Amazonas demanda explicações outras que não o efeito direto das condições
limnológicas típicas de águas brancas sobre a aptidão. Diferenças no efeito local da predação
ou de competição (direta ou indireta) entre as linhagens são alternativas possíveis. Embora
possível de conceber, o papel da seleção sexual por meio de preferência da fêmea parece
ser menos claro, pois já há evidência de fraca rejeição das fêmeas por machos de linhagens
distintas. As linhagens diferem quanto ao padrão de colorido dos ornamentos, contudo
fêmeas da linhagem “Rio Negro” apenas discriminam claramente contra machos da linhagem
“Amazonas” quando os ornamentos são bastante conspícuos, o que é visto apenas em
indivíduos grandes (dados não publicados da dissertação de mestrado de E. Borghezan).
Essa observação parece estar alinhada com previsões teóricas de que o acasalamento
preferencial deve evoluir apenas quando populações possuem diferenças profundas, o que
não parece ser o caso da morfologia externa das linhagens de C. spilurus, que diferem em
características pontuais e pouco conspícuas dos ornamentos.
87
PERSPECTIVAS FUTURAS
As variações encontradas nos marcadores mitocondriais utilizados no Capítulo 2
sugerem que estes tenham se modificado tanto em resposta à seleção (pelos tipos de água)
quanto em decorrência de processos neutros (isolamento por distância). Vale ressaltar que
esta tese focou apenas no sinal de seleção passado, deixando em aberto os estudos de
biogeografia histórica. Contudo, um estudo dessa natureza se beneficiaria grandemente de
uma maior abrangência geográfica das amostragens. Em especial, a amostragem e
sequenciamento de indivíduos provindos de rios que drenam regiões entre o Rio Negro e o
Amazonas, como o Japurá e Putumayo, parecem ser de especial relevância. É possível que
o processo de dispersão populacional tenha ocorrido por essa rota se a linhagem “Rio Negro”
for mais antiga (o que é sugerido pelo maior grau de diferenciação genética) e ela tenha sido
dispersa por cones aluviais às margens do Escudo das Guianas. Os cones aluviais decorrem
do movimento lateral que rios fazem ao fluir de uma região mais elevada para uma de menor
elevação. Além disso, amostras de indivíduos provenientes de riachos da região do sopé dos
Andes também poderiam esclarecer se a formação de condições ambientais lênticas em larga
escala espacial no passado geológico pode ter contribuído para a dispersão da espécie.
Chamado de Lago Pebas, essas condições lênticas em grande escala geográfica parecem
ter perdurado por um longo tempo em decorrência do soerguimento da região norte andina,
que teria impedido que os rios desaguassem na região norte da América do Sul. Tais rios
teriam sido levados a correr na direção oeste-leste, também bloqueada por uma região de
maior elevação conhecida como Arco do Purus.
Existem poucas dúvidas de que o isolamento reprodutivo entre linhagens de C.
spilurus pode ser mediado por condições limnológicas das águas amazônicas. Contudo,
ainda existe a possibilidade de evolução do isolamento reprodutivo entre populações nos
extremos das distribuições de cada linhagem. Isso poderia mostrar que parte da variação do
isolamento reprodutivo possa ser explicada por processos neutros. Também aberto a futuras
investigações está a interessante perspectiva de que as linhagens de C. spilurus registradas
88
nos rios Jari e Coari apresentem isolamento reprodutivo reduzido em relação aos indivíduos
da linhagem “Rio Negro”, apesar de geneticamente distantes, o que seria melhor explicado
por habitarem tipos de águas semelhantes. Isso seria contrastado com o grau de isolamento
reprodutivo dessas populações (Jari e Coari) com seus grupos evolutivamente mais
próximos, mas que habitam diferentes tipos de águas.
Embora o papel da seleção sexual pareça não ser prevalente a partir das evidências
encontradas até agora, é possível conceber que deriva sensorial (sensory drive) tenha
desempenhado um papel importante ao influenciar a preferência da fêmea ou o combate
entre machos. Isso porque a coloração da água (i.e. o ambiente subaquático) de igarapés de
águas pretas é avermelhada ou em tons âmbar, o que pode deixar partes dos ornamentos
mais ou menos conspícuas quando comparadas a ambientes de águas claras (cristalinas) ou
mais ricos em sedimentos em suspensão. Essas diferenças nos ambientes podem permitir,
impedir ou aprimorar a qualidade de sinais emitidos durante interações sociais. Ainda, o grupo
irmão de Crenuchus, o gênero Poecilocharax, possui forte dimorfismo sexual e padrões de
coloridos das nadadeiras bastante distintos. Notoriamente, a espécie Poecilocharax
weitzmanii possui uma faixa lateral azul composta por iridióforos. A evolução dessa coloração
conspícua pode ter sido promovida por preferência da fêmea, possivelmente latente na
linhagem ancestral que deve ser representada pela linhagem “Rio Negro” de C. spilurus. O
arrazoado para acreditar que Poecilocharax é uma linhagem derivada de C. spilurus se dá
por evidência de repetidos eventos de miniaturização na família Crenuchidae, e
Poecilocharax pode ter surgido por miniaturização de linhagem de Crenuchus.
Embora diversas características de C. spilurus favoreçam seu uso como modelo de
estudo, várias espécies amazônicas possuem características ecológicas similares.
Aparentemente o grupo em que existe maior número de casos notórios de evolução neutra é
aquele composto pelas muitas espécies de pequeno porte da família Characidae
petrencentes aos gêneros Astyanax, Moenkhausia, Hemigrammus e Hyphessobrycon. Esse
conjunto de espécies popularmente chamadas de piabas ou lambaris é muito diverso e muitas
89
variações morfológicas entre espécies frequentemente parecem ser contínuas ou clinais,
sugerindo que os caracteres diagnósticos possam não são limitados por seleção e quem
variam por deriva. Esse grupo de espécies ocorre em tipos de ambientes mais diversos do
que os ocupados por C. spilurus, ocorrendo em virtualmente todos os principais tipos de
ambientes aquáticos amazônicos. Estudar a intensidade do isolamento reprodutivo nesse
grupo de espécies poderia ser iluminador para avaliar a importância relativa de seleção e
deriva genética na evolução do isolamento reprodutivo em peixes amazônicos. Entretanto,
esse tipo de estudo pode ser proibitivo, especialmente em face da falta de informação sobre
as relações filogenéticas entre as espécies de pequenos caracídeos.
top related