felipe de moura messias - bibliotecatede.uninove.br de... · a parede abdominal anterior foi...

1

UNIVERSIDADE NOVE DE JULHO

PROGRAMA DE PÓS GRADUAÇÃO EM CIÊNCIAS DA REABILITAÇÃO

AÇÃO DA TERAPIA LASER DE BAIXA POTÊNCIA NOS EFEITOS

DELETÉRIOS DA ISQUEMIA EM RINS DESTINADOS A TRANSPLANTE:

UM ESTUDO PRÉ-CLÍNICO.

FELIPE DE MOURA MESSIAS

São Paulo, SP

2012

2

FELIPE DE MOURA MESSIAS

AÇÃO DA TERAPIA LASER DE BAIXA POTÊNCIA NOS EFEITOS

DELETÉRIOS DA ISQUEMIA EM RINS DESTINADOS A TRANSPLANTE:

UM ESTUDO PRÉ-CLÍNICO.

Dissertação apresentada à

Universidade Nove de Julho, para

obtenção do título de Mestre em

Ciências da Reabilitação.

Orientador: Prof. Dr. Rodrigo Álvaro

Brandão Lopes Martins

São Paulo, SP

2012

3

FICHA CATALOGRÁFICA

Messias Felipe de Moura. Ação da terapia laser de baixa potência nos efeitos deletérios da isquemia em rins destinados a transplantes: um estudo pré clínico. / Felipe de Moura Messias. 2012. 93 f. Dissertação (mestrado) – Universidade Nove de Julho - UNINOVE, São Paulo, 2012. Orientador (a): Prof. Dr. Rodrigo Álvaro Brandão Lopes Martins.

1. Laserterapia. 2. Transplante renal. 3. Isquemia-reperfusão. I. Martins, Rodrigo Álvaro Brandão Lopes. II. Titulo

CDU 615.8

5

DEDICATÓRIA

Dedico este trabalho à meus pais Sueli e José por todo apoio e incentivo

sempre. Também à minha noiva Alessandra pelo carinho, compreensão e

ajuda nos momentos difíceis.

6

AGRADECIMENTOS

Agradeço primeiramente a Deus que me dá forças e me conduz no caminho

que ele mesmo trilhou pra mim.

Agradeço à meus pais Sueli e José pelo apoio, ajuda e palavras de conforto

nos momentos de cansaço, e palavras de incentivo que sempre valeram à

pena!

Agradeço à minha noiva Alessandra, minha companheira e melhor amiga, sem

o seu apoio nada seria possível.

Agradeço todo o corpo docente do Programa de Mestrado em Ciências da

Reabilitação por me auxiliar na construção do saber.

Agradeço à toda diretoria de Saúde da Uninove, principalmente a prof. Cinthya

Duran que foi a intermediadora e grande incentivadora para a realização deste

Mestrado.

Agradeço à todos os técnicos de laboratório da unidade Vergueiro que me

ajudaram e compreenderam meus momentos de ausência.

Agradeço aos amigos Patricia, Rodney, Tabata, Prof. Rodrigo Labat e Prof.

Ernesto que foram mais que amigos durante todo o trabalho.

Agradeço em especial ao meu orientador Prof. Dr. Rodrigo, que foi mais que

orientador e sim um grande amigo não somente durante o processo do

mestrado, mas para toda vida. Muito obrigado por todo esforço, dedicação e

compreensão.

Agradeço à Universidade Nove de Julho que me acolheu desde a graduação e

tem participação ativa na minha formação de vida.

7

RESUMO

Introdução. A lesão renal aguda (LRA) está associada a um grau elevado de

morbidez e mortalidade. A Isquemia e reperfusão (IR) é uma das principais

causas de LRA. Atualmente, especialmente a citocina inflamatória TNF-α,

parece estar envolvida na lesão e não há agentes farmacológicos que

comprovadamente possam prevenir a LRA após IR. Na última década, foi

demonstrado que a Terapia Laser de Baixa Potência (LLLT) é capaz de inibir

os marcadores inflamatórios incluindo citocinas (TNF-α e IL-1). Objetivos. Nós

investigamos o efeito da LLLT em citocinas inflamatórias em rim de rato após

isquemia prolongada. Métodos. Após a aprovação do Comitê de Ética para

Uso de Animais, ratos Wistar foram anestesiados com cetamina mais xilazina.

A parede abdominal anterior foi incisionada na linha mediana. Ambos os rins

foram retirados e colocados imediatamente em solução nutritiva gelada.

Grupos tratados receberam a terapia a laser com 1,3,6 e 10 Joules de energia

em momentos diferentes. Depois de 2, 12 e 24 horas os rins foram fixados para

análise histológica e bioquímica. No grupo tratado a laser, uma dose de energia

de 3 Joules foi entregue em dois pontos centralmente e, bilateralmente, 5 min

após a reperfusão. Resultados. A análise bioquímica não revelou alterações

significativas para as citocinas inflamatórias após a laserterapia. A avaliação

morfológica demonstrou uma melhor organização tecidual nos grupos tratados

com laser. Conclusões. Os resultados demonstraram que LLLT foi capaz de

preservar o tecido renal de isquemia induzida por lesão.

Palavras-chave: Terapia Laser de Baixa Potência; Transplante Renal;

Isquemia-reperfusão.

8

ABSTRACT

Introduction. Acute Kidney injury (AKI) is associated with a high degree of

morbidity and mortality. Ischaemia-reperfusion injury (IRI) is one of the major

causes of AKI. Currently, inflammatory cytokines specially TNF-α, seems to be

involved in the injury and no pharmacological agents have proven to prevent

AKI after IRI. In the last decade we demonstrated that LLLT is able to inhibit

inflammatory markers including cytokines (TNF-α and IL-1 for example). Aims.

Here we investigate the effect of LLLT on inflammatory cytokines in Rat kidney

after prolonged ischemia. Methods. After approval of the Ethical Committee for

Animal Use, Male Wistar rats were taken to the experiment table and

anaesthetized with ketamine plus xilazyne. The anterior abdominal wall was

incised on the median line. Both kidneys were excised and immediately placed

in cold nutritive solution. Treated groups received laser therapy with 1,3,6 and

10 Joules of energy in different times. After 2, 12 and 24 hours the kidneys were

fixed for histological and biochemical analysis. In the laser treated group, an

energy dose of 3 Joules was delivered in two points centrally and bilaterally, 5

min after reperfusion. Results. Biochemical analysis revealed no significant

alterations for inflammatory cytokines after LLLT. Morphological evaluation

demonstrated a better cell organization in the laser-treated groups.

Conclusion. Our results demonstrated that LLLT was able to preserve the

renal tissue from ischemia-induced lesions.

Keywords: Low Level Laser Therapy, Kidney Transplant, Ischaemia-reperfusion

9

ÍNDICE

1. Contextualização 14

1.1. Transplantes Renais 15

1.2. Terapia Laser de Baixa Potência 19

2. Objetivos 21

2.1. Objetivo Geral 21

2.2. Objetivo Específico 21

3. Método 22

3.1. Aspectos Éticos 22

3.2. Modelo Experimental 22

3.3. Processamento Histológico 23

4. Resultados / Artigo 25

4.1. Resumo 27

4.2. Abstract 28

4.3. Introdução 29

4.4. Material e Métodos 32

4.4.1.Dosagem de Citocinas Inflamatórias 33

4.4.2. Processamento Histológico 33

4.5. Resultados 35

4.5.1. Análise Histopatológica 35

4.5.2. Dosagem de Citocinas Inflamatórias 45

4.6. Discussão 50

4.7. Conclusões 53

4.8. Referências Bibliográficas 54

5. Considerações Finais 59

6. Referências Bibliográficas 7. Apêndices

60

65

10

LISTA DE TABELAS E QUADROS

TABELA 01. Número de Transplantes de órgãos Sólidos durante o 3° trimestre

de 2012.

TABELA 02. Dados do censo de diálise de 2011

QUADRO 01. Resumo das principais características histopatológicas – Grupo 2

Horas

QUADRO 02. Resumo das principais características histopatológicas – Grupo

12 Horas

QUADRO 03. Resumo das principais características histopatológicas – Grupo

24 Horas

11

LISTA DE FIGURAS

Figura 01. Cortes histológicos de rim mostrando as regiões cortical (A-D) e

medular (E-F) coradas pelos métodos do HE (A, C, E) e do picrossírius (B, D,

F), Observar em A-B, um corpúsculo renal em condições de normalidade sem

espessamento de suas membranas (seta) no glomérulo renal (Grupo - 01

Joule). Observar em C-D um corpúsculo renal com glomerulopatia

membranosa leve, evidenciado pelo espessamento das membranas (seta) do

glomérulo (Grupo - Controle). Observar em E-F os túbulos coletores em

condições de normalidade, assim como o tecido intersticial (seta).

Figura 2. Cortes histológicos de rim mostrando a região medular corados pelo

método do HE com diferentes características de necrose tubular aguda.

Observar em A uma congestão vascular (seta) (Grupo - Controle). Em B é

mostrado cortes transversais de túbulos contorcidos proximais e distais com

material granuloso e vacuolização no citosol de células em processo de

degeneração (seta) (Grupo - Controle). Em C é mostrado túbulos com material

hialino descamado no lúmen (seta) (Grupo - 03 Joules). Em D é mostrado

algumas alça de Henle preenchido com material hialino e células degeneradas

(seta) (Grupo - Controle).

Figura 3. Cortes histológicos de rim corados pelo método do HE, onde A –

Controle; B – 01 Joule; C – 03 Joules; D – 06 Joules, E – 10 Joules, referentes

ao protocolo de 2 horas.







12

Figura 06 - Dosagem de interleucina – 1 (IL-1) nos tempos de 2 (Painel A), 12

(Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de 06

rins. * p < 0,05



rins. * p < 0,05

Figura 08 - Dosagem de interleucina – 10 (IL-10) nos tempos de 2 (Painel A),

12 (Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de

06 rins. * p < 0,05

Figura 09 - Dosagem de TNF-alfa nos tempos de 2 (Painel A), 12 (Painel B) e

24 horas (Painel C). Os valores representam a média + EPM de 06 rins. * p <

0,05

13

LISTA DE ABREVIATURAS

ABTO – Associação Brasileira de Transplantes de Órgãos

AH – Alça de Henle

ATN – Necrose Tubular Aguda

ATP – Trifosfato de adenosina

cm2 – centímetro quadrado

CN – Condições de Normalidade

COX 2 – Ciclooxigenase 2

CP – Corpúsculo Renal

DC – Dutos coletores

DRC – Doença Renal Crônica

HE – Hematoxilina Eosina

IL 1 – Interleucina 1



IRA – Insuficiência Renal Aguda

IRI – Isquemia Reperfusão Renal

J – Joule

LIR – Lesão de Isquemia e Reperfusão

LLLT – Laser de Baixa Intensidade

LRA – Lesão Renal Aguda

MMPs – Matriz Metalloproteinases

mW – milliwatts

Nm – Nanômetros

14

RBT – Rede Brasileira de Transplantes

TCP – Túbulo Contorcido Proximal

TNF-α – Fator de Necrose Tumoral

UTI – Unidade de Terapia Intensiva

14

1. CONTEXTUALIZAÇÃO

Os rins são órgãos fundamentais para a manutenção da homeostase do

corpo humano. A diminuição progressiva da função renal acarreta o

comprometimento de essencialmente todos os outros órgãos do corpo humano.

A função renal é avaliada pela filtração glomerular (FG) e a sua diminuição é

observada na Doença Renal Crônica (DRC), associada à perda das funções

regulatórias, excretórias e endócrinas do rim. Quando a FG atinge valores

muito baixos, inferiores a 15 mL/min/1,73m2, estabelece-se o que

denominamos falência funcional renal (FFR), ou seja, o estágio mais avançado

do continuum de perda funcional progressiva observado na DRC. A DRC é,

atualmente, considerada um problema de saúde pública mundial. No Brasil, a

incidência e a prevalência de FFR estão aumentando, o prognóstico ainda é

ruim e os custos do tratamento da doença são altíssimos. O número projetado

atualmente para pacientes em tratamento dialítico e com transplante renal no

Brasil está próximo dos 120.000, a um custo de 1,4 bilhão de reais.

Independentemente da doença de base, os principais desfechos em pacientes

com DRC são as suas complicações (anemia, acidose metabólica, alteração do

metabolismo mineral e desnutrição), decorrentes da perda funcional renal, óbito

(principalmente por causas cardiovasculares) e FFR1.

A Lesão Renal Aguda (LRA) se caracteriza por uma redução abrupta da

função renal definida por aumento absoluto da creatinina sérica de pelo menos

0,3mg/dL, elevação de 50% (até 1,5 vez) do valor basal ou redução do fluxo

urinário, documentado como oligúria ou menor de 0,5mL/kg por hora por mais

de seis horas2.

A Insuficiência Renal Aguda (IRA) é caracterizada por uma redução

abrupta da função renal, que se mantém por períodos variáveis, resultando na

inabilidade dos rins em exercer suas funções básicas de excreção e

manutenção da homeostase hidroeletrolítica do organismo. A IRA se apresenta

em diversas formas clínicas, entre elas a IRA isquêmica e a nefrotóxica. Dentre

as etiologias de IRA renal, 62% são decorrentes de necrose tubular aguda

conseqüentes a causas isquêmicas (72%) e tóxicas (28%). No Brasil, em

estudo de Burdmann e cols. (1993), observou-se que as causas de IRA eram

15

predominantemente: sepse (33%), hipovolemia (33%), insuficiência cardíaca

descompensada (32%), nefrotoxicidade de drogas (27%), traumatismo cirúrgico

(13%) e hipotensão (20%), com grande ocorrência de associação de dois ou

mais desses fatores, e, de forma geral, a maior parte incorrendo em

hipoperfusão renal3.

O mecanismo de isquemia-reperfusão é a etiologia mais comumente

relacionada à lesão renal. Na isquemia, um dos eventos mais precoces é a

redução dos níveis intracelulares de ATP, que compromete preferencialmente

porções do néfron que possuem alta taxa de reabsorção tubular com gasto de

energia, como o túbulo proximal e a alça ascendente espessa de Henle. A

depleção de ATP desencadeia uma série de eventos, incluindo desestruturação

do citoesqueleto, perda da polaridade celular e interação célula-célula,

produção de espécies reativas de oxigênio, alterações do pH intracelular,

podendo culminar com morte celular2.

1.1 – Transplantes Renais

No ano de 2010, a Associação Brasileira de Transplantes de Órgãos

(ABTO) iniciou um novo desafio, o de conhecer os resultados dos transplantes

realizados no País, no que se refere às taxas de sobrevidas dos pacientes e

dos enxertos. Foram realizados 6.402 transplantes de órgãos (coração, fígado,

intestino, pâncreas, pulmão e rim) no país, entre estes 4.630 transplantes

renais (próximos da meta de 4.800), aumento de 8% em relação a 2009, sendo

64,6% com doador falecido, a maior taxa já obtida. Houve aumento de 17,2%

na taxa de transplante com doador falecido e queda de 5,7% com doador vivo.

Apesar das restrições aos transplantes com doador vivo não parente, não

cônjuge, a taxa aumentou levemente de 6,3% para 6,6%. A notícia positiva é a

grande remoção de rins de doadores limítrofes (superior a 150), em estados

que não realizam esses transplantes, e a sua disponibilização para alocação

para a Central Nacional, em outros estados, mas ainda inferior ao número

estimado de 600 rins por ano, pois apenas 10% dos doadores tinham idade

superior a 60 anos. São Paulo com 49,6 transplantes renais pmp aproxima-se

da necessidade estimada para o país (70 ppm), seguido a distância por Santa

Catarina (36,9 ppm) e RS (36,6 ppm). Outro dado que se repete é a elevada

16

taxa de transplantes com doador vivo no Paraná (17,9 ppm) e em São Paulo

(21,1 ppm), entre as possíveis explicações estão a realização desses

transplantes em pacientes de outras regiões e um maior esforço na busca

desse tipo de doador pelas equipes desses estados4.

Dados de 2012 revelam que houve um crescimento de 9,4% na taxa de

transplantes renais (28,5 ppm) e de 10,5% na taxa de transplantes hepáticos e

uma queda de 13,1% na de transplante de pâncreas. Deve-se comemorar o

aumento expressivo da taxa de transplantes cardíacos (39%) e pulmonares

(34%), ressaltando, entretanto, que esses números estão muito abaixo do

esperado em relação a taxa de doadores do país e a necessidade estimada de

transplantes. Um aspecto que deve ser mais bem avaliado é o número de

pacientes em lista de espera para transplante de órgãos5.

A diminuição dos pacientes em lista para o transplante de rim, atualmente

de 20.005, não deve ser creditada ao aumento dos transplantes (ainda

insuficiente), mas a talvez um pequeno ingresso em lista (no RS há grande

dificuldade dos pacientes do SUS marcarem consulta de investigação para

ingresso em lista de espera por problemas burocráticos) e por inativação por

vários motivos dos pacientes em lista de espera (soro vencido, recusas de

transplante, etc). O número esperado em lista de espera para o transplante

renal seria em torno de 30.000 a 35.0000. Há também uma diminuição no

número de pacientes em lista de espera para transplante hepático (1.351) e um

persistentemente pequeno número de pacientes em lista de espera para

transplante de coração (192) e de pulmão (152). No transplante renal

destacaram-se RS (50,5 ppm), SP (47,7 ppm) e PR (41 ppm). O RS é o único

estado que realiza mais de 40 transplantes ppm com doador falecido (42,1

ppm), graças ao projeto de receber rins não utilizados em outros estados,

enquanto que PR (15,8 ppm) e SP (14,4 ppm) são ainda os únicos estados que

realizam mais do que 10 transplantes renais com doador vivo ppm. A queda no

número de transplantes com doador vivo persiste, sendo responsável por

apenas 26,7% dos transplantes renais, quando era em torno de 50% há cinco

ou seis anos. A taxa de doador vivo não parente e não cônjuge está caindo

(5,1%)5.

trime

Tabela 1

estre de 20

Tabela 2

1 – Núme

012. (ABTO

– Dados d

ro de Tra

O, 2012)

do censo d

ansplantes

de diálise d

de órgão

de 2011

os Sólidoss durante

17

o 3°

18

O transplante renal é uma abordagem terapêutica aceitável para

pacientes com doença renal terminal. A denominada lesão de isquemia e

reperfusão (LIR) é um problema clínico, que ocorre como uma conseqüência

invariável dos transplantes, especialmente renal4. Existem poucas abordagens

terapêuticas efetivas capazes de minimizar a lesão de isquemia e reperfusão

renal6,7,8. Recentemente, tem se sugerido que o período pós-isquemia, que é

definido como uma rápida interrupção intermitente do fluxo sanguíneo na fase

inicial da reperfusão protege o coração contra as lesões de isquemia e

reperfusão. Esta proteção também foi observada para o rim. Em transplantes

renais, a ocorrência de lesões por isquemia e reperfusão renal pode afetar

consideravelmente as funções do órgão, colocando em risco o sucesso de todo

o processo de transplante9,10. LIR pode ser causada por múltiplos fatores

envolvendo formação de radicais livres de oxigênio, disfunção mitocondrial,

geração de citocinas inflamatórias e infiltração de neutrófilos. Em particular, o

Fator de Necrose Tumoral-α (TNF-α) - citocina central no processo inflamatório

- tem sido estabelecido como um importante mediador de lesão por isquemia e

reperfusão renal10. Dados experimentais em modelos animais de isquemia e

reperfusão renal demonstram intensa reação inflamatória após um período de

isquemia renal de 45 minutos e reperfusão de 2 horas11,12.

O fator de necrose tumoral (TNF-α) é uma citocina pleitrópica

relacionada tanto à sobrevivência e proliferação celular como à morte celular

no processo apoptótico12. O TNF-α tem sido identificado como uma citocina

pró-inflamatória importante sintetizada em hemorragias relacionadas com

lesões de isquemia-reperfusão13,14,15,16. É bem conhecido que o TNF-α é

expresso após hemorragia17,18,19, desempenha um importante papel na

inflamação auto-destrutiva excessiva e, finalmente, é capaz de induzir a

falência múltipla de órgãos através da ativação maciça de neutrófilos15,16. Além

disso, o TNF-α é conhecido por desencadear a liberação de outras citocinas

pró-inflamatórias, como a interleucina (IL)-1b e IL-620,21.

19

1.2- Terapia Laser de Baixa Potência

A terapia com laser de baixa potência (LBP), incide sobre as reações

atérmicas da luz com o tecido, ocasionando efeitos fotoquímicos22, ou seja,

radiações com baixa densidade de potência (DP) 0,01 w/cm2 à 1 w/cm2 e

também baixa densidade de energia (DE), de 1 à 10J/cm2 23. O Laser de baixa

potência parece agir sobre organelas celulares (mitocôndrias e membranas),

gerando aumento da síntese de ATP e modificando o transporte iônico. Dessa

forma o laser, em curto prazo, acelera a glicólise e a oxidação fosforilativa e em

longo prazo a transcrição e a replicação do DNA24.

O uso de lasers na prática clínica objetivando o efeito antiinflamatório em

diferentes doenças baseia-se em um número já razoável de publicações de

caráter científico. Nos últimos anos, inúmeros estudos clínicos aleatorizados,

placebo-controle foram realizados, fazendo com que a terapia laser já seja

considerada como alternativa terapêutica para várias doenças25,26.

Os mecanismos de ação ainda não foram totalmente determinados,

porém existem evidências que o laser pode reduzir a expressão gênica de

alguns mediadores inflamatórios como COX-2, PGE2, ILs, TNF-α e aumentar a

expressão de outros mediadores antiinflamatórios como IL-10. O laser pode

ainda reduzir a expressão de determinadas colagenases (MMPs) e

conseqüentemente reduzir a degeneração do tecido, favorecendo a

proliferação celular.25,26.

Laser de baixa intensidade (LLLT) tem sido utilizado clinicamente desde

1981 no tratamento de pacientes com doenças inflamatórias. As vantagens

terapêuticas do LLLT para doenças inflamatórias tem sido sugeridas por vários

autores e é apontado como uma alternativa para reduzir a dor.

Interessantemente, diversos trabalhos de nosso grupo demonstram a

capacidade desta terapia em inibir os principais mediadores inflamatórios

envolvidos na LIR renal, a saber, TNF-alfa e COX-2 e aumentar a expressão de

outros mediadores antiinflamatórios como IL 27,28,26,29,30,31. O laser pode ainda

reduzir a expressão de determinadas colagenases (MMPs) e


20

proliferação celular. No entanto, é muito importante ressaltar que muito pouco

se conhece a respeito do mecanismo de ação do laser infravermelho em

órgãos internos e nobres como o Rim, especialmente em condições de

isquemia e transplante32,33,34,35,25,36,37,38.

Tendo em vista a experiência prévia do grupo de pesquisa, no estudo

dos mecanismos de ação do Laser de baixa potência em diferentes doenças ou

situações inflamatórias, visamos investigar os efeitos da laserterapia na lesão

por isquemia e reperfusão em rins destinados ao transplante.

21

2- OBJETIVOS

2.1 – Objetivo Geral

Investigar os efeitos do Laser de Baixa Potência em rins destinados a

transplantes.

2.2 – Objetivo Específico

Investigar os efeitos do Laser de Baixa Potência sobre aspectos

histomorfológicos, bioquímicos e moleculares renais na vigência do processo

inflamatório induzido por isquemia prolongada “in vitro” em rins destinados a

transplantes.

22

3 – MÉTODO

3.1 – Aspectos Éticos

Foram utilizados 45 ratos Wistar machos pesando entre 150 e 200g (+/-

60 dias de vida), com livre acesso a água e ração, provenientes do Biotério da

Universidade Nove de Julho. Os animais foram mantidos em ambiente com

temperatura controlada e ciclo claro/escuro de 12 horas. O presente protocolo

experimental foi submetido e aprovado pelo Comitê de Ética em

Experimentação Animal da Universidade Nove de Julho (AN 0018/2011).

3.2 – Modelo Experimental

Os animais foram anestesiados com uma mistura de ketamina 10% (0,2

ml/100 gramas do animal) e de xylazina 2% (0,1 ml/100 gramas do animal), e

submetidos à cirurgia bilateral para extração dos rins. Os rins extraídos foram

imediatamente acondicionados em solução comercial para manutenção de

órgãos destinados a transplante, conforme especificações da Rede Brasileira

de Transplantes (RBT). Após a cirurgia os animais foram sacrificados por

administração de superdose de anestésico. Este procedimento não produz

qualquer sofrimento ao animal de experimentação.

Após a cirurgia de extração renal, os órgãos mantidos em solução

específica para manutenção de órgãos para transplante foram irradiados com

Laser de baixa potência (810 nm e 100 mW de potência; 0,028 cm2 de área de

feixe; Thera Lase, DMC®) em diferentes tempos (2, 12 e 24 horas) durante 10,

30, 60 e 100s caracterizando as doses de energia/ponto de 1, 3, 6 e 10 Joules.

As irradiações foram realizadas em 2 pontos de cada hemisfério renal,

iniciando-se em diferentes momentos (vide protocolos a seguir).

Protocolo 01 – 2 Horas

Neste protocolo, foi realizada a irradiação durante o ato cirúrgico, e após

01 hora de imersão em líquido de transplante. Após 2 horas os rins foram

fixados ou congelados em nitrogênio líquido para posteriores análises. Foram

23

utilizados 06 órgãos para cada dose de energia (Grupos controle, 1,3, 6 e 10

Joules). Número total de Rins = 30; Número Total de Animais = 15;


Neste protocolo foram realizadas as irradiações durante o ato cirúrgico, e

após 01, 03, 05, 07 e 09 horas de imersão em líquido de transplante. Após 12

horas os rins foram fixados ou congelados em nitrogênio líquido para

posteriores análises. Foram utilizados 06 órgãos para cada dose de energia

(Grupos controle, 1,3, 6 e 10 Joules). Número total de Rins = 30; Número Total

de Animais = 15;


Neste protocolo foram realizadas as irradiações durante o ato cirúrgico, e

após 01, 03, 05, 07, 09, 12 e 20 horas de imersão em líquido de transplante.

Após 12 horas os rins foram fixados ou congelados em nitrogênio líquido para



de Animais = 15;

3.3 – Processamento Histológico

Os espécimes (rins) foram delimitados em metade ventral e dorsal,

inseridos em cassetes plásticos devidamente identificados, lavados por uma

hora em água corrente e submetidos à desidratação. A desidratação foi

realizada em soluções de concentrações crescentes de álcool anidro (Synth,

SP, Brasil), na sequência em álcool 70, 80, 90, 95, 100 (1), 100 (2) e 100 (3),

durante 1 hora em cada passagem. O processo de diafanização ou

clareamento foi realizado em álcool/xilol (1:1), xilol (1, Synth, SP, Brasil), xilol

(2) e xilol (3) durante 1 hora em cada passagem. A impregnação foi realizada

com parafina de baixa temperatura de fusão (56-58C) em estufa com controle

de temperatura microprocessada (Fanem, SP, Brasil) a 56,5C, em três

imersões (parafina 1, parafina 2 e parafina 3) com duração de 1 hora em cada

passagem. Os espécimes foram incluídos em formas de plástico apropriadas,

sob lupa estereoscópica e emblocados em suporte de madeira devidamente

24

identificados, sendo que superfície seccionada de cada rim ficou posicionada

para a face de corte em micrótomo.

Cortes histológicos de cinco micrômetros de espessura foram realizados

em micrótomo rotativo (RM2125 RT, Leica Instruments, USA) acoplado com

navalha descartável. Para a coleta dos cortes histológicos, inicialmente foi

realizada a trimagem do bloco de parafina com o espécime em micrótomo até

que toda a superfície do órgão fosse seccionada; a partir deste ponto foram

selecionados três cortes histológicos em sequência (um para coloração HE,

outro para coloração picrossirius e outro reserva), os quais foram transferidos

para o banho histológico (Easybath, Easypath, SP, Brasil). Estes cortes

histológicos foram coletados em lâminas de vidro revestidas com poli-lisina

(Sigma, USA).

Para a coleta das imagens digitais foi utilizado um microscópio de luz

(DM500, Leica, CA, USA) com objetiva de 4x, acoplado com uma câmera

digital (Sony, CA, USA) com programa para captura de imagens (Qwin, Leica,

USA). As imagens digitais foram gravadas em formato TIFF.

4 – RES

SULTADOS / ARTTIGO

25

26

Ação da Terapia Laser de Baixa Potência nos efeitos deletérios

da isquemia em rins destinados a transplante: um estudo pré-

clínico. Submetido à Physical Therapy in Movement n.° 0004529 em

13/11/2012

Felipe de Moura Messias BSc.1, Patrícia Almeida Silva P.Ed.1, Rodney Capp

Pallota, M.Sc.2, Rodrigo Labat Marcos, PhD.1, Rodrigo Álvaro Brandão Lopes

Martins, PhD1,2

1 – Programa de Pós-graduação em Ciências da Reabilitação, Universidade Nove de Julho – UNINOVE

2 – Departamento de Farmacologia – Instituto de Ciências Biomédicas – Universidade de São Paulo

Short Title – LLLT in Kidney Ischemia

Autor para Correspondência

Felipe de Moura Messias

Rua Vergueiro – 249 – Liberdade

São Paulo – SP

[email protected]

Suporte Financeiro: FAPESP – 2011/18330‐1

27

4.1 - RESUMO

Introdução. A lesão renal aguda (LRA) está associada a um grau elevado de

morbidez e mortalidade. A Isquemia e reperfusão (IR) é uma das principais

causas de LRA. Atualmente, especialmente a citocina inflamatória TNF-α,

parece estar envolvida na lesão e não há agentes farmacológicos que

comprovadamente possam prevenir a LRA após IR. Na última década, foi

demonstrado que a Terapia Laser de Baixa Potência (LLLT) é capaz de inibir

os marcadores inflamatórios incluindo citocinas (TNF-α e IL-1). Objetivos. Aqui

nós investigamos o efeito da LLLT em citocinas inflamatórias em rim de rato

após isquemia prolongada. Métodos. Após a aprovação do Comitê de Ética

para Uso de Animais, ratos Wistar foram anestesiados com cetamina mais

xilazina. A parede abdominal anterior foi incisionada na linha mediana. Ambos

os rins foram retirados e colocados imediatamente em solução nutritiva gelada.

Grupos tratados receberam a terapia a laser com 1,3,6 e 10 Joules de energia

em momentos diferentes. Depois de 2, 12 e 24 horas os rins foram fixados para

análise histológica e bioquímica. No grupo tratado a laser, uma dose de energia

de 3 Joules foi entregue em dois pontos centralmente e, bilateralmente, 5 min

após a reperfusão. Resultados. A análise bioquímica não revelou alterações

significativas para as citocinas inflamatórias após a laserterapia. A avaliação

morfológica demonstrou uma melhor organização tecidual nos grupos tratados

com laser. Conclusões. Os resultados demonstraram que LLLT foi capaz de

preservar o tecido renal de isquemia induzida por lesão.

28

4.2 - ABSTRACT

Introduction. Acute Kidney injury (AKI) is associated with a high degree of

morbidity and mortality. Ischaemia-reperfusion injury (IRI) is one of the major

causes of AKI. Currently, inflammatory cytokines specially TNF-α, seems to be

involved in the injury and no pharmacological agents have proven to prevent

AKI after IRI. In the last decade we demonstrated that LLLT is able to inhibit

inflammatory markers including cytokines (TNF-α and IL-1 for example). Aims.

Here we investigate the effect of LLLT on inflammatory cytokines in Rat kidney

after prolonged ischemia. Methods. After approval of the Ethical Committee for

Animal Use, Male Wistar rats were taken to the experiment table and

anaesthetized with ketamine plus xilazyne. The anterior abdominal wall was

incised on the median line. Both kidneys were excised and immediately placed

in cold nutritive solution. Treated groups received laser therapy with 1,3,6 and

10 Joules of energy in different times. After 2, 12 and 24 hours the kidneys were

fixed for histological and biochemical analysis. In the laser treated group, an

energy dose of 3 Joules was delivered in two points centrally and bilaterally, 5

min after reperfusion. Results. Biochemical analysis revealed no significant

alterations for inflammatory cytokines after LLLT. Morphological evaluation

demonstrated a better cell organization in the laser-treated groups.

Conclusion. Our results demonstrated that LLLT was able to preserve the

renal tissue from ischemia-induced lesions.

29

4.3 - INTRODUÇÃO

No ano de 2010, a Associação Brasileira de Transplantes de Órgãos

(ABTO) iniciou um grande levantamento dos transplantes realizados no País,

com especial atenção às taxas de sobrevidas dos pacientes e dos enxertos.

Foram realizados 6.402 transplantes de órgãos, incluindo coração, fígado,

intestino, pâncreas, pulmão e rim, no país. Dentre estes, 4.630 transplantes

renais, representando um aumento de 8% em relação a 2009. Do total

realizado, 64,6% refere-se a doador falecido, a maior taxa já obtida. Houve

aumento de 17,2% na taxa de transplante com doador falecido e queda de

5,7% com doador vivo. Apesar das restrições aos transplantes com doador vivo

não parente, não cônjuge, a taxa aumentou levemente de 6,3% para 6,6% 1.

A Doença Renal Crônica (DRC) é, atualmente, considerada um problema

de saúde pública mundial e os custos do tratamento da doença são altíssimos.

O número projetado atualmente para pacientes em tratamento dialítico e com

transplante renal no Brasil está próximo dos 120.000, a um custo de 1,4 bilhão

de reais2.

A Insuficiência Renal Aguda (IRA) é caracterizada por uma redução

abrupta da função renal, que se mantém por períodos variáveis, resultando na

inabilidade dos rins em exercer suas funções básicas de excreção e

manutenção da homeostase hidroeletrolítica do organismo. A IRA se apresenta

em diversas formas clínicas, entre elas a IRA isquêmica e a nefrotóxica. Dentre

as etiologias de IRA renal, 62% são decorrentes de necrose tubular aguda

conseqüentes a causas isquêmicas (72%) e tóxicas (28%) 2,3. No Brasil, em

estudo de Burdmann e cols. (1993), observou-se que as causas de IRA eram

predominantemente: sepse (33%), hipovolemia (33%), insuficiência cardíaca

descompensada (32%), nefrotoxicidade de drogas (27%), traumatismo cirúrgico

(13%) e hipotensão (20%), com grande ocorrência de associação de dois ou

mais desses fatores, e, de forma geral, a maior parte incorrendo em

hipoperfusão renal3.

O mecanismo de isquemia-reperfusão é a etiologia mais comumente

relacionada à lesão renal. Na isquemia, um dos eventos mais precoces é a

30

redução dos níveis intracelulares de ATP, que compromete preferencialmente

porções do néfron que possuem alta taxa de reabsorção tubular com gasto de

energia, como o túbulo proximal e a alça ascendente espessa de Henle. A

depleção de ATP desencadeia uma série de eventos, incluindo desestruturação

do citoesqueleto, perda da polaridade celular e interação célula-célula,

produção de espécies reativas de oxigênio, alterações do pH intracelular,

podendo culminar com morte celular4.

O transplante renal é uma abordagem terapêutica aceitável para

pacientes com doença renal terminal. A denominada lesão de isquemia e

reperfusão (LIR) é um problema clínico, que ocorre como uma consequência

invariável dos transplantes, especialmente renal4. Existem poucas abordagens

terapêuticas efetivas capazes de minimizar a lesão de isquemia e reperfusão

renal5,6,7. Recentemente, tem se sugerido que o período pós-isquemia, que é

definido como uma rápida interrupção intermitente do fluxo sanguíneo na fase

inicial da reperfusão protege o coração contra as lesões de isquemia e

reperfusão. Esta proteção também foi observada para o rim. Em transplantes

renais, a ocorrência de lesões por isquemia e reperfusão renal pode afetar

consideravelmente as funções do órgão, colocando em risco o sucesso de todo

o processo de transplante8,9. LIR pode ser causada por múltiplos fatores

envolvendo células operatórias tubulares, formação de radicais livres de

oxigênio, disfunção mitocondrial, geração de citocinas inflamatórias e infiltração

de neutrófilos. Em particular, o Fator de Necrose Tumoral-α (TNF-α) - citocina

central no processo inflamatório - tem sido estabelecido como um importante

mediador de lesão por isquemia e reperfusão renal10. Dados experimentais em

modelos animais de isquemia e reperfusão renal demonstram intensa reação

inflamatória após um período de isquemia renal de 45 minutos e reperfusão de

2 horas11,4.

O fator de necrose tumoral (TNF-α) é uma citocina pleitrópica relacionada

tanto à sobrevivência e proliferação celular como à morte celular no processo

apoptótico12. O TNF-α tem sido identificado como uma citocina pró-inflamatória

importante sintetizada em hemorragias relacionadas com lesões de isquemia-

reperfusão13,14,15. É bem conhecido que o TNF- α é expresso após

31

hemorragia16,17,18, desempenha um importante papel na inflamação auto-

destrutiva excessiva e, finalmente, é capaz de induzir a falência múltipla de

órgãos através da ativação maciça de neutrófilos15. Além disso, o TNF- α é

conhecido por desencadear a liberação de outras citocinas pró-inflamatórias,

como a interleucina (IL)-1b e IL-619,20.

Laser de baixa intensidade (LLLT) tem sido utilizado clinicamente desde

1981 no tratamento de pacientes com doenças inflamatórias. As vantagens

terapêuticas do LLLT para doenças inflamatórias tem sido sugeridas por vários

autores e é apontado como uma alternativa para reduzir a dor.

Interessantemente, diversos trabalhos de nosso grupo demonstram a

capacidade desta terapia em inibir os principais mediadores inflamatórios

envolvidos na LIR renal, a saber, TNF-alfa e COX-2 e aumentar a expressão de

outros mediadores antiinflamatórios como IL-1021,22,23,24,25,26. O laser pode

ainda reduzir a expressão de determinadas colagenases (MMPs) e


proliferação celular. No entanto, é muito importante ressaltar que muito pouco

se conhece a respeito do mecanismo de ação do laser infravermelho em

órgãos internos e nobres como o Rim, especialmente em condições de

isquemia e transplante27,28,29,30,31,32,33,34.

Tendo em vista a experiência prévia do grupo de pesquisa, no estudo dos

mecanismos de ação do Laser de baixa potência em diferentes doenças ou

situações inflamatórias, visamos investigar os efeitos da laserterapia na lesão

por isquemia e reperfusão em rins destinados ao transplante.

32

4.4 - MATERIAL E MÉTODOS

Foram utilizados 45 ratos Wistar machos pesando entre 150 e 200g (+/-

60 dias de vida), com livre acesso a água e ração, provenientes do Biotério da

Universidade Nove de Julho. Os animais foram mantidos em ambiente com

temperatura controlada e ciclo claro/escuro de 12 horas. O presente protocolo

experimental foi submetido e aprovado pelo Comitê de Ética em

Experimentação Animal da Universidade Nove de Julho (AN 0018/2011).

Os animais foram anestesiados com uma mistura de ketamina 10% (0,2

ml/100 gramas do animal) e de xylazina 2% (0,1 ml/100 gramas do animal), e

submetidos à cirurgia bilateral para extração dos rins. Os rins extraídos foram

imediatamente acondicionados em solução comercial para manutenção de

órgãos destinados a transplante, conforme especificações da Rede Brasileira

de Transplantes (RBT). Após a cirurgia os animais foram sacrificados por

administração de superdose de anestésico. Este procedimento não produz

qualquer sofrimento ao animal de experimentação.

Após a cirurgia de extração renal, os órgãos mantidos em solução

específica para manutenção de órgãos para transplante foram irradiados com

Laser de baixa potência (810 nm e 100 mW de potência; 0,028 cm2 de área de

feixe; Thera Lase, DMC®) em diferentes tempos (2, 12 e 24 horas) durante 10,

30, 60 e 100s caracterizando as doses de energia/ponto de 1, 3, 6 e 10 Joules.

As irradiações foram realizadas em 2 pontos de cada hemisfério renal,

iniciando-se em diferentes momentos (vide protocolos a seguir).


Neste protocolo, foi realizada a irradiação durante o ato cirúrgico, e

após 01 hora de imersão em líquido de transplante. Após 2 horas os rins foram

fixados ou congelados em nitrogênio líquido para posteriores análises. Foram

utilizados 06 órgãos para cada dose de energia (Grupos controle, 1,3, 6 e 10

Joules). Número total de Rins = 30; Número Total de Animais = 15;

33


Neste protocolo foram realizadas as irradiações durante o ato cirúrgico,

e após 01, 03, 05, 07 e 09 horas de imersão em líquido de transplante. Após 12

horas os rins foram fixados ou congelados em nitrogênio líquido para



de Animais = 15;


Neste protocolo foram realizadas as irradiações durante o ato cirúrgico,

e após 01, 03, 05, 07, 09, 12 e 20 horas de imersão em líquido de transplante.

Após 12 horas os rins foram fixados ou congelados em nitrogênio líquido para



de Animais = 15;

4.4.1 - Dosagem de Citocinas Inflamatórias

Foram realizadas as dosagens de citocinas inflamatórias IL-1, IL-6, IL-10

e TNF-alpha. Foram utilizados KIT´s comerciais da marca Cayman, e a

metodologia realizada conforme as instruções de cada Kit.

4.4.2 - Processamento histológico

Os espécimes (rins) foram delimitados em metade ventral e dorsal,

inseridos em cassetes plásticos devidamente identificados, lavados por uma

hora em água corrente e submetidos à desidratação. A desidratação foi

realizada em soluções de concentrações crescentes de álcool anidro (Synth,

SP, Brasil), na sequência em álcool 70, 80, 90, 95, 100 (1), 100 (2) e 100 (3),

durante 1 hora em cada passagem. O processo de diafanização ou

clareamento foi realizado em álcool/xilol (1:1), xilol (1, Synth, SP, Brasil), xilol

(2) e xilol (3) durante 1 hora em cada passagem. A impregnação foi realizada

com parafina de baixa temperatura de fusão (56-58C) em estufa com controle

de temperatura microprocessada (Fanem, SP, Brasil) a 56,5C, em três

34

imersões (parafina 1, parafina 2 e parafina 3) com duração de 1 hora em cada

passagem. Os espécimes foram incluídos em formas de plástico apropriadas,

sob lupa estereoscópica e emblocados em suporte de madeira devidamente

identificados, sendo que superfície seccionada de cada rim ficou posicionada

para a face de corte em micrótomo.

Cortes histológicos de cinco micrômetros de espessura foram realizados

em micrótomo rotativo (RM2125 RT, Leica Instruments, USA) acoplado com

navalha descartável. Para a coleta dos cortes histológicos, inicialmente foi

realizada a trimagem do bloco de parafina com o espécime em micrótomo até

que toda a superfície do órgão fosse seccionada; a partir deste ponto foram

selecionados três cortes histológicos em sequência (um para coloração HE,

outro para coloração picrossirius e outro reserva), os quais foram transferidos

para o banho histológico (Easybath, Easypath, SP, Brasil). Estes cortes

histológicos foram coletados em lâminas de vidro revestidas com poli-lisina

(Sigma, USA).

Para a coleta das imagens digitais foi utilizado um microscópio de luz

(DM500, Leica, CA, USA) com objetiva de 4x, acoplado com uma câmera

digital (Sony, CA, USA) com programa para captura de imagens (Qwin, Leica,

USA). As imagens digitais foram gravadas em formato TIFF.

35

4.5 - RESULTADOS

4.5.1 - ANÁLISE HISTOPATOLÓGICA

Os espécimes mostraram adequadas condições de preservação tecidual,

sem visíveis artefatos de fixação histológica. Portanto, as principais

características histopatológicas observadas podem ser em decorrência de

patologias renais pré-existentes ou da manipulação experimental dos animais.

A coloração pelo método HE permitiu visualizar as características

estruturais dos néfrons e tubos coletores, em particular, a morfologia celular

(epitélio renal) e detalhes do perfil nuclear (figura 1). Além disso, o tecido

conjuntivo de preenchimento, o sistema vascular renal e possíveis processos

inflamatórios foram evidenciados (figura 1).

A coloração pelo método do picrossírius permitiu visualizar o tecido

conjuntivo de preenchimento, restringindo a análise a um dos componentes

teciduais (matriz extracelular fibrilar) (figura 1). Deste modo, somente sensíveis

alterações puderam ser elucidadas empregando este método de coloração;

corroborando, por exemplo, na observação de espessamento membranoso do

glomérulo renal (figura 1), de base patológica.

A análise histopatológica revelou que os espécimes apresentaram dois

padrões típicos: a) condições de normalidade tecidual ou, ocasionalmente, com

leves alterações celulares que não permitem isoladamente caracterizar uma

patologia renal (figura 1); b) alterações histopatológicas, restritas aos

glomérulos (glomerulopatia membranosa, figura 1), com intensidades leve ou

moderada e/ou associadas à necrose tubular aguda (leve ou moderada) (figura

1). A necrose tubular aguda pode ser decorrente de isquemia (perfusão renal

insuficiente).

A glomerulopatia membranosa observada apresentava principalmente

com grau leve e, ocasionalmente moderado. Estava caracterizada com

espessamento do tecido conjuntivo subjacente ao epitélio dos vasos

36

sanguíneos do glomérulo renal, evidenciando pela exuberância da coloração

eosinófilica (figura 1). Não foi evidenciado processo inflamatório associado.

A necrose tubular aguda estava evidenciada nos túbulos contorcidos

distais ou proximais, alças de Henle e nos tubos coletores. As alterações mais

pronunciadas foram à presença de células vacuolizadas, com granulações

citosólicas difusas e a descamação de células necróticas ou viáveis no lúmen

dos túbulos (figura 2). Em alguns casos, o lúmen estava preenchido por

material hialino, celular ou granular (figura 2). Não foi evidenciado processo

inflamatório associado, indicando que o processo necrótico estava em

processo inicial.

Figu

med

F), O

espe

Joule

Obse

evide

Cont

assim

duto

ura 1. Cor

dular (E-F)

Observar e

essamento

e).

ervar em C

enciado pe

trole). Obs

m como o

os ou túbulo

rtes histoló

coradas p

em A-B, um

o de suas

C-D um co

elo espess

servar em E

o tecido int

os coletore

ógicos de

pelos méto

m corpúsc

membran

orpúsculo

samento d

E-F os túb

tersticial (s

es; TCP, tú

rim most

odos do HE

culo renal e

nas (seta)

renal com

das membr

bulos coleto

seta). Abre

úbulo conto

rando as

E (A, C, E

em condiç

no glomé

glomerulo

ranas (seta

ores em co

eviaturas:

orcido prox

regiões co

) e do picr

ões de no

érulo rena

opatia mem

a) do glom

ondições d

*, corpúsc

ximal.

cortical (A-

rossírius (

ormalidade

al (Grupo

mbranosa

mérulo (Gru

de normalid

culo renal;

37

-D) e

B, D,

sem

- 01

leve,

upo -

dade,

DC,

Figu

méto

Obse

mos

mate

dege

hialin

algu

(seta

ura 2. Corte

odo do H

ervar em

trado corte

erial granu

eneração (

no descam

mas alça d

a) (Grupo -

es histológ

HE com d

A uma co

es transve

uloso e v

(seta) (Gru

mado no l

de Henle p

- Controle)

gicos de ri

diferentes

ongestão v

ersais de t

vacuolizaçã

upo - Contr

úmen (set

preenchido

). Abreviatu

m mostran

caracterís

vascular (s

túbulos co

ão no cito

role). Em C

ta) (Grupo

o com mat

uras: *, cor

ndo a regiã

sticas de

seta) (Gru

ontorcidos

osol de c

C é mostra

o - 03 Jou

terial hialin

rpúsculo re

ão medula

necrose t

upo - Cont

proximais

células em

ado túbulo

ules). Em

no e célula

enal

ar corados

tubular ag

trole). Em

s e distais

m processo

os com ma

D é most

s degener

38

pelo

guda.

B é

com

o de

aterial

trado

radas

Fi

C

re

A

B

D igura 3. Co

ontrole; B

eferentes a

ortes histol

– 01 Jou

ao protocol

lógicos de

ule; C – 03

o de 2 hor

C

Erim corado

3 Joules;

ras.

C

E os pelo mé

D – 06 Jo

étodo do H

oules, E –

HE, onde A

– 10 Joule

39

A –

es,

Figu

Con

ao p

A

B

D

A

ura 4. Cor

ntrole; B –

protocolo d

rtes histoló

01 Joule;

de 12 hora

ógicos de

C – 03 Jo

as.

C

E

rim corad

oules; D –

C

E

dos pelo m

06 Joules,

método do

, E – 10 Jo

o HE, ond

oules, refe

40

de A –

erentes

Fig

Con

refe

B

D

A

D

B

ura 5. Cor

ntrole; B –

erentes ao

rtes histoló

– 01 Joul

protocolo

ógicos de

e; C – 03

de 24 hora

CC

rim corado

3 Joules;

as.

C

E

C

os pelo mé

D – 06 J

étodo do H

Joules, E

HE, onde A

– 10 Jou

41

A –

les,

42

QUADRO 01. RESUMO DAS PRINCIPAIS CARACTERÍSTICAS HISTOPATOLÓGICAS – GRUPO 2 HORAS

Abreviaturas: * alterações histopatológicas; cn, condições de normalidade; CR, corpúsculo renal (glomérulo-cápsula de Bowman); AH, Alça de Henle; DC, dutos coletores; TCD, túbulo contorcido distal; TCP, túbulo contorcido proximal.

Grupo Córtex Medula

Sistema circulatório renal Observações

CR TCP TCD AH DC

CONTROLE * * * * * Baixa perfusão renal

Necrose tubular aguda leve. Presença de células com

granulações e vacuolizações. Glomerulopatia

Membranosa

01 J cn cn cn * cn Baixa perfusão renal

Necrose tubular aguda leve. Presença de

material hialino no lúmen.

03 J cn * * * * Baixa perfusão renal


granulações e vacuolizações.

Presença de material hialino

no lúmen.

06 J * cn * cn cn Congestão vascular leve

Necrose tubular aguda leve. Presença de

material hialino no lúmen.

Glomerulopatia Membranosa leve.

10 J cn cn * * cn Baixa perfusão renal


granulações e vacuolizações

43




CR TCP TCD AH DC

CONTROLE cn * * * cn Congestão vascular




no lúmen.

01 J cn * * * * Congestão vascular

Necrose tubular aguda. Presença de células com granulações e vacuolizações.


no lúmen.




no lúmen.




no lúmen.

10 J cn * * * cn Baixa perfusão renal




44




CR TCP TCD AH DC

CONTROLE * * * * * Congestão vascular

Necrose tubular aguda. Presença de

células com granulações e vacuolizações.

Presença de material hialino no

lúmen.Glomerulopatia Membranosa leve.




Presença de material hialino no lúmen.





Discreto processo inflamatório crônico

na região do hilo renal





10 J * * * * * Baixa perfusão renal




Glomerulopatia Membranosa.


45

4.5.2 - Dosagem de Citocinas Infamatórias

Foram realizadas as dosagens de citocinas inflamatórias.

A Figura 06 mostra os resultados da dosagem de interleucina – 1 (IL-1) nos

tempos de 2 (Painel A), 12 (Painel B) e 24 horas (Painel C). Como podemos

observar, apenas a dose de 10 Joules provocou um aumento significativo de

IL-1 no tempo de 2 horas. Todas as outras doses de Energia não induziram

qualquer alteração nos níveis de IL-1 no tecido renal.



observar, todas as doses de Energia utilizadas não induziram qualquer

alteração nos níveis de IL-6 no tecido renal.



observar, todas as doses de Energia utilizadas não induziram qualquer

alteração nos níveis de IL-10 no tecido renal.

A Figura 09 mostra os resultados da dosagem de TNF-alfa nos tempos de 2

(Painel A), 12 (Painel B) e 24 horas (Painel C). Como podemos observar, todas

as doses de Energia utilizadas não induziram qualquer alteração nos níveis

desta citocina no tecido renal.

46

IL-1 (2hs)

CONTROLE 1J 3J 6J 10

J0

500

1000

1500

*

pg/m

g de

Tec

ido

IL-1 (12hs)


J0

200

400

600

800

pg/m

g de

Tec

ido

IL-1 (24hs)


J0

100

200

300

400

pg/m

g de

Tec

ido

A

B

C



rins. * p < 0,05

47

IL-6 (2hs)

CONT

ROLE 1J 3J 6J 10

J0

200

400

600

800

1000

pg/m

g de

Tec

ido

IL-6 (12hs)

CONT

ROLE 1J 3J 6J 10

J0

200

400

600

pg/m

g de

Tec

ido

IL-6 (24hs)

CONT

ROLE 1J 3J 6J 10

J0

100

200

300

400

pg/m

g de

Tec

ido

A

B

C



rins. * p < 0,05

48

IL-10 (2hs)


J0

2000

4000

6000

8000

10000

pg/m

g de

Tec

ido

IL-10 (12hs)


J0

2000

4000

6000

8000

pg/m

g de

Tec

ido

IL-10 (24hs)


J0

1000

2000

3000

4000

pg/m

g de

Tec

ido

A

B

C



rins. * p < 0,05

49

TNF-α (2hs)

CONT

ROLE 1J 3J 6J 10J

0

500

1000

1500

2000

pg/m

g de

Tec

ido

TNF-α (12hs)

CONT

ROLE 1J 3J 6J 10J

0

500

1000

1500

2000

pg/m

g de

Tec

ido

TNF-α (24hs)


J0

200

400

600

800

pg/m

g de

Tec

ido

A

B

C

Figura 09 - Dosagem de TNF-alfa nos tempos de 2 (Painel A), 12 (Painel B) e

24 horas (Painel C). Os valores representam a média + EPM de 06 rins. * p < 0,05

50

4.6 - DISCUSSÃO

A lesão renal aguda (LRA), anteriormente conhecida como "insuficiência

renal aguda", tem sido tradicionalmente descrita como uma diminuição rápida

da função renal (variando de horas a semanas, com menos de 3 meses),

medida pelo aumento de creatinina sérica2. A complexa rede de eventos que

ocorrem na lesão aguda do rim foi definida mais precisamente como "uma

abrupta (em 48 horas) redução da função renal", e estabelecidos valores

específicos laboratoriais e clínicos para orientar o diagnóstico. A incidência de

LRA em pacientes hospitalizados tem sido geralmente relatada no intervalo de

2% a 7%, com uma incidência de 5% a 10% maior do que na população em

UTI. O quadro é normalmente encontrado em situações de falência de

múltiplos órgãos e sepse2.

A incidência de LRA tem crescido em muitos grupos demográficos, e

pode inclusive, ser maior do que a de acidentes vasculares encefálicos. Apesar

dos avanços nas estratégias de prevenção e medidas de apoio, LRA continua a

ser associada com alta morbidade e mortalidade, particularmente naqueles

internados na UTI, onde as taxas de mortalidade hospitalar podem exceder

50%2,35.

A chamada Isquemia / reperfusão Renal (IRI) tem sido apontada como

causa comum de LRA, e resulta de uma deficiência generalizada ou localizada

de oxigénio e de nutrientes para entrega, e remoção de produtos do

metabolismo a partir de células do rim. Como resultado do desequilíbrio, as

células epiteliais tubulares podem sofrer lesões graves ou mesmo morte por

apoptose e/ou necrose (necrose tubular aguda [ATN]), com insuficiência de

órgãos funcionais e homeostase de electrólitos e excreção reduzida de

resíduos de produtos de metabolismo. Existem muitos estados fisiopatológicos

e medicamentos que podem contribuir para a isquemia generalizada ou

localizada35.

O objetivo da primeira parte deste trabalho foi verificar um possível efeito

terapêutico do Laser de Baixa Potência sobre as lesões decorrentes do

fenômeno de isquemia renal. Tendo em vista que, respeitando-se as

51

particularidades inerentes ao modelo, trata-se, em última instância, de uma

resposta inflamatória que é gerada pelo período prolongado de isquemia, e que

pode ser até mesmo potencializado no momento da reperfusão. Sabemos que

a radiação laser operando em baixa intensidade apresenta importante atividade

antiinflamatória, visamos investigar tais efeitos no modelo experimental ora

estudado.

De acordo com Gonçalves et al (2010)35, as interleucinas 1 e 18 possuem

papel preponderante na resposta inflamatória da lesão renal aguda. Em nosso

trabalho, avaliamos os níveis de IL-1 no tecido renal. No entanto, não foi

possível observar nenhum tipo de alteração significativa nos órgãos analisados

em qualquer tratamento.

Analisamos também os níveis de interleucina 6 (IL-6) no tecido renal, e

constatamos que a isquemia/reperfusão não foram capazes de induzir um

aumento significativo da citocina. Segundo Nakagiri et al (2012)36, níveis

aumentados de IL-6 parecem estar relacionados a processos de rejeição em

situações de transplante. Estudos adicionais são necessários para melhor

elucidarmos o papel da IL-6 na lesão de isquemia e reperfusão.

Avaliamos os níveis de interleucina-10 classicamente associadas a efeitos

antiinflamatórios. Pudemos observar um aumento dos níveis de IL-10 no tecido

renal após a isquemia e reperfusão nos grupos tratados com Laser, embora a

variabilidade experimental não tenha permitido um nível aceitável de

significância. Podemos sugerir que estes níveis devem estar significativamente

aumentados com o objetivo de modular o processo inflamatório desencadeado

pelo modelo utilizado. Orman et al, (2011)37 estudaram a dinâmica de várias

citocinas e quimiocinas em modelos inflamatórios e infecciosos. Neste trabalho,

observaram que os níveis de IL-10 tendem a decair com a resolução da

inflamação, sugerindo uma modulação da IL-10.

Os níveis de TNF-α analisados neste trabalho, ao menos no tempo de 2

horas, quando foi feito o sacrifício dos animais, não apresentaram diferenças

significativas para nenhum dos grupos.

52

As análises histomorfológicas qualitativas realizadas até o momento

revelaram uma proteção dos grupos tratados com Laser, quando comparado

ao grupo somente isquemia. Os achados histológicos descritos nos quadros 1,

2 e 3 demonstram claramente o efeito protetor do tratamento com Laser sobre

o tecido renal. Podemos observar nos quadros da análise qualitativa, que todas

as doses de energia utilizadas foram capazes de melhorar ou preservar o

tecido analisado. Ao contrário das dosagens de citocinas inflamatórias, a

análise histológica demonstrou-se mais sensível para a detecção de alterações

causadas pela isquemia renal em diferentes tempos.

53

4.7 - CONCLUSÕES

A irradiação com Laser de Baixa potência operando em 810 nm e com

diferentes doses de energia foi capaz de preservar o tecido renal de lesões

induzidas pelos períodos de isquemia de 2, 12 e 24 horas. A análise qualitativa

histomorfológica foi capaz de revelar uma proteção conferida pelo tratamento

com Laser sobre o dano tecidual induzido pela isquemia e reperfusão renal,

demonstrando-se mais sensível do que a dosagem de citocinas inflamatórias.

54

4.8 - REFERÊNCIAS BIBLIOGRÁFICAS

1. Associação Brasileira de Transplante de Órgãos. Registro Brasileiro de

Transplantes. Disponível em:

http://www.abto.org.br/abtov02/portugues/populacao /rbt/anoXVI_n4/index.aspx

Acesso em: 11 de abril. 2011

2. Bastos et al.; Doença Renal Crônica: Frequente e Grave, mas também

prevenível e tratável. Ver. Assoc. Med. Bras. V. 56(2), p. 248-53, 2010.

3. Burdman E, et al. Epidemiologia. In: Schor N, Boim MA, Santos OFP. IRA,

Insuficiência Renal Aguda: Fisiopatologia, Clínica e Tratamento. J. Bras. Nefrol.

v. 24, p. 1-12, 1997.

4. Matsuyama, M.; Yoshimura, R.; Hase, T.; Kawahito, Y.; Sano, H.; Nakatani,

T.; Study of cyclooxygenase-2 in renal ischemia-reperfusion injury. Transplant

Proc. v. 37, p. 370-372, 2005.

5. Kin, H.; Zhao, Z.Q.; Sun, H.Y.; Wang, N.P.; Corvera, J.S.; Halkos, M.E.;

Kerendi, F.; Guyton, R.A.; Vinten-Johansen, J.; Postconditioning attenuates

myocardial ischemia-reperfusion injury by inhibiting events in the early minutes

of reperfusion. Cardiovasc Res. v. 62, p. 74, 2004.

6. Sun, H.Y.; Wang, N.P.; Halkos, M.; et al.; Postconditioning attenuates

cardiomyocyte apoptosis via inhibition of JNK and p38 mitogen-activated

protein kinase signaling pathways. Apoptosis. v. 11, p. 583, 2006.

7. Zhao, Z.Q.; Corvera, J.S.; Halkos, M.E.; Kerendi, F.; Wang, N.P.; Guyton,

R.A.; et al.; Inhibition of myocardial injury by ischemic postconditioning during

reperfusion: comparison with ischemic preconditioning. Am J Physiol Heart Circ

Physiol. v. 285(2), p. 579-88, 2003.

8. Szware, I.; Soullier, S.; Gayard, N.; et al.; Ischemic postconditioning Modified

Renal Oxidative Stress and Lipid Peroxidation caused by Ischemic Reperfusion

Injury in Rats. Transplant Proc v. 39, p. 2554, 2007.

55

9. Liu, X.; Chen, H.; Zhan, B.; Xing, B.; Zhou, J.; Zhu, H.; Chen, Z.; Attenuation

of reperfusion injury by renal ischemic postconditioning: the role of NO.

Biochem Biophys Res Commun. V. 359, p.628, 2007.

10. Choi, D.E.; Jeong, J.Y.; Lim, B.J.; Na, K.R.; Shin, Y.T.; Lee, K.W.;

Pretreatment with the tumor nerosis factor-alpha blocker etanercept attenuated

ischemia-reperfusion renal injury. Transplant Proc v. 41, p. 3590-6, 2009.

11. Yun, Y.; Duan, W.G.; Chen, P.; et al.; Down-regulation of cyclooxygenase-2

is involved in ischemic postconditioning protection against renal ischemia

reperfusion injury in rats. Transplant Proc. v. 41, p. 3585, 2009.

12. Hosaka, Y.; Kirisawa, R.; Ueda, H.; Yamaguchi, M.; Takehana, K.;

Differences in Tumor Necrosis Factor (TNFα) and TNF Receptor-1-Mediated

Intracellular Signaling Factors in Normal, Inflamed and Scar-Formed Horse

Tendons. Journal of Veterinary Medical Science. v. 67, p. 985-991, 2005.

13. Caty M.G., Guice K.S., Oldham K.T.; et al. Evidence for tumor necrosis

factor-induced pulmonary microvascular injury after intestinal ischemia-

reperfusion injury. Ann. Surg. v. 212, p. 694–700, 1990.

14. Takada, M.; Nadeau, K.C.; Shaw, G.D.; Marquette, K.A.; Tilney, N.L.; The

cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat

kidney. Inhibition by a soluble P-selectin ligand. J. Clin. Invest. V. 99, p. 2682–

2690, 1997.

15. Donnahoo, K.K.; Meng, X.; Ayala, A.; Cain, M.P.; Harken A.H.; Meldrum;

D.R.; Early kidney TNF-alpha expression mediates neutrophil infiltration and

injury after renal ischemiareperfusion. Am. J. Physiol. v. 277, p. R922–R929.

1999a.

16. Roumen, R.M.; Hendriks, T.; Van Der Ven-Jongekrijg, J.; et al. Cytokine

patterns in patients after major vascular surgery, hemorrhagic shock, and

severe blunt trauma. Relation with subsequent adult respiratory distress

syndrome and multiple organ failure. Ann. Surg. v. 218, p. 769–776, 1993.

56

17. Guo, W.; Ding, J.; Huang, Q.; Jerrells, T.; Deitch, E.A.; Alterations in

intestinal bacterial flora modulate the systemic cytokine response to

hemorrhagic shock. Am. J. Physiol. V. 269, p. 827–832, 1995.

18. Jiang, J.; Tian, K.; Diao, Y.; Chen, H.; Zhu, P.; Wang, Z.; Expression of TNF

alpha, IL-1 beta, IL-6 mRNA, release of TNF alpha in vital organs and their

relationship with endotoxin translocation following hemorrhagic shock. Chin.

Med. Sci. J. v. 12, p. 41-6, 1997.

19. Dinarello, C.A.; Cannon, J.G.; Wolff, S.M.; et al. Tumor necrosis factor

(cachectin) is an endogenous pyrogen and induces production of interleukin 1.

J. Exp. Med. v. 163, p. 1433–1450, 1986.

20. Suitters, A.J.; Foulkes, R.; Opal, S.M.; et al. (1994) Differential effect of

isotype on efficacy of anti-tumor necrosis factor alpha chimeric antibodies in

experimental septic shock. J. Exp. Med. v. 179, p. 849–856, 1994.

21. Pallotta, R.C.; Bjordal, J.M.; Frigo, L.; Leal-Junior, E.C.P.; Teixeira, S.;

Marcos, Rl.; Ramos, L.; Messias, F.D.M.; Lopes-Martins, R.A.B.; Infrared (810-

nm) low-level laser therapy on rat experimental knee inflammation. Lasers in

Medical Science. v. 77. p. 21-8, 2011.

22. Marcos, R.L.; Leal-Junior, E.C.P.; Messias, F.D.M.; Carvalho, M.H.C.;

Pallotta, R.C.; Frigo, L.; Dos Santos, R.A.; Ramos, L.; Teixeira, S.A.; Bjordal,

J.M.; Lopes-Martins, R.A.B.; Infrared (810 nm) low-level laser therapy in rat

Achilles tendinitis: A consistent alternative to drugs. Photochem & Photobiol. v.

87, p. 1447-52, 2011.

23. Lopes-Martins, R.A.B.; Albertini, R.; Leonardo, P.S.L.M.; et al. Steroid-

receptor antagonism inhibits the anti-inflammatory effects of low-level laser

therapy. Photomed. Laser Surg. v. 24, p. 197-201, 2007.

24. Aimbire, F.; Albertini, R.; Pacheco, M.T.; Castro-Faria-Neto, H.C.; Leonardo,

P.S.; Iversen, V.V.; Lopes-Martins, R.A.B.; Bjordal, J.M.; Low level laser therapy

induces dose-dependent reduction of TNF-α levels in acute inflammation.

Photomed. Laser Surg. v. 24(1),p. 33-7. 2006

57

25. Aimbire, F., Bjordal J.M., Iverson V.V.; Low level laser therapy partially

restores trachea muscle relaxation response in rats with tumor necrosis factor

alpha-mediated smooth airway muscle dysfunction. Lasers Surg. Med. v. 38, p.

773–778, 2006.

26. Aimbire, F., Albertine, R., Magalhães, R.G., Et Al. Effect of LLLT Ga-Al-As

(685 nm) on LPS-induced inflammation of the airway and lung in the rat. Lasers

Med. Sci. v. 20, p. 11–20, 2005.

27. Marcos, R.L.; Leal-Junior, E.C.; Arnold, G.; Magnenet, V.; Rahouadj, R.;

Wang, X.; Demeurie, F.; Magdalou, J.; De Carvalho, M.H.; Lopes-Martins,

R.A.B.; Low-level laser therapy in collagenase-induced achilles tendinitis in rats:

Analyses of biochemical and biomechanical aspects. Journal of Orthopaedic

Research. v. 30, p. 1945-51, 2012

28. Joensen, J.; Demmink, J.H.; Johnson, M.I.; Iversen, V.; Lopes-Martins,

R.A.B.; Bjordal, J.M.; The Thermal Effects of Therapeutic Lasers with 810 and

904 nm Wavelengths on Human Skin. Photomedicine and Laser Surgery. v.

29(3), p. 145-153, 2011.

29. Frigo, L.; Fávero, G.M.; Campos-Lima, H.J.; Maria, D.A.; Bjordal, J.M.;

Joensen, J.; Iversen, V.; Labat, M.R.; Parizzoto, N.A.; Lopes-Martins, R.A.B.;

Low-Level Laser Irradiation (InGaAlP-660 nm) Increases Fibroblast Cell

Proliferation and Reduces Cell Death in a Dose-Dependent Manner.

Photomedicine and Laser Surgery. v. 28(S1) p. S-151-S-156, 2010.

30. Frigo, L.; Fávero, G.M.; Lima H.J.; Maria, D.A.; Bjordal, J.M.; Joensen, J.;

Iversen, V.V.; Marcos, R.L.; Parizzoto, N.A.; Lopes-Martins, R.A.B.; Low-Level

Laser Irradiation (InGaAlP-660 nm) Increases Fibroblast Cell Proliferation and

Reduces Cell Death in a Dose-Dependent Manner. Photomedicine and Laser

Surgery. v. 1, p. S1 51-6, 2010.

31. Chow, R.T.; Johnson, M.I.; Lopes-Martins, R.A.B.; Bjordal, J.M.; Efficacy of

low-level laser therapy in the management of neck pain: a systematic review

and meta-analysis of randomized placebo or active-treatment controlled trials.

Lancet v. 374, p.1897–1908, 2009.

58

32. Leal-Junior, E.C.; Lopes-Martins, R.A.; Godoi, V.; Mancalossi, J.L.; Rossi,

R.P.; De Marchi, T.; Parente, M.; Grosselli, D.; Generosi, R.A.; Basso, M.;

Frigo, L.; Bjordal, J.M.; Comparison between cold water immersion therapy

(CWIT) and light emitting diode therapy (LEDT) in short-term skeletal muscle

recovery after high-intensity exercise in athletes—preliminary results. Lasers

Med Sci. v. 26, p. 419–424, 2010.

33. Leal-Junior, E.C.; Lopes-Martins, R.A.; Dalan, F.; Ferrari, M.; Sbabo, F.M.;

Generosi, R.A.; Baroni, B.M.; Penna, S.C.; Iversen, V.V.; Bjordal, J.M.; Effect of

655-nm low level laser therapy on exerciseinduced skeletal muscle fatigue in

humans. Photomed Laser Surg. v. 26, p. 419–424, 2008.

34. Bjordal, J.M.; Lopes-Martins, R.A.B.; Joensen, J.; Couppe, C.; Ljunggren,

A.E.; Stergioulas, A.; Johnson, M.I.; A systematic review with procedural

assessments and meta-analysis of low level laser therapy in lateral elbow

tendinopathy (tennis elbow). BMC Musculoskelet Disord v. 9, p.75, 2008.

35. Gonçalves, G.M.; Zamboni, D.S.; Câmara, N.O.; The role of innate immunity

in septic acute kidney injuries. Shock. 34 Suppl v. 1, p. 22-6, 2010.

36. Nakagiri, T.; Inoue, M.; Minami, M.; Shintani, Y.; Okumura, M.; Immunology

mini-review: the basics of T(H)17 and interleukin-6 in transplantation.

Transplant Proc. v. 44(4), p. 1035-40, 2012.

37. Orman, M.A.; Nguyen, T.T.; Ierapetritou, M.G.; Berthiaume, F.; Androulakis,

I.P.; Comparison of the cytokine and chemokine dynamics of the early

inflammatory response in models of burn injury and infection. Cytokine. v. 55(3),

p. 362-71, 2011.

59

5 – CONSIDERAÇÕES FINAIS

Nosso grupo de pesquisas vem estudando os mecanismos de ação da

Laserterapia em diferentes modelos experimentais e clínicos desde o ano

2000. Vimos acumulando experiência sobre os efeitos do Laser de baixa

potência em doenças como osteoartrite, tendinites, lesões musculares,

pleurisia, peritonite e outras.

Neste trabalho abordamos uma importante situação médica que é a

preservação de órgãos destinados a transplante no Brasil. Conforme

mencionado, o transplante renal apresenta a maior demanda dentre os

transplantes de órgãos, e as lesões que podem ser geradas pelo período de

tempo que o órgão permanece fora do organismo podem levar ao

comprometimento de todo o procedimento e a perda do enxerto.

Desenvolvemos um modelo de retirada e manutenção de rins de ratos em

solução nutritiva, para avaliarmos os efeitos da laserterapia na preservação do

órgão.

A dosagem dos marcadores bioquímicos utilizados neste estudo não foi

sensível para evidenciar os efeitos da laserterapia na preservação dos rins

estudados. No entanto, a análise histomorfológica foi capaz de demonstrar o

efeito protetor da Laserterapia sobre o tecido renal, apontando para uma

possibilidade promissora da referida terapia para órgãos destinados a

transplante.

Consideramos que a coloração escura dos rins pode ter sido um fator

limitante para um melhor efeito da laserterapia, embora não tenha sido possível

avaliar alguns parâmetros como, por exemplo, o possível aumento de

temperatura do órgão durante a irradiação. Estudos adicionais se fazem

necessários para que possamos aperfeiçoar a terapia e o próprio modelo

experimental.

Podemos concluir que abre-se aqui uma nova possibilidade de pesquisa

que poderá levar a inovações tecnológicas e científicas na área de transplante

de órgãos.

60

6 – REFERÊNCIAS BIBLIOGRÁFICAS

1. BASTOS et al.; Doença Renal Crônica: Frequente e Grave, mas também

prevenível e tratável. Ver. Assoc. Med. Bras. V. 56(2), p. 248-53, 2010.

2. BEZERRA, J.S.; TEIXEIRA, W.; VATTIMO, M.F.F.; Efeito Protetor da Vitis

Vinifera na Lesão Renal Aguda Isquêmica em Ratos. J. Bras. Nefrol. v. 30, p.

99-104, 2008.

3. BURDMAN E, et al. Epidemiologia. In: Schor N, Boim MA, Santos OFP. IRA,

Insuficiência Renal Aguda: Fisiopatologia, Clínica e Tratamento. J. Bras. Nefrol. v. 24, p. 1-12, 1997.



http://www.abto.org.br/abtov02/portugues/populacao/rbt/anoXVI_n4/index.aspx

Acesso em: 11 de abril. 2011



http://www.abto.org.br/abtov02/portugues/populacao/rbt/mensagemRestrita6.aspx?

idCategoria=2 Acesso em: 01/11/2012

6. KIN, H.; ZHAO, Z.Q.; SUN, H.Y.; WANG, N.P.; CORVERA, J.S.; HALKOS,

M.E.; KERENDI, F.; GUYTON, R.A.; VINTEN‐JOHANSEN, J.; Postconditioning

attenuates myocardial ischemia-reperfusion injury by inhibiting events in the

early minutes of reperfusion. Cardiovasc Res. v. 62, p. 74, 2004.

7. SUN, H.Y.; WANG, N.P.; HALKOS, M.; et al.; Postconditioning attenuates

cardiomyocyte apoptosis via inhibition of JNK and p38 mitogen-activated

protein kinase signaling pathways. Apoptosis. v. 11, p. 583, 2006.

8. ZHAO, Z.Q.; CORVERA, J.S.; HALKOS, M.E.; KERENDI, F.; WANG, N.P.;

GUYTON, R.A.; et al.; Inhibition of myocardial injury by ischemic

postconditioning during reperfusion: comparison with ischemic preconditioning.

Am J Physiol Heart Circ Physiol. v. 285(2), p. 579-88, 2003.

61

9. SZWARE, I.; SOULLIER, S.; GAYARD, N.; et al.; Ischemic postconditioning

Modified Renal Oxidative Stress and Lipid Peroxidation caused by Ischemic

Reperfusion Injury in Rats. Transplant Proc v. 39, p. 2554, 2007.

10. LIU, X.; CHEN, H.; ZHAN, B.; XING, B.; ZHOU, J.; ZHU, H.; CHEN, Z.; Attenuation of

reperfusion injury by renal ischemic postconditioning: the role of NO. Biochem Biophys Res Commun. V. 359, p.628, 2007.

11. YUN, Y.; DUAN, W.G.; CHEN, P.; et al.; Down-regulation of

cyclooxygenase-2 is involved in ischemic postconditioning protection against

renal ischemia reperfusion injury in rats. Transplant Proc. v. 41, p. 3585, 2009.

12. MATSUYAMA, M.; YOSHIMURA, R.; HASE, T.; KAWAHITO, Y.; SANO, H.;

NAKATANI, T.; Study of cyclooxygenase-2 in renal ischemia-reperfusion

injury. Transplant Proc. v. 37, p. 370-372, 2005.

13. CATY M.G., GUICE K.S., OLDHAM K.T.; et al. Evidence for tumor necrosis

factor-induced pulmonary microvascular injury after intestinal ischemia-

reperfusion injury. Ann. Surg. v. 212, p. 694–700, 1990.

14. TAKADA, M.; NADEAU, K.C.; SHAW, G.D.; MARQUETTE, K.A.; TILNEY,

N.L.; The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of

the rat kidney. Inhibition by a soluble P-selectin ligand. J. Clin. Invest. V. 99, p.

2682–2690, 1997.

15. DONNAHOO, K.K.; MENG, X.; AYALA, A.; CAIN, M.P.; HARKEN A.H.;

MELDRUM; D.R.; Early kidney TNF-alpha expression mediates neutrophil

infiltration and injury after renal ischemiareperfusion. Am. J. Physiol. v. 277, p.

R922–R929. 1999a.

16. DONNAHOO, K.K.; SHAMES, B.D.; HARKEN, A.H.; MELDRUM, D.R.;

Review article: the role of tumor necrosis factor in renal ischemia-reperfusion

injury. J. Urol. v. 162, p. 196–203, 1999b.

17. ROUMEN, R.M.; HENDRIKS, T.; VAN DER VEN-JONGEKRIJG, J.; et al.

Cytokine patterns in patients after major vascular surgery, hemorrhagic shock,

62

and severe blunt trauma. Relation with subsequent adult respiratory distress

syndrome and multiple organ failure. Ann. Surg. v. 218, p. 769–776, 1993.

18. GUO, W.; DING, J.; HUANG, Q.; JERRELLS, T.; DEITCH, E.A.; Alterations

in intestinal bacterial flora modulate the systemic cytokine response to

hemorrhagic shock. Am. J. Physiol. V. 269, p. 827–832, 1995.

19. JIANG, J.; TIAN, K.; DIAO, Y.; CHEN, H.; ZHU, P.; WANG, Z.; Expression

of TNF alpha, IL-1 beta, IL-6 mRNA, release of TNF alpha in vital organs and

their relationship with endotoxin translocation following hemorrhagic shock.

Chin. Med. Sci. J. v. 12, p. 41-6, 1997.

20. DINARELLO, C.A.; CANNON, J.G.; WOLFF, S.M.; et al. Tumor necrosis

factor (cachectin) is an endogenous pyrogen and induces production of

interleukin 1. J. Exp. Med. v. 163, p. 1433–1450, 1986.

21. SUITTERS, A.J.; FOULKES, R.; OPAL, S.M.; et al. (1994) Differential effect

of isotype on efficacy of anti-tumor necrosis factor alpha chimeric antibodies in

experimental septic shock. J. Exp. Med. v. 179, p. 849–856, 1994.

22. HONMURA, A.; ISHII, A.; YANASE, M.; OBATA, J.; HARUKI E.; Analgesic

effect of Ga-Al-As diode laser irradiation on hyperalgesia in carrageenin-

induced inflammation. Lasers Surg Med. v. 13(4), p. 463-9, 1993.

23. SCHINDL, A.; SCHINDL, M.; PERNERSTORFER-SCHO, N.H.; SCHINDL,

L. Low-intensity laser therapy: a review. J Invest Med. v. 48(5), p. 312–326,

2000.

24. KARU, T.I.; Photobiological fundamentals of low power laser therapy. IEEE J Quant Electron. v. 23, p. 1703–1717, 1987.

25. CHOW, R.T.; JOHNSON, M.I.; LOPES-MARTINS, R.A.B.; BJORDAL, J.M.;

Efficacy of low-level laser therapy in the management of neck pain: a

systematic review and meta-analysis of randomized placebo or active-treatment

controlled trials. Lancet v. 374, p.1897–1908, 2009.

63

26. LOPES-MARTINS, R.A.B.; ALBERTINI, R.; LEONARDO, P.S.L.M.; et al.

Steroid-receptor antagonism inhibits the anti-inflammatory effects of low-level

laser therapy. Photomed. Laser Surg. v. 24, p. 197-201, 2007.

27. PALLOTTA, R.C.; BJORDAL, J.M.; FRIGO, L.; LEAL-JUNIOR, E.C.P.;

TEIXEIRA, S.; MARCOS, RL.; RAMOS, L.; MESSIAS, F.D.M.; LOPES-

MARTINS, R.A.B.; Infrared (810-nm) low-level laser therapy on rat experimental

knee inflammation. Lasers in Medical Science. v. 77. p. 21-8, 2011.

28. MARCOS, R.L.; LEAL-JUNIOR, E.C.P.; MESSIAS, F.D.M.; CARVALHO,

M.H.C.; PALLOTTA, R.C.; FRIGO, L.; DOS SANTOS, R.A.; RAMOS, L.; TEIXEIRA,

S.A.; BJORDAL, J.M.; LOPES‐MARTINS, R.A.B.; Infrared (810 nm) low-level laser

therapy in rat Achilles tendinitis: A consistent alternative to drugs. Photochem & Photobiol. v. 87, p. 1447-52, 2011.

29. AIMBIRE, F.; ALBERTINI, R.; PACHECO, M.T.; CASTRO‐FARIA‐NETO, H.C.;

LEONARDO, P.S.; IVERSEN, V.V.; LOPES‐MARTINS, R.A.B.; BJORDAL, J.M.; Low level

laser therapy induces dose-dependent reduction of TNF-α levels in acute

inflammation. Photomed. Laser Surg. v. 24(1),p. 33-7. 2006

30. AIMBIRE, F., BJORDAL J.M., IVERSON V.V.; Low level laser therapy

partially restores trachea muscle relaxation response in rats with tumor necrosis

factor alpha-mediated smooth airway muscle dysfunction. Lasers Surg. Med. v.

38, p. 773–778, 2006.

31. AIMBIRE, F., ALBERTINE, R., MAGALHÃES, R.G., et al. Effect of LLLT

Ga-Al-As (685 nm) on LPS-induced inflammation of the airway and lung in the

rat. Lasers Med. Sci. v. 20, p. 11–20, 2005.

32. MARCOS, R.L.; LEAL‐JUNIOR, E.C.; ARNOLD, G.; MAGNENET, V.; RAHOUADJ,

R.; WANG, X.; DEMEURIE, F.; MAGDALOU, J.; DE CARVALHO, M.H.; LOPES‐MARTINS,

R.A.B.; Low-level laser therapy in collagenase-induced achilles tendinitis in rats:

Analyses of biochemical and biomechanical aspects. Journal of Orthopaedic Research. v. 30, p. 1945-51, 2012

64

33. JOENSEN, J.; DEMMINK, J.H.; JOHNSON, M.I.; IVERSEN, V.; LOPES-

MARTINS, R.A.B.; BJORDAL, J.M.; The Thermal Effects of Therapeutic Lasers

with 810 and 904 nm Wavelengths on Human Skin. Photomedicine and Laser Surgery. v. 29(3), p. 145-153, 2011.

34. FRIGO, L.; FÁVERO, G.M.; CAMPOS-LIMA, H.J.; MARIA, D.A.; BJORDAL,

J.M.; JOENSEN, J.; IVERSEN, V.; LABAT, M.R.; PARIZZOTO, N.A.; LOPES-

MARTINS, R.A.B.; Low-Level Laser Irradiation (InGaAlP-660 nm) Increases

Fibroblast Cell Proliferation and Reduces Cell Death in a Dose-Dependent

Manner. Photomedicine and Laser Surgery. v. 28(S1) p. S-151-S-156, 2010.

35. FRIGO, L.; FÁVERO, G.M.; LIMA H.J.; MARIA, D.A.; BJORDAL, J.M.; JOENSEN,

J.; IVERSEN, V.V.; MARCOS, R.L.; PARIZZOTO, N.A.; LOPES‐MARTINS, R.A.B.; Low-

Level Laser Irradiation (InGaAlP-660 nm) Increases Fibroblast Cell Proliferation

and Reduces Cell Death in a Dose-Dependent Manner. Photomedicine and Laser Surgery. v. 1, p. S1 51-6, 2010.

36. LEAL-JUNIOR, E.C.; LOPES-MARTINS, R.A.; GODOI, V.; MANCALOSSI,

J.L.; ROSSI, R.P.; DE MARCHI, T.; PARENTE, M.; GROSSELLI, D.;

GENEROSI, R.A.; BASSO, M.; FRIGO, L.; BJORDAL, J.M.; Comparison

between cold water immersion therapy (CWIT) and light emitting diode therapy

(LEDT) in short-term skeletal muscle recovery after high-intensity exercise in

athletes—preliminary results. Lasers Med Sci. v. 26, p. 419–424, 2010.

37. LEAL-JUNIOR, E.C.; LOPES-MARTINS, R.A.; DALAN, F.; FERRARI, M.;

SBABO, F.M.; GENEROSI, R.A.; BARONI, B.M.; PENNA, S.C.; IVERSEN,

V.V.; BJORDAL, J.M.; Effect of 655-nm low level laser therapy on

exerciseinduced skeletal muscle fatigue in humans. Photomed Laser Surg. v.

26, p. 419–424, 2008.

38. BJORDAL, J.M.; LOPES-MARTINS, R.A.B.; JOENSEN, J.; COUPPE, C.;

LJUNGGREN, A.E.; STERGIOULAS, A.; JOHNSON, M.I.; A systematic review

with procedural assessments and meta-analysis of low level laser therapy in

lateral elbow tendinopathy (tennis elbow). BMC Musculoskelet Disord v. 9,

p.75, 2008.

65

7 – APÊNDICES

Artigo 1

Lasers Med Sci (2012) 27:71–78 DOI 10.1007/s10103-011-0906-1

ORIGINAL ARTICLE

Infrared (810-nm) low-level laser therapy on rat experimental knee inflammation

Rodney Capp Pallotta & Jan Magnus Bjordal & Lúcio Frigo &�Ernesto Cesar Pinto Leal Junior & Simone Teixeira & Rodrigo Labat Marcos & Luciano Ramos & Felipe de Moura Messias & Rodrigo Álvaro Brandão Lopes-Martins

Received: 3 November 2010 / Accepted: 22 February 2011 / Published online: 12 April 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com

Abstract Arthritis of the knee is the most common type of joint inflammatory disorder and it is associated with pain and inflammation of the joint capsule. Few studies address the effects of the 810-nm laser in such conditions. Here we investigated the effects of low-level laser therapy (LLLT; infrared, 810-nm) in experimentally induced rat knee inflammation. Thirty male Wistar rats (230–250 g) were anesthetized and injected with carrageenan by an intra- articular route. After 6 and 12 h, all animals were killed by

Financial support FAPESP Grants 2005/02117-6

R. C. Pallotta : S. Teixeira : R. L. Marcos : L. Ramos :�R. Á. B. Lopes-Martins�Laboratory of Pharmacology and Experimental Therapeutics, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo,

São Paulo, SP, Brazil 05508–900

J. M. Bjordal�Section of Evidence Based Research, Bergen University College, Bergen, Norway

L. Frigo�Biological Sciences and Health Center, Cruzeiro do Sul University,�São Paulo, SP, Brazil 08060–070

E. C. P. Leal Junior : F. de Moura Messias : R. Á. B. Lopes-Martins�Post Graduate Program in Rehabilitation Sciences - Nove de Julho University,

São Paulo, SP, Brazil

R. Á. B. Lopes-Martins (*)�Laboratory of Pharmacology and Phototherapy of Inflammation, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo,�Av. Prof. Lineu Prestes, 1524, Butantan,�São Paulo, SP, Brazil 05508–900�e-mail:

rmart

CO2analyordeinhibwithcounsite. enerby laoperincreinveenzy

Keyw

Arthpopupainand parc

Althagenimpo

72

Laser

Increinflachoninteroxygpros5].

IL-1signiincretype

IL-1

[email protected]

inhalationysis. Articu

er to evaluabit the tota

h 1, 3, and 6nting showVascular e

rgy of 10 J.aser irradiarating at 81eased COXstigate the

ymes induc

words LLL

hritis is conulation, aff, reduced rfinancial cel is marke

hough arthrnts acting oortant role

rs Med Sci (2

easing evidammatory pndrocytes prleukin-1 (Igen speciestaglandins

and TNF-ificant leveeased expre II collagen

and TNF-

p.br

n and the arular tissue ate COX-1 l number o6 J (Joules)ing the redextravasati. Both COXation while10 nm markX-1 and 2 g

possible pced by laser

LT . Laser

nsidered onfecting diarrange of monsequencedly growin

ritis may beon the jointin the prog

2012) 27:71–

dence indicprocess at tproduce a wIL-1), IL-6s (ROS) anand leuko

-α are the mels in osteoessed on on synthesis

-α are also

rticular cavwas carefuand COX-

of leukocyt) of energy

duction of pon was sigX-1 and 2 g PGE2 prodkedly reducgene expresproduction r irradiatio

. Arthritis

ne of the mrthrodial joovement, c

ces of this ing [1–3].

e initiated bt, pro- inflagression of

–78

cates that cthe molecuwide range6, IL-8, IL-nd lipid-der- trienes, in

most extensoar- thritis steoarthritis and suppr

important

vity was waully remov-2 expressites, as welly. This resupolymorphgnificantly gene expreduction waced inflamssion. Furtof antiinfla

on in knee i

. Inflamma

major causesoints. Clinicrepitus, teillness tend

by impact ammatory ef the diseas

cartilage deular level. Ae of cytokin-17, and ILrived medincreases ch

sive studiesynovial flis chondroress proteo

regulators

ashed for cved for realion. LLLT l as the myult was corhonuclear cinhibited a

ession wereas inhibited

mmatory sigher studiesammatory inflammati

ation . Kne

s of chronical sympto

enderness, ad to be high

loading aneicosanoidse [4, 5].

egenerationActivated ines and che

L-18, etc. Iniators produhondrocyte

d metaboliluid and typcyte. It is c

oglycan syn

of metal- l

cellular and-time PCRwas able toeloperoxidroborated b

cells at the at the highee significand. Low-levegns of inflas are necessmediators ion.

ee Introduc

ic disabilityoms are chaand inflamher as this p

nd other meds and cytok

n results froinflammatoemokines, n addition, ucts, such ae catabolic

ites. IL-1 ispe I IL-1 rcapable of nthesis [4,

loproteinas

d biochemiR analysis into significadase activitby cell inflammater dose of ntly enhancel laser the

ammation bsary to by COX

ction

y in the eldaracterized

mmation. Sopopulation

echanical kines play

om ory cells ansuch as reactive as activity [2

s found in receptor is suppressin5].

se (MMP)

66

ical n

antly ty

tory

ced erapy but

derly d by ocial n

an

nd

2, 4,

ng

gene

67

expression and protein synthesis in osteoarthritis [5–7]. Additionally, TNF-α is also found in synovial fluid and its receptor TFR1 is up-regulated in osteoarthritis. The production of prostanoids such as leukotriens and prostaglandins is also specially involved in osteoarthritis-related pain and disability [8].

Arthritis therapies are based on relieving pain, improving the range of motion, and promoting partial tissue regeneration. Current therapeutic strategies include surgical procedures and pharmacological and non-pharmacological management. Surgical procedures are only considered after more conservative therapies have failed, and it includes osteotomy, arthroscopy management, grafting, arthrodesis, and arthroplasty. Besides analgesics (opiate and non-opioid) and chondroitin, glucosamine, sodium hyaluronate com- pounds, the anti-inflammatory drugs (corticosteroids and non-steroidal) are the most widely used drugs, despite that a panel of experts has ranked oral non-steroidal anti- inflammatory drugs (NSAIDs) as the most toxic therapy in knee osteoarthritis, followed by corticosteroid injections, paracetamol, topical NSAIDs, chondroitin, and glucosamine sulphate [3, 9].

The search for less toxic non-pharmacological alter- natives agents in arthritis management suffers from lack of interest and funding, but low-level laser therapy (LLLT) is about to be taken more seriously by clinicians. We recently demonstrated that LLLT is effective in reducing non-specific neck pain [10, 11] and is beginning to be considered a potential alternative to drugs.

The bulk of new and increasing evidence shows that LLLT is no longer a mythical alternative therapy with diffuse and hypothetical mechanisms of biological action, but a therapy that has distinct biophysical properties and dose-dependent biological mechanisms of action [12].

Several animal and human trials have been performed that show the modulatory effect of laser radiation on

inflammatory markers (PGE2, TNF-α, IL-1β, plasminogen activator) and on the inflammatory process itself (reducing edema, hemorrhagic formation, necrosis, neutrophils influx) [12, 13].

In this perspective, the present study was designed to investigate the effect of low-level laser therapy on edema formation, leucocyte influx, myeloperoxidase activity, COX-1 and COX-2 gene expression, residues, IL-1 and PGE2 quantification in rat-induced knee inflammation in rats. In other words, our main hypothesis is that LLLT can act as an effective therapeutic alternative to treat joint inflammatory conditions.

Materials and methods

Animals

All eCom

Maleprocprotostimudiscoat di

Proc

Indu

Animmg/kInitiain stsyrinligam

Expe

Eachfollo

& C

& Dwith

Laser

73

experimentmmittee of t

e Wistar racedure. Fooocol. Rats uli injectioomfort andifferent tim

cedures

uction of ac

mals were kg) and xyally 100 μlerile salinenge (300 μlment, perfo

erimental g

h group waows:

ontrol grou

iclofenac gh sodium di

rs Med Sci (2

&inflamm

&inflamm

&�inflam

&�inflamlevel las

tal proceduthe Univer

ats (250 g) od and watewere anest

on. All pre-d to avoid a

mes.

cute arthrit

anesthetizelazine (0.5l of kaolin e solution (l). The bevorming the

groups

as compose

up – The an

group - Theiclofenac (

2012) 27:71–

& 1.0 J gromation and

& 3.0 J gromation and

& 6.0 J grommation an

& 10.0 J grmmation anser therapy

ures were srsity of São

were houser were prothetized wi-operative pany infectio

is

ed with an mg/kg), an(3%, Sigm

(NaCl, 0.9%vel of the n

puncture t

ed of five a

nimals rece

e animals r1 mg/kg; I

–78

oup – The aafter 1 h re

oup – The aafter 1 h re

oup – The and after 1 h

roup – Thend after 1 hy procedure

submitted ao Paulo.

sed five perovided ad lith inhalatoproce- duron. The an

intraperitoand trichotoma-Aldrich)%) was inj

needle was towards the

animals ran

eived kaoli

received kaIM, 30 min

animals receceived las

animals receceived las

animals rech received l

e animals reh received le �LLLT w

and approv

r cage befolibitum throry halothares were penimals were

oneal injectomized at t) plus carraected into positionede joint surf

ndomly div

in + carrag

aolin + carn prior infla

ceived the ser irradiati

ceived the ser irradiati

ceived the laser irradia

eceived thelaser irradiawas perform

ved by the E

ore the expeoughout th

ane to allowerformed toe killed by

tion of ketathe region oageenan (3the joint us

d medially tface of the

vided into s

geenan.

rageenan aammatory s

induction oion - 1.0 J.

induction oion - �3.0

induction oation - �6.

e inductionation - 10.0med 1 h aft

Ethical

erimental he experimw inflammao prevent CO2 inhala

amine (52 of the left s%) dissolvsing a micrto the patefemur.

six groups

and pre-trestimulus).

of .

of J.

of .0 J.

n of 0 J. �Lowfter carrage

68

mental atory

ation

side. ved ro

ellar

as

ated

-eenan

69

+ kaolin injection using an infrared laser unit (DMC, São Carlos, Brazil). The laser unit emitted a continuous optical output of 100 mW with a wavelength of 810 nm and a spot size area of 0.028 cm2, which gave a power density of 5 W/cm2. The optical output of the laser unit was measured before, halfway through, and after the experiment. Laser irradiation was performed in skin contact at the site of injection with doses of 1, 3, 6, and 10 J with corresponding irradiation times of 10, 30, 60, and 100 s, and energy densities of 50, 150, 300, and 500 J/cm2, respectively. �Cellular, biochemical, and molecular analysis �All analyses were performed by an observer who was blinded to group allocation. Initial analysis was performed at Section of Pharmacology, ICB at University of São Paulo, Brazil. To ensure consistency in analyses and reproducibility of results, two other laboratories at Univer- sity of São Paulo, Brazil, duplicated the analyses. �Joint cavity wash �The joint wash was obtained by injection and aspiration of final volume of 300 μl (3 × 100 μl) of solution PBS + EDTA (4 μM) (Ultrafine 29 G, BD). The joint washings were transferred to Eppendorf tubes and stored at −80°C until the time of biochemical test. �The total number of cells counting was performed taking 20 μl from lavage fluid diluted in Turkey liquid (380 μl). A Neubauer chamber was used under an optical microscope (Carl Zeiss) with 40× amplification. The results were expressed as a total number of leucocytes per cavity. For differential leukocyte cell counts (mononuclear and neutrophil cells), we used the same microscope with a higher (100×) amplification. For the leukocyte differential cell counting, 100-ml aliquots from cells suspension were used

Vascular permeability - Evans Blue dye

An Evans Blue dye (25 mg/ml; Merck) was dissolved in saline solution and then filtered in a sterilized membrane (0.22 m; Millipore) and conserved in at 4°C.

Animals were previously anesthetized with halothane and then injected intra-articularly with the Evans Blue dye, 1 h before euthanasia. The animals were killed by halothane super dose. After the killing, the joint was washed and exudate recovered in a glass tube in formamide solution (Merck article 9684,1000, 4 ml/g) for dye extraction. A 150-μl sample from each tube was used for determination of Evans Blue concentrations (BIOTEK Spectrophotometer 618–620 nm).

Myeloperoxidase activity (MPO)

In order to determine MPO levels, 50 μl of exudate was added to 200 μl of potassium phosphate buffer (pH 6.0), containing 0.164 mg/ml of o-dianisidine dihydrochloride (Sigma Chemical Co., St. Louis, MO, USA) and 0.0005% of hydrogen peroxide (Merck, Darmstadt, Alemanha). The absorbance was measured in an ELISA scanner (Espectra max plus 384, Sunnyvale, CA, USA) at 460 nm for 20 min, with recordings made at 20-s intervals. Graphs showing the

absocalcuabsoor abclosecalcuhomthe dof Hthe atissuwere

RNA

At thnitroacco

DNaintegwas

for c

time

s,

74

Laser

usingdurintranscontampoligoreverAGABetaAAGCGG

The 30 cy

orbance varulated from

orbance varbsorbance)er to 1), obulated and

mogenate codegradation

H2O2 per miactivity of Mue (mg) adde performe

A isolation

he selectedogen, and sording to th

ase I was emgrity of RNused for fi

centrifugati

e = 18

rs Med Sci (2

g SuperScrng this proscribed (i.etaminants. Dlification uonucleotiderse: CCTC

ATCAGAAa-actin wasGATTTGGGTGAGCA

conditionsycles of 95

riation as am these grariation show) as a functbtaining thedivided by

orrespond tn in microminute correMPO was ded to the ad by Stude

and real-ti

d time-poinstored at −8he manufac

mployed toNA was verirst-strand c

ion (2,000

2012) 27:71–

ript II. In acess. Three

e., reverse tDiluted RTusing Platines for COX

CACCAGTAGCGAGGs used as anGCACCACAGCACAG

s for PCR w5°C, 15 s; 6

a function oaphs. The tiwed linearion of timee value Vmy the amouto 0.5 mg omol (μmol)sponds to aexpressed assay (U/ment’s t test,

ime PCR a

nts, the join80°C. Totacturer’s ins

o digest DNrified by agcDNA syn

rpm, T = 4

–78

addition, RNe pooled RtranscriptaT samples (num Sybr QX-1 (forwarTCATTCCCGACCTG;n internal cCACTTTCGGGT).

were as fol60°C, 1 mi

of time werime intervarity was choe in second

max/sec. Thunt of tissueof tissue). T) of H2O2 pa variationin MPO un

mg). Statistusing a sig

analysis

nt tissues wal RNA wastructions.

NA to obtagarose gel nthesis [rev

400 s, rise

NaseOUTRNA aliquose omitted(1:10) werQPCR Sup

ard: CCGTGCTGT) an; reverse: Ccontrol (for

C TACA; re

llows: 50°Cin, and 72°

re obtainedal where thosen from ds (correspohe mean ofe in each pThe MPO aper minute.n of 0.0113nits and coical analysgnificance

were dissects isolated i

ain RNA puelectropho

verse transc

stop time=

was also aots were ro) to ensure

re submittepermix-UDGCGAGTAd COX-2 (

CCATCCTrward: everse:

C, 2 min; 9C, 15 s. Ct

d and the Vhe measurethe graph (onding to tf the dupliclate well (eactivity un. ConsideriAU (absor

orrected by ses of the Mlevel of 0.0

ted, frozenin the Trizo

urification oresis. Totacriptase (RT

=11 s).

added to prutinely sha

e the absencd to real-ti

DG and specACAGTCA(forward: TG GAAAA

95°C, 2 mint values we

Vmax/sec wements of (optical dethe value ocates was each 10 μl

nit is defineing that 1 μrbance uni

y the amounMPO levels05%.

n in liquid ol reagent,

and the al RNA (2 T)]

rotect the Ram reversece of DNAime PCR cific ACAT;

AGTCGAA

n, followedere recorde

70

was

ensity of r2

of ed as μmol its), nt of s

μg)

RNA

A

AG).

d by ed for

71

each gene, the results of genes of interest were normalized to results obtained with the internal control gene. ddCT were calculated and the results are expressed as fold increase. All oligonucleotides and reagents utilized in this protocol were purchased from Invitrogen Co., USA.

PGE2 and cytokines analysis

PGE2 and cytokines generation were analyzed and determined according to the manufacturer’s instructions by ELISA (R & D Systems, Minneapolis, MN, USA).

Outcomes

The following outcomes were analyzed in this study: leukocyte, neutrophils, and mononuclear cells counting; myeloperoxidase activity; vascular permeability; IL-1, IL-6, and PGE2 (ELISA); and gene expression of COX-1 and COX-2 (real-time PCR analysis, from joint tissue and joint fluid).

Statistical analysis

A blinded observer unaware of the allocation to groups performed the statistical analysis. Data are expressed as mean and standard error (±) of the mean (SEM). All data were statistically evaluated by analysis of variance (ANOVA), followed by the Newman-Keuls-Student’s test. Values with p<0.05 were considered to be statistically significant.

Results

Inflammatory cell accumulation

Three hours after induction of inflammation we could observe that both LLLT (1.0 and 3.0 J) as well as diclofenac

significantly reduced the total number of leukocytes (Fig. 1a). After six hours, LLLT at the energy doses of 6.0 and 10.0 J significantly reduced the total number of leukocytes in the knee joint (Fig. 1b).

Regarding the neutrophils, one more time we could observe that both the diclofenac and LLLT groups treated with 3.0, 6.0, and 10.0 J significantly reduced (p < 0.001) the cell accumulation (Fig. 2a).

The number of mononuclear cells was significantly higher in all treated groups when compared to control (Fig. 2b).

Evans Blue dye extravasation

Figure 3a shows the amount of Evans Blue dye extravasation 6 h after induction of inflammation. Only the diclofenac and 10.0 J LLLT groups were effective in reducing Evans Blue extravasation (p < 0.05).

Mye

ThreJ andothe

Fig. 1leukoper grh in tgrouparthriJ); thSEM

Laser

75

eloperoxida

ee hours aftd 10.0 J dor laser

1 Analysis ofocytes in articroup (*p<0.0the control grp treated withitis group tree arthritis gr)

rs Med Sci (2

ase activity

fter the induoses signifi

f articular wacular lavage 05) (**p<0.0roup and afteh diclofenac

eated with 3 Jroup treated w

2012) 27:71–

y (MPO)

uction of incantly inhi

ash 3 and 6 hfluid after 3

001). b Total er LLLT (n=(Diclof); the

J LLLT (AT+with 10 J LL

–78

nflammatioibited the M

h after induc h in the con number of l

=6 animals pee arthritis gro+3 J); the art

LLT (AT + 10

on, the eneMPO activi

ed inflammantrol group anleukocytes iner group arthoup treated wthritis group 0 J). Results

ergy doses oity. Interes

ation. a Totalnd after LLLn articular lavhritis group (Awith 1 J LLL

treated withare expresse

of laser of stingly, the

l number of LT (n=6 animvage fluid afAT); the arth

LT (AT+ 1 J)h 6 J LLLT (Aed as mean (

72

f 6.0

mals fter 6 hritis ; the AT+6 ±

Fig. 2the co6 h afArthr1 J LL

2 a The numbontrol group fter induced ritis group (ALLT (AT+1

ber of neutroand after LLinflammatio

AT); arthritisJ); arthritis g

ophils in the LLT. b The non in the cont group treategroup treated

articular wasnumber of mtrol group aned with diclod with 3 J LL

sh fluid 6 h aononuclear c

nd after LLLTofenac (DicloLLT (AT+3 J

after inducedcells in the arT (n = 6 anim

of); arthritis gJ); arthritis g

d inflammatiorticular washmals per grougroup treated

group treated

73

on in h fluid up). d with with

6 J LLmean

enerof M

On tgrouthe c

COX

Figurespe3.0 aexprjust pdiclo

COX

The fluidhand

a The

Fig. 3inflaminduc(AT)(AT+(AT+mean

obseexpr

Cyto

Interener6a)

Interdiclo10.0

76

LLT (AT+6 n±SEM (**p

rgies as weMPO activit

the other haups were abcontrol gro

X-1 and CO

ure 4a and bectively, inand 10.0 J pression whepresented sofenac grou

X-1 and CO

energy dosd when comd, we could

e protein extr

3�6 h after immation in tced inflamma; arthritis gro

+1 J); arthriti+6 J); arthritin±SEM

erve any diression. Th

okines

rleukin-1 Wrgy doses) p

rleukin-6 Tofenac as w J when co

J); arthritis g< 0.001)

ll as the dity (Fig. 3b)

and, 6 h aftble to produup (Fig. 3c

OX-2 gene

b shows thn joint tissupresented aen comparesignificantups.

OX-2 gene

se of 3.0 J mpared to td not

ravasation as

induced inflathe control anation in contoup treated wis group treatis group treat

fference behese results

We observepresented a

The levels owell as in Lompared to

group treated

clofenac tr).

fter the induuce a signic).

expression

he RNA expue. We obsa significaned to the coincrease in

expression

significantthe control

s an indicator

ammation. b nd treated grrol and treate

with diclofented with 3 J Lted with 10 J

etween all can be vis

ed that dicla significan

of IL-6 in jLLLT group the contro

d with 10 J L

reatment di

uction of inificant inhi

n in joint ti

pression ofserved that nt increaseontrol and n COX-2 e

n in joint fl

tly increaseand other

r of vascular

The activity roups. c Theed groups (*

nac (Diclof); LLLT (AT+3J LLLT (AT+

the tested sualized res

lofenac andnt inhibitio

joint fluid wps (1.0, 3.0

ol group (F

LLLT (AT+1

id not pres

nflamma- tibition of M

issue

f COX-1 anthe groups

e of COX-1diclofenac

expression

fluid

ed the COXexperimen

r permeability

of myeloperactivity of m p<0.05) (**arthritis grou3 J); arthritis+10 J). Resu

groups regspectively

d LLLT groon of IL-1 l

were signi0, and 6.0 J

Fig. 6b).

0 J). Results

ent signific

tion, all expMPO when

nd COX-2 s treated w1 and COXc groups. Tcompared

X-1 expresntal groups

y

roxidase 3 h myeloperoxid**p<0.001). Aup treated wis group treatelts are expres

garding to Cin Fig. 5a

oups (1.0 Jlevels in jo

ficantly redJ of energy

s are express

cant inhibi

perimentaln compared

enzymes, with LLLT wX-2 RNA The 6.0 J gr

to control

ssion in join. On the ot

after inducedase 6 h afterArthritis groith 1 J LLLTed with 6 J Lssed as

COX-2 and b.

J and 6.0 J oint fluid (F

duced in y) but not w

74

ed as

tion

l d do

with

roup and

nt ther

d r up

T LLLT

of Fig.

with

Laser

Fig. 4b Theanima(Dicl(AT+LLLT

rs Med Sci (2

4 a The RNAe RNA expreals per groupof); arthritis

+3 J); arthritiT (AT+10 J)

2012) 27:71–

A expression ession of COp (*p<0.01). group treate

is group treat. Results are

–78

of COX-1 enOX-2 enzyme

Arthritis groed with 1 J LLted with 6 J Lexpressed a

nzyme mease measured boup (AT); artLLT (AT+1 LLLT (AT+6

as mean±SEM

sured by realby real-time Pthritis group J); arthritis g

6 J); arthritisM

- time PCR iPCR in joint treated with

group treateds group treate

in joint cartilcartilage (n=

h diclofenac d with 3 J LLed with 10 J

75

lage. =6

LLT

Fig. 5COXanimaarthriarthriJ). Re

Fig.6meas(**p<with with with

Prospresegrou

Disc

Kneebiochof arthe tcorrochem

Laser

77

In ad(TNF

5 a The COXX-2 RNA exp

als per groupitis group treitis group treesults are exp

6 aIL-1levelsaured by ELI<0.01) (***pdiclofenac (D3 J LLLT (A10 J LLLT (

staglandin Eented a sig

up (Fig. 6c)

cussion

e arthritis ihemical, anrthritis. In ototal numbeoborated bmical mark

rs Med Sci (2

ddition, proF)-α, and p

X-1 RNA exppression measp. Arthritis geated with 1 Jeated with 6 Jpressed as m

atarticularwaSA. c PGE2

p <0.001) (n=Diclof); arthr

AT+3 J); arthAT+10 J). R

E2 The diclgnificant de).

is a complend physicaour study, er of leukoy the inhib

ker of neutr

2012) 27:71–

oinflammaprostagland

pression measured by real

group (AT); aJ LLLT (AT+J LLLT (AT+

mean±SEM

ashfluidmeaslevels at artic=6 animals pritis group tr

hritis group trResults are ex

lofenac andecrease of P

ex problemal causes. Llaser irradi

ocytes as wbition of myrophil infilt

–78

atory mediadins, are al

asured by real- time PCR arthritis grou+1 J); arthrit+ 6 J); arthri

suredbyELIScular wash f

per group). Areated with 1reated with 6xpressed as m

d laser-treaPGE2 level

m with a nuLeukocyte iation was

well as neutyeloperoxitration.

ators, inclul over-prod

al-time PCR at articular w

up treated wittis group treaitis group tre

SA.bIL- 6 levfluid measure

Arthritis group J LLLT (AT

6 J LLLT (ATmean±SEM

ated groupsls when com

umber of uninfiltrationsignificant

trophils in jidase activi

uding IL-1, duced in ch

at articular wwash fluid (*th diclofenacated with 3 J ated with 10

vels at articued by ELISAp (AT); arthrT+1 J); arthriT+6 J); arthr

s (3.0, 6.0, mpared to

nderlying cn to the jointly effectivjoint cavityity that rep

tumor nechondrocyte

wash fluid. b*p < 0.01) (n c (Diclof); J LLLT (AT+0 J LLLT (AT

ular wash fluiA (*p<0.05) ritis group trritis group treritis group tre

and 10.0 Jthe contro

cellular, nt is a hallmve in reducy. This factpresents a

crosis factoes in

76

The = 6

+3 J); T+10

id

eated eated eated

J) l

mark ing t was

or

77

pathological conditions and contribute to amplify the inflammatory process of the joint [13]. Cartilage extracellular matrix degradation and suppression of extracellular matrix biosynthesis are regulated by a significant increase in the levels of cytokines in the affected synovial joint [5].

IL-1 was originally detected in OA synovium [14, 15]. Only minimal IL-1 concentrations, particularly in its active form, were found in normal synovial fluid [4]. IL-1 was not detected in plasma even in patients with OA with prominent synovial fluid IL-1 levels, suggesting that IL-1 most likely acts locally and alters cartilage metabolism in OA synovial joints [16]. In our model of acute knee inflammation we could observe that LLLT was able to significantly reduce the concentration of IL-1β in joint wash fluid. These results are important, since IL-1 is implicated in cartilage degradation.

IL-6 was detected in patients with rheumatoid arthritis as well as in patients with osteoarthritis [5]. Some studies showed that IL-6 augmented MMP production while also inhibiting proteoglycan synthesis, increasing cartilage destruction [17]. From this point of view, LLLT was significantly effective in reducing IL-6 in joint wash fluid in our experimental model of joint inflammation which can indicate an effective reduction of joint cartilage degradation. We agree with the definition given by Brandt et al. [18] that OA as a joint inflammatory disorder is best defined as failed repair of damage that has been caused by excessive stress. In these cases, the innate mechanism of repairing the damage is not able to regenerate the cartilage. In fact, there is equilibrium between cell proliferation and death in healthy tissue. During joint diseases such as osteoarthritis, there will be a higher index of cell death, leading to cartilage and bone destruction and disability. IL-6 is also a key cytokine in this process by the stimulation of metalloproteinases.

Interestingly, COX-1 and COX-2 gene expression presented a tendency of increase in joint fluid after laser irradiation and a significant increase in joint cartilage after laser irradiation (Figs. 4, 5). However, PGE2 levels measured in joint wash fluid were inhibited. COX-2 was originally appointed as a target for anti- inflammatory drugs. Suppression of the activity of this enzyme reduces edema formation and hyperalgesia. However, COX-2 is also a major contributor to the processes that leads to resolution of inflammation (for a review, see [18]). According to the author, injection of carrageenan into the rat paw produced edema formation with greatest increase in paw swelling typically seen 4–6 h after carrageenan administration. However, in wild-type mice, the swelling returned to its normal volume by 24– 48 h and in COX-2-deficient mice, the extent of paw

edema was similar to that in wild-type mice, but the paw swelling failed to resolve even 1 week later. These findings indicate that in fact, COX-2 should play a pivotal role in resolution of inflammation.

Sehan et al. [19] demonstrated that aspirin (ASA) is unique among current pharmacological therapies because it acetylates cyclooxygenase COX-2 enabling

the bmedenhainfiltinhibmodinfla

Ackn2005/

OpenNoncin any

Refe

1. BraAm 3

2. Mapatho

3. TopatienCartil

4. Howith

5. Jikprote

6. Ahmetal39(9)

7. Bainhib

8. BeElsonimmu49(5)

9. Bjoterm meta-

78

Laser

biosynthe- iators. Our

anced by latra- tion, mbited. Thes

dulate inflamammatory m

nowledgment/02117-6 and

n Access Thicommercial Ly medium, p

erences

andt KD, Di34:531–559

artel-Pelletieophysiology

owle CA, Hunts with ostelage 5:293–3

olt I, Cooper disease activ

kko A, Wakisoglycan met

hrens D, Koclloproteinase):1576–1587

aker EA, Stepitors in huma

ensouyad A, n CJ (1990) Cunological an):301–307

ordal JM, Joefficacy of p- analysis of

rs Med Sci (2

sis of R-cor results shaser irradiamyeloperoxse results lemmatory pmediators.

ts The authord CAPES for

s article is diLicense whicprovided the

eppe P, Radi

er J, Alaaeddof osteoarthr

ng HH, Boneoarthritis: a 300

RG, Dentonvity in arthrit

saka T, Iwamtabolism in a

ch AE, Pope e 9 (96-kd ge

phenson TJ, an breast can

Hollander AConcentrationd inflamma

hnson MI, Lphysical interf randomised

2012) 27:71–

ontaining pow that ev

ation, all othxidase activead us to suprocess and

rs would liker the scholar

istributed unch per- mits aoriginal auth

in EL (2008)

ine N, Pelletritis. Front B

assar LJ et apossible auto

n J et al (1992tis. Br J Rheu

moto M et al articular chon

RM, Stein-Pelatinase B) i

Reed MW, Bncer progress

AP, Dularay Bons of glycostory mediato

Lopes-Martinrven- tions inplacebo-con

–78

precursors ven when Cher inflammvity, IL-1, Iuggest thatd possibly s

e to thank FArship to Pallo

nder the termany noncommhor(s) and so

) Etiopathoge

tier JP (1999Biosci 4:D694

al (1997) Detocrine/paracr

2) Cytokine umatol 31:72

(1998) Effecndrocyte cult

Picarella M, Nin human rhe

Brown NJ (2sion and surv

B, Bedwell Asaminoglycanors in rheuma

ns RA, Bogenn osteoarthrintrolled trials

of endogenCOX-1 andmatory maIL-6, and st laser radiastimulating

APESP for thota R.

s of the Creamercial use, urce are cred

enesis of ost

) Cytokines 4–D703

tection of interine role in p

inter- relatio25–733

cts of interleutures. Cell Bi

Niedbala MJeumatoid arth

2002) Expresvival. Mol Pa

AE, Cooper Rns in synoviaatoid arthri-

n B, Chow Rtic knee pains. BMC Mus

nous antiinCOX-2 ex

arkers suchspecially Pation couldg the produ

he research g

ative Commodistribution,

dited.

eoarthritis. R

and their rol

erleukin-1 inpathogenesis.

nships and th

ukin-6 on priol Int 22:61

J (1996) Exprhritis. Arthrit

sion of proteathol 55(5):3

RA, Hutton Cal fluids and tis. Ann Rhe

R, Ljunggren n. A systematcu- loskelet

nflam- matoxpression wh as leukocyPGE2 were d be actinguction of an

grants

ons Attributi, and reprodu

Rheum Dis C

le in the

n the cartilag. Osteoarthri

heir associat

roliferation a5–621

pression of mitis Rheum

einases and 300–304

CW, Dieppe their relation

eum Dis

AE (2007) Satic review anDisord 22(8)

78

ory were yte

g to nti-

on uction

Clin N

ge of itis

tion

and

matrix

PA, n with

Short-nd ):51

10.

11.

12.

13.

14.

degen

Res T

S, Ev1 receOrtho

16. ItmetabRheu

17. Marthri52(3)

18. Winflaminflam

begin

Chow RTtherapy (L

Chow RTlaser therrandomis

Bjordal JPhotoradiclinical e24(2):158

Aimbire FNeto HC,partially ralpha-me

Goupille therapeut

neration: less

Ther 9(6):110

vans CH, Nixeptor antagoop Res 23(1)

to A, Itoh Y, bolism of co

um 35(10):11

Madhok R, Citis: correlati):232–234

Wallace JL (2mmation. Scimmation: the

nning program

T, Barnsley LLLLT) in the

T, Johnson Mrapy in the msed placebo o

M, Johnson iation in acuffects in rand8–168

F, Bjordal JM, Chavantes Mrestores trach

ediated smoo

P, Mullemantic interventi

sons from th

0�15. Haupt

xon AJ (2005nist protein c

):118–126

Sasaguri Y,nnective tiss

197–1201

rilly A, Watsions with clin

2006) COX-2i World J 6:5e

ms the end. N

L (2005) Syse managemen

MI, Lopes-Mamanagement oor active-trea

MI, Iversen te pain: a sysdomized plac

M, Iversen VMC, Labat Rhea muscle rth airway mu

n D, Chevalion in interve

e osteoarthri

t JL, Frisbie

5) Dual transcontrols cart

Morimatsu sue compone

son J, Capellnical and lab

2: a pivotal e577–588 19.

Nat Immuno

stematic revieent of neck pa

artins RAB, of neck pain:atment contro

V, Aimbire Fstematic revicebo-control

VV, AlbertiniRM, Lopes-Mrelaxation resuscle dysfun

ier X (2007) ertebral disc

itic experienc

DD, McIlwr

sduction of intilage degrad

M, Mori Y (ents in rheum

l HA (1993) boratory indic

enzyme in muSerhan CN,

ol 6(12):1191

ew of the liteain. Lasers S

Bjordal JM (: a systematiolled trials. L

F, Lopes-Maiew of possiblled trials. Ph

i R, Frigo L, Martins RA (sponse in rat

nction. Lasers

Is interleuki

ce. Arthritis

raith CW, Ro

nsulin-like grdation in an o

(1992) Effectmatoid synovi

Serum interlces of diseas

ucosal protecSavill J (200

1–1197

erature of lowSurg Med 37(

(2009) Efficac review and

Lancet 374(9

artins RA (20ble mechanishotomed Las

Pacheco MT2006) Low-l

ts with tumors Surg Med 3

n-1 a good ta

obbins PD, G

rowth factor-osteoarthritic

ts of interleuial fibroblast

leukin 6 levee activity. A

ction and res05) Resolutio

w-level laser(1):46–52

acy of low-led meta-analy9705):1897–1

006) sms of actionser Surg

T, Castro-Farlevel laser thr necrosis fac38(8):773–7

arget for

Ghivizzani

r-I and interle culture mod

ukin-6 on thets. Arthritis

els in rheumaAnn Rheum D

solution of on of

79

r

evel ysis of 1908

n and

ria-herapy ctor 78

eukin-del. J

e

atoid Dis

80

Artigo 2

Photochemistry and Photobiology, 2011, 87: 1447–1452

Infrared (810 nm) Low-level Laser Therapy in Rat Achilles Tendinitis: A Consistent Alternative to Drugs

Rodrigo Labat Marcos1, Ernesto Cesar Pinto Leal Junior2, Felipe de Moura Messias2, Maria Helena Catelli de Carvalho3, Rodney Capp Pallotta1, Lúcio Frigo4, Rosângela Aparecida dos Santos3, Luciano Ramos1, Simone Teixeira1, Jan Magnus Bjordal5 and Rodrigo Álvaro Brandão Lopes-Martins*1,2

1Laboratory of Pharmacology and Experimental Therapeutics, Department of Pharmacology, Institute of Biomedical Sciences, University of Sa ̃o Paulo, Sa ̃o Paulo, SP-Brazil

2Post Graduate Program in Rehabilitation Sciences, Nove de Julho University (UNINOVE), São Paulo, SP-Brazil

3Laboratory of Hypertension, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, SP-Brazil

4Biological Sciences and Health Center, Cruzeiro do Sul University, São Paulo, SP-Brazil 5Section of Evidence Based Practice, Bergen University College, Bergen, Norway

Received 1 August 2011, accepted 1 September 2011, DOI: 10.1111/j.1751-1097.2011.00999.x

ABSTRACT

Nonsteroidal anti-inflammatory drugs (NSAIDs) are widely used and can reduce musculoskeletal pain in spite of the cost of adverse reactions like gastrointestinal ulcers or cardiovascular events. The current study investigates if a safer treatment such as low-level laser therapy (LLLT) could reduce tendinitis inflammation, and whether a possible pathway could be through inhibition of either of the two-cyclooxygenase (COX) isoforms in inflammation. Wistar rats (six animals per group) were injected with saline (control) or collagenase in their Achilles tendons. Then, we treated them with three different doses of IR LLLT (810 nm; 100 mW; 10 s, 30 s and 60 s; 3.57 W cm)2; 1 J, 3 J, 6 J) at the sites of the injections, or intramuscular diclofenac, a nonselective COX inhibitor ̊NSAID. We found that LLLT dose of 3 J significantly reduced inflammation through less COX-2-derived gene expression and PGE2 production, and less edema formation compared to nonirradiated controls. Diclofenac controls exhibited significantly lower PGE2 cytokine levels at 6 h than collagenase control, but COX isoform 1-derived gene expression and cytokine PGE2 levels were not affected by treatments. As LLLT seems to act on inflammation through a selective inhibition of the COX-2 isoform in collagenase-induced tendinitis, LLLT may have potential to become a new and safer nondrug alternative to coxibs.

INT

Tenddisorpharmtendiwhile

*Corre

Ó 2011

inclu(6).

For atargebeenand gpharminjurnonpinflam

Loadand cmodeincrecoulddirecprofi

Collahas pstudiinjeccolla

Low-acuteinvoltendipositinflam

1447

1448

obsersame

TRODUC

dinitis and orders in modma- cologicinopathies ae extrinsic r

esponding autho

1 The Authors�P

ude high-fre

acute and sueted at reducn observed fglucocorticoma- ceuticaries (10–14)pharmacologmmatory te

ding of tendconsequentlel of healthyease as a resd in turn be ct ‘‘in vivo’ile after an i

agenase is kpreviously bies found inction (19,20agenase-indu

-level laser e tendinitis lved are notinopathy tretive results (mmatory pr

7

8 Rodrigo L

rved that spe level as a h

CTION

other tendindern societycal agents inare middle orisk factors

or email: rmart

Photochemistry an

equency of w

ubacute tendcing inflammfor pharmacoid injectional agents ma). In this pergical alternaendinitis res

don cells seely the releasy Achilles tsponse to tenblocked by’ evidence cinflamma- t

known to habeen used tonflammatory), but the kiuced tendin

therapy (LLand other tet well undereatments, w(21). One process. In a

Labat Marco

pecific dosehuman equi

opathies arey and they an primary heor older age

[email protected]

nd Photobiology Ó

work-related

dinitis theremation and otherapies sns (9). Howay negativelrspective, thatives to exaponse with

ems to increse of prostagtendons, perndon loadin

y a COX-2 iconcerning tory stimulu

ave both proo induce acuy cell migrainetic profil

nitis is not y

LLT) has beendin- opathrstood. In a

we pointed ouossible undprevious st

os et al.

s of LLLT ripotent dose

e among theare commonealth care (

e (3), diabete

r (Rodrigo A ́ lv

Ó 2011 The Ame

d repetitive

e is consensuedema (7).

such as nonwever, experly affect thehere is a neeamine if theless advers

ease the expglandin E2 (ritendinous ng (15). Thiinhibitor (ceCOX-2 gen

us.

oinflammatoute tendinitiation and edle of the infl

yet determin

een used wihies for the previous reut that seve

derlying mectudy, we

reduced acue of the non

e most prevnly treated w1,2). Intrinses (4) and a

varo Branda ̃o L

erican Society of

movement

us that the a Short-term

nsteroidal anrimental stue healing proed for invesey can modue effects tha

pression of c(PGE2). In aPGE2 conce

is activity-inelecoxib) (1ne expressio

ory and degis in animalema during

flammatory ned.

ith mixed relast three d

eview of theeral mechanchanism is a

ute rat paw ensteroidal an

alent muscuwith anti-infsic risk factoantibiotic tre

Lopes-Martins)

Photobiology 003

s in non-neu

aim of theram effects in tnti- inflammudies have foocess after atigating ulate the acuan drugs.

cyclooxygena human expentra- tions nduced relea6). Howeve

on in tendon

generative p models (17the first da

process in t

esults in clinecades, but

e applicationisms could a modula- ti

edema to apnti-inflamm

uloskeletal flammatoryors for eatment (5),

)

31-8655/11

utral positio

apy should btendinitis ha

matory drugfound that thacute tendo

ute

nase-2 (COperimental seemed to ase of PGEer, there is lns and its tim

properties an7,18). Theseays after this model o

nical studie the mechann of LLLT iaccount for

tion of the

pproximatelmatory drug

81

y

,

ons

be ave s (8)

hese n

X-2)

2 little me

nd it e

of

s of nisms in r the

ly the

82

diclofenac (22). This finding has been supported by similar macroscopic and histological findings in other animal models comparing LLLT and tenoxicam (23), meloxicam (24) and celecoxib (25). In a human model of activating Achilles tendinitis by overload, we found that PGE2 was reduced by LLLT, but if and how LLLT act on COX isoforms remains uncertain. In this study, we aim at mapping the short-term time profile of rat collagenase-induced tendinitis and to measure the gene expressions of the COX isoforms and their respective prostaglandin PGE2 production in tendons. In addition, we sought to investigate if LLLT could affect the inflammatory process in rat Achilles tendons.

MATERIALS AND METHODS

All of the experimental procedures were submitted and approved by the Ethical Committee of the University of Sao Paulo. One hundred and fifty male Wistar rats weighing about 250 g were randomly divided and housed five per cage before the experimental procedure. Food and water were provided ad libitum throughout the experiment. Rats were anesthetized with inhalatory halothane before collagenase injection. All the necessary preoperative procedures were performed in order to prevent discomfort and to avoid any infection. Skin was surgically prepared and the collagenase (30lL of crude collagenase— 1 mg mL)1; Sigma, St. Louis, MO; Cat# C-6885—using a 30 G needle) was injected percutaneously parallel to the right Achilles tendon ca 2 mm above the osteotendinous junction under anesthesia. Collagenase was dissolved in sterile PBS containing 50 mM NaH2P04, 10 mM NaCl at pH 7.1. The same volume of PBS without collagenase was injected using the same procedure in a control group of six animals. In another control group of six animals, a prefabricated solution of diclofenac 1 mg kg)1 rat bodyweight was injected in the abdomen 30 min prior to the collagenase injection.

Animals were sacrificed with an overdose of halothane at the different outcome timepoints (2, 4, 6, 12, 24, 48 and 72 h, 7 and 14 days). After the removal of skin and connective tissue, Achilles tendons were removed and processed for further analysis.

LLLT procedure. A single LLLT was performed 1 h after collagenase injection with an IR laser unit (DMC, Sao Carlos, Brazil). The laser unit emitted a continuous optical output of 100 mW with a wavelength of 810 nm to a spot size area of 0.028 cm2, which gave a power density of 3.57 W cm)2. The optical output of the laser unit was measured before, halfway through and after the experiment. Laser irradiation was performed in skin contact at the site of collagenase injection with doses of 1 J (35.71 J cm)2), 3 J (107.14 J cm)2) and 6 J (214.29 J cm)2) and corresponding irradiation times of 10, 30 and 60 s, respectively. The laser energy doses were chosen according to previous studies of our research group (22,25).

Analyses. For all analyses we used a sample of six animals. An observer who was blinded to group allocation performed all analyses. Initial analysis was performed at Section of Pharmacology, ICB at University of Sao Paulo, Brazil. To insure consistency in analyses and reproducibility of results, two other laboratories at University of Sao Paulo (Brazil) duplicated the analyses.

RNA isolation and Real Time PCR analysis: At the selected timepoints Achilles tendons were dissected, frozen in liquid nitrogen, and stored at )80°C. Total RNA was isolated in the Trizol reagent, according to the manufacturer’s instruction.

DNase I was employed to digest DNA to obtain RNA purification and the integrity of RNA was verified by agarose gel electrophoresis. Total RNA (2 lg) was used for first-strand cDNA synthesis (reverse transcriptase [RT]) using SuperScript II. In addition, RNaseOUT was also added to protect the RNA during this process. Three pooled RNA aliquots were routinely sham

83

reverse transcribed (i.e. RT omitted) to insure the absence of DNA contaminants. Diluted RT samples (1:10) were submitted to real-time PCR amplification using Platinum Sybr QPCR Supermix-UDG and specific oligonucleotides for COX-1

(forward: CCGTGCGAGTACAGTCACAT; reverse: CCTCACCAG TCATTCCCTGT) and COX-2 (forward: AGATCAGAAGCGAG GACCTG; reverse: CCATCCTGGAAAAGTCGAAG).

Beta-actin was used as an internal control (forward: AAGATTTG GCACCACACTTTCTACA; reverse: CGGTGAGCAGCACAGG GT).

The conditions for PCR were as follows: 50°C—2min; 95°C—2 min, followed by 30 cycles of 95°C—15 s; 60°C—1 min and 72°C—15 s. Ct values were recorded for each gene, and the results of genes of interest were normalized to results obtained with the internal control gene. ddCT were calculated and the results are expressed as fold increase. All oligonucleotides and reagents utilized in this protocol were purchased from Invitrogen Co.

PGE2—production derived from each COX isoform: PGE2 generation was analyzed and determined according to the manufacturer instructions by ELISA (R & D Systems, Minneapolis, MN). In order to separate the two-COX isoforms, we used indomethacin as a nonspecific inhibitor and etoricoxib as a selective COX-2 inhibitor (26). The amount of PGE2 production derived from each isoform was then calculated according to the difference between complete inhibition by indomethacin and partial inhibition by the selective COX-2 inhibitor etoricoxib.

Vascular permeability—Evans Blue: An Evans Blue dye (25 mg mL)1; MERCK) was dissolved in saline solution and then filtered in a sterilized membrane (0.22 m; MILLIPORE) and conserved at 4°C.

The animals were previously anesthetized with halothane and then injected peritendinously with the Evans Blue dye, 1 h before euthanasia. Animals were sacrificed by halothane super dose. After the sacrifice, the tendon was collected, weighed and conserved for 24 h at

37°C in a glass tube in Formamide solution (MERCK article )1

9684,1000, 4 mL g ) for dye extraction. A 150 lL sample from each tube was used for determination of Evans Blue concentrations (BIOTEK Spectrophotometer 618–620 nm). The results were analyzed by linear regression, correlation and the Tukey–Kramer multiple comparisons tests.

Edema formation—wet–dry weight measurements: After collagenase injection, the rat Achilles tendons were excised after 24 h, in order to evaluate edema formation. Tendons were dried for 48 h at 60°C and edema was then calculated from the difference between wet and dry weight, measured with a precision analytical balance (0.0001 mg sensitivity). As tendon matrix is a firm structure and the formation of edema is less prevalent than in soft tissue which is of looser structure, an extra control group receiving the nonsteroidal anti-inflammatory drug (NSAID) diclofenac was added for this comparison.

Statistical analysis. A blinded observer unaware of the allocation to groups performed the statistical analysis. Data are expressed as mean and standard error (±) of the mean (SEM). All data were statistically evaluated by analysis of variance (ANOVA), followed by the New- man–Keuls–Student’s test. Values with P < 0.05 were considered to be statistically significant.

RESULTS

Characteristics of acute inflammation in the collagenase-induced tendinitis model

84

COX-1 and COX-2 gene expression by real-time PCR. There was a sharp decrease in mRNA expression for COX-1 after collagenase injection at 2 h, thereafter it stabilized at a low level for the first 24 h. On the other hand, COX-2 mRNA expression increased sharply after collagenase injection and peaked at 2 h. It stayed significantly higher than baseline for the first 24 h. The results suggested that 2 h after collagenase injection would be the most suitable timepoint for measuring effects on COX-1 and COX-2 gene expression from anti- inflammatory therapies. In addition, the results suggest that anti-inflammatory effects should be expressed as an ability to increase COX-1 expression and reduce COX-2 expression at the 2 h timepoint (Fig. 1A).

Effects of low-level laser irradiation on COX-1 gene expression.

All therapeutic groups exhibited highly significant increases in COX-1 mRNA expressions (P < 0.0001) compared to the collagenase control group at 2 h after collagenase injections. There were no significant differences between diclofenac and the LLLT groups (P = 0.18–0.91) (Fig. 1B).

Effects of low-level laser irradiation on COX-2 gene expression.

There were no significant effects on the COX-2 gene expression at 2 h from diclofenac and LLLT with an energy dose of 1 J. LLLT with an energy dose of 6 J significantly reduced COX-2 gene expression (P < 0.05), whereas LLLT with an energy dose of 3 J induced a highly significant reduction of COX-2 gene expression (P < 0.0001) compared to the collagenase control. The LLLT with 3 J also reduced the COX-2 gene expression to a level significantly lower (P < 0.05) than the saline control (Fig. 1C).

Effects of LLLT on tendon COX-1-derived PGE2 production.

Tendon tissue produced higher concentrations of COX-1- derived PGE2 than COX-2-derived PGE2 at 6h after collagenase injections. PGE2 concentration derived from COX-1 isoform exhibited statistical significance versus saline control, while PGE2 concentration derived from COX-2 isoform was significantly different from saline (data not shown).

Neither diclofenac nor energy doses of 3 J and 6 J LLLT significantly affected PGE2 production derived from the COX-1 enzyme compared to collagenase controls. LLLT with an energy dose of 1 J significantly (*P < 0.05) increased the COX-1-derived PGE2 production (Fig. 2A).

LLLT doses of 1 J and 3 J LLLT significantly reduced PGE2 production derived from the COX-2 isoform (P = 0.001 and P = 0.01, respectively), while 6 J of LLLT was not significantly different (P = 0.08) from the collagenase control group (Fig. 2B).

Vascular permeability (Evans Blue Dye). The time course for vascular permeability measured by Evans Blue dye showed significantly increased permeability versus saline control. As expected, the onset for vascular extravasation was slower than for reactions related to gene expression and PGE2 production and no significant differences from saline control were seen up to the 6 h timepoint. However, vascular permeability peaked at 12 h and remained significant at 24 and 48 h (P < 0.05) after collagenase injection (Fig. 3A).

85

There was a significant reduction of vascular permeability and extravasation measured by Evans Blue dye at 12 h from LLLT doses of both 3 and 6 J (P < 0.05). Neither diclofenac, nor LLLT with an energy dose of 1 J, differed significantly from the collagenase control group in vascular permeability (Fig. 3B).

Edema formation in tendon tissue. Diclofenac and LLLT doses of 1 and 6 J were not significantly different from the collagenase control group in wet weight ̊dry weight differences at 12 h after the collagenase injection. However, there was a significant reduction in the wet weight–dry weight difference in the group receiving LLLT with an energy dose of 3 J, and both the collagenase and diclofenac (P < 0.01) groups (Fig. 4).

DISCUSSION

In this experiment we have demonstrated that the collagenase- induced tendinitis model may be suitable for studying the sequence of acute inflammatory responses in tendon tissue. The characterization of the experimental model with

Photochemistry and Photobiology, 2011, 87 1449

FigurCOX(B) Cand cexpreLLLTanimacontrlaser

re 1. (A) TimX-1 values areCOX-1 mRNcollagenase +ession 2 h aftT treatments als per group

rol group. Thgroup (*P <

me course of e related to th

NA expression+ laser treatmter collage- nwith 1, 3 an

p. (**P < 0.0he COX-2 lev 0.05). COX

COX-1 and he right y- axn 2 h after co

ments with 1,nase injectiond 6 J of ener

001) betweenvel was signi

X = cyclooxyg

COX-2 mRNxis, and COXollagenase in, 3 and 6 J ofn in saline, crgy. The valun each treatedificantly lowgenase; LLL

NA expressioX-2 values arnjection in saf energy (*P control (collaues are expred group and n

wer in the 3 J LT = low- lev

on after collare related to

aline, control < 0.05). (C)

agenase) and essed as meannonirradiatedlaser group t

vel laser thera

agenase injecthe left y-ax

l (collagenaseCOX-2 mRNcollagenase

n ± SEM. N d collagenasthan in the 6apy.

86

ction. xis. e) NA + = 6 e J

1450

Figur(collagroupgroup(collaexprecompCOX

0 Rodrigo L

re 2. (A) Levagenase) andp. There werps. (B) Levelagenase) andessed as meaparisons betw

X = cyclo- ox

Labat Marco

vels of COX-d collagenasee no significls of COX-2-

d collage- nasan ± SEM. N ween treated ygenase; LL

os et al.

-1-derived PGe + LLLT treant differenc-derived PGEse + LLLT tr= 6 animals groups and c

LLT = low-le

GE2 6 h aftereatments withces between E2, 6 h after reatments wi per group. Tcollagenase cevel laser the

r collagenaseh 1, 3 and 6 Jthe collagencollagenase ith 1, 3 and 6There are sigcontrol grouprapy.

e injection inJ of energy. Nase control ginjection in

6 J of energynificant diffep (*P < 0.05;

n saline, contN = 6 animagroup and tresaline, contr

y. The values ferences in ; **P < 0.01

87

trol als per eated rol

are

).

Figurextravanimacollagpermreceiv6 J re

Figurforma

re 3. (A) Timvasation afteals per groupgenase group

meability as mving LLLT eeached statist

re 4. Effect oation after co

me course of er collagenasp. There werps at 12, 24 a

measured by Eexhibited lesstical significa

of the NSAIDollagenase in

vascular permse injection. Te significantand 48 h (*P Evans dye bls edema thanance (*P < 0

D diclofenac,njection, mea

meability as The values at differences < 0.05; **Plue at 12 h pn the collage0.05). LLLT

, and LLLT dasured by the

measured by

are expressedbetween the < 0.01). (B)ostinjection.nase control = low-level l

doses of 1 J, e difference b

y Evans blued as mean ± S

saline contro) Showing thAlthough algroup, only

laser therapy

3 J and 6 J obetween wet

e dye SEM. N = 6 rol group andhe vascular ll groups doses of 3 J

y.

on tendon edweight and

88

d

J and

dema dry

89

weight 12 h after the collagenase injection. The graph is representative of six animals per group (*P < 0.05 compared to collagenase group). NSAID = nonsteroidal anti-inflammatory drugs; LLLT = low-level laser therapy.

collagenase-induced inflammation revealed that mRNA expression for COX-1 decreased, while mRNA COX-2 expression increased at 2 h. This finding contradicts the common opinion that anti-inflammatory effects are achieved by reducing activity in both COX isoforms. Consequently, anti-inflammatory effects from therapies on gene expression at this stage should increase COX-1 gene expression, and reduce COX-2 gene expression. At the 6 h timepoint, PGE2 production was significantly increased for both isoforms. Vascular extravasation and edema peaked at 12 h, but was not measured separately for each COX isoform. This characterization validates the use of this model to investigate possible anti-inflammatory effects of therapies at the above timepoints for maximal inflammatory expression for the respective outcomes.

In the therapeutic part of the trial, we found that gene expression of COX-1 increased significantly in all LLLT groups and also in the diclofenac control group. This finding is in line with an anti-inflammatory effect of these therapies. However, for the gene expression of COX-2, neither diclofenac

control nor LLLT doses of 1 and 6 J produced anti-inflammatory effects. However, a dose of 3 J significantly reduced COX-2 gene expression. Diclofenac control and LLLT of 1 and 3 J reduced only COX-2-derived PGE2. For the

macroscopic end result, vascular permeability and edema formation at 12 h were significantly reduced by LLLT with a dose of 3 J. Putting the sequences together, LLLT with a dose of 3 J exhibited the most consistent anti-inflammatory effects throughout the experiment. It was significantly superior to diclofenac for three outcomes, equal in two and inferior in one outcome.

In previous studies, LLLT has been found to be equally effective as NSAIDs in the acute inflammatory stage across several experimental models and types of NSAIDs such as indomethacin (27), diclofenac (22), meloxicam (24), tenoxicam (23) and celecoxib (25).

The least effect from LLLT was found on the tendon weight ̊ dry weight difference, but this may be caused by the tendon tissue structure that is quite solid and allows for less expansion than looser tissue such as in the rat paw model (22). When administered orally, rofecoxib has the undesired systemic side-effect that it increases platelet aggregation and thereby increases the risk for myocardial infarct (28). Follow- ing this discovery, caution has been advocated in the systemic use of orally administered COX-2 inhibitors (29). But the enormous increase in prescription rates for COX-2 inhibitors during the first years after introduction (30) shows that there was an urgent need for finding new treatment solutions for musculoskeletal disorders with an inflammatory component. The traditional nonspecific NSAIDs have undesired side- effects on the gastro-intestinal tract (31). In addition, both COX-2 specific and nonspecific NSAIDs seem to have negative effects on the healing process of tendons (12,32). In animal studies, glucocorticoids seem to cause even more deleterious effects on tendon tissue with tendon degeneration (33) and increased apoptosis (34). Contrary to this, a number of authors have found positive effects and accelerated tendon repair after LLLT application in injured Achilles tendons of animals (35– 38). This dual action of both

90

anti-inflammatory action and enhancement of tendon repair seems to be unique to LLLT, and offers potential for refinement of LLLT dosing in clinical studies. LLLT is also well tolerated among patients with no reports of serious adverse events and the occurrence of minor side-effects being no different from placebo (39).

The collagenase-induced tendinitis is an experimental model to study tendon inflammation. However, this model may not represent exactly what happens in human pathologies, and this could be a limitation of the present study. On the other hand, our results strongly suggest a new explanation for why LLLT also seems to work with similar doses in other bodily locations such as neck pain (40,41), knee osteoarthritis (42) and hand rheumatoid arthritis (43).

CONCLUSION

In this study, we have demonstrated that the collagenase- induced tendinitis model is suitable for evaluating effects of anti-inflammatory treatments. We also found that LLLT (k = 810 nm, 100 mW) administered with an energy dose of 3 J significantly increased COX-1 gene expression, reduced COX-2 gene expression and COX-2-derived PGE2 production, vascular permeability and edema formation compared to no treatment. The effects of 3 J of LLLT were significantly better than the NSAID diclofenac in four out of five outcomes of COX-2 gene expression and edema formation, similar for

vascular permeability and significantly less for inhibition of COX-2-derived PGE2.

Ethicalstandards—ThisresearchfollowsthecurrentBrazilianlawsof experiments with animals.

Conflict of interests—All the authors declare no conflict of interests related to this research.

REFERENCES

1. van der Windt, D. A., B. Koes, B. A. de Jong and L. M. Bouter (1995) Shoulder disorders in general practice: Incidence, patient characteristics an management. Ann. Rheum. Dis. 54, 959–964.

2. Smidt, N. and D. A. van der Windt (2006) Tennis elbow in primary care. BMJ 333, 927–928.

3. Fahlstrom, M., R. Lorentzon and H. Alfredson (2002) Painful conditions in the Achilles tendon region: A common problem in middle-aged competitive badminton players. Knee Surg. Sports Traumatol. Arthrosc. 10, 57–60.

4. Miranda, H., E. Viikari-Juntura, S. Heistaro, M. Heliovaara and H. Riihimaki (2005) A population study on differences in the determinants of a specific shoulder disorder versus nonspecific shoulder pain without clinical findings. Am. J. Epidemiol. 161, 847–855.

5. Melhus,A.(2005)Fluoroquinolonesandtendondisorders.Expert Opin. Drug Saf. 4, 299–309.

6. Tanaka, S., M. Petersen and L. Cameron (2001) Prevalence and risk factors of tendinitis and related disorders of the distal upper extremity among U.S. workers: Comparison to carpal tunnel syndrome. Am. J. Ind. Med. 39, 328–335.

7. Johansson, K., L. Adolfsson and M. Foldevi (1999) Attitudes toward management of patients with subacromial pain in Swedish primary care. Fam. Pract. 16, 233–237.

91

8. Green, S., R. Buchbinder, L. Barnsley, S. Hall, M. White, N. Smidt and W. Assendelft (2002) Non-steroidal anti-inflammatory drugs (NSAIDs) for treating lateral elbow pain in adults. Coch- rane Database Syst. Rev. 2, CD003686.

9. Smidt, N., W. J. Assendelft, D. A. van der Windt, E. M. Hay, R. Buchbinder and L. M. Bouter (2002) Corticosteroid injections for lateral epicondylitis: A systematic review. Pain 96, 23–40.

10. Riley, G. P., M. Cox, R. L. Harrall, S. Clements and B. L. Hazleman (2001) Inhibition of tendon cell proliferation and matrix glycosaminoglycan synthesis by non-steroidal anti-inflammatory drugs in vitro. J. Hand Surg. 26, 224–228.

11. Ferry, S. T., L. E. Dahners, H. M. Afshari and P. S. Weinhold (2007) The effects of common anti-inflammatory drugs on the healing rat patellar tendon. Am. J. Sports Med. 35, 1326–1333.

12. Cohen, D. B., S. Kawamura, J. R. Ehteshami and S. A. Rodeo (2006) Indomethacin and celecoxib impair rotator cuff tendon- to-bone healing. Am. J. Sports Med. 34, 362–369.

13. Akpinar,S.,M.A.Hersekli,H.Demirors,R.N.TandoganandF. Kayaselcuk (2002) Effects of methylprednisolone and betameth- asone injections on the rotator cuff: An experimental study in rats. Adv. Ther. 19, 194–201.

14. Tsai, W. C., F. T. Tang, M. K. Wong and J. H. Pang (2003) Inhibition of tendon cell migration by dexamethasone is correlated with reduced alpha-smooth muscle actin gene expression: A potential mechanism of delayed tendon healing. J. Orthop. Res. 21, 265–271.

15. Langberg, H., D. Skovgaard, M. Karamouzis, J. Bulow and M. Kjaer (1999) Metabolism and inflammatory mediators in the peritendinous space measured by microdialysis during intermittent isometric exercise in humans. J. Physiol. 515, 919–927.

16. Langberg,H.,R.Boushel,D.Skovgaard,N.RisumandM.Kjaer (2003) Cyclo-oxygenase-2 mediated prostaglandin release regu- lates blood flow in connective tissue during mechanical loading in humans. J. Physiol. 551, 683–689.

17. Marsolais, D., C. H. Cote and J. Frenette (2003) Nonsteroidal anti-inflammatory drug reduces neutrophil and macrophage accumulation but does not improve tendon regeneration. Lab. Invest. 83, 991–999.

Photochemistry and Photobiology, 2011, 87 1451

1452 Rodrigo Labat Marcos et al.

Stone, D., C. Green, U. Rao, H. Aizawa, T. Yamaji, C. Niyibizi, G. Carlin and S. L. Woo (1999) Cytokine-induced tendinitis: A preliminary study in rabbits. J. Orthop. Res. 17, 168–177.

Wetzel, B. J., G. Nindl, J. A. Swez and M. T. Johnson (2002) Quantitative characterization of rat tendinitis to evaluate the efficacy of therapeutic interventions. Biomed. Sci. Instrum. 38, 157–162.

Marsolais, D., C. H. Cote and J. Frenette (2001) Neutrophils and macrophages accumulate sequentially following Achilles tendon injury. J. Orthop. Res. 19, 1203–1209.

Bjordal, J. M., C. Couppe ́ and A. E. Ljunggreen (2001) Low level laser therapy for tendinopathy. Evidence of a dose-response pat- tern. Phys. Ther. Rev. 6, 91–99.

92

Reduced risk of upper gastrointestinal ulcer complications with celecoxib, a novel COX-2 inhibitor. Am. J. Gastroenterol. 95, 1681–1690.

32. Dimmen, S., L. Engebretsen, L. Nordsletten and J. E. Madsen (2009) Negative effects of parecoxib and indomethacin on tendon healing: An experimental study in rats. Knee Surg. Sports Trau- matol. Arthrosc. 17, 835–839.

33. Tatari, H., C. Kosay, O. Baran, O. Ozcan and E. Ozer (2001) Deleterious effects of local corticosteroid injections on the Achilles tendon of rats. Arch. Orthop. Trauma Surg. 121, 333–337.

34. Hossain, M. A., J. Park, S. H. Choi and G. Kim (2008) Dexamethasone induces apoptosis in proliferative canine tendon cells and chondrocytes. Vet. Comp. Orthop. Traumatol. 21, 337–

22. Albertini, R., F. S. Aimbire, F. I. Correa, W. Ribeiro, J. C. Cogo,�E. Antunes, S. A. Teixeira, G. De Nucci, H. C. Castro-Faria- 342.

Neto, R. A. Zangaro and R. A. Lopes-Martins (2004) Effects of different protocol doses of low power gallium–aluminum–arsenate (Ga–Al–As) laser radiation (650 nm) on carrageenan induced rat paw ooedema. J. Photochem. Photobiol. B 74, 101–107.

15. Ulugol, A., H. Unalan, I. Dokmeci and S. Kokino (1997) Com- parison of the effects of tenoxicam and mid-laser irradiation on chronic adjuvant arthritis in rats. Clin. Exp. Rheumatol. 15, 83–86.

16. Campana, V. R., M. Moya, A. Gavotto, F. Soriano, H. O. Juri, L. S. Spitale, J. C. Simes and J. A. Palma (1999) The relative effects of HeNe laser and meloxicam on experimentally induced inflammation. Laser Ther. 11, 36–41.

17. Aimbire, F., R. A. Lopes-Martins, R. Albertini, M. T. Pacheco, H. C. Castro-Faria-Neto, P. S. Martins and J. M. Bjordal (2007) Effect of low-level laser therapy on hemorrhagic lesions induced by immune complex in rat lungs. Photomed. Laser Surg. 25, 112–117.

18. Ajuebor, M. N., A. Singh and J. L. Wallace (2000) Cyclooxy- genase-2-derived prostaglandin D(2) is an early anti-inflammatory signal in experimental colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 279, G238–G244.

19. Honmura, A., A. Ishii, M. Yanase, J. Obata and E. Haruki (1993) Analgesic effect of Ga–Al–As diode laser irradiation on hyperalgesia in carrageenin-induced inflammation. Lasers Surg. Med. 13, 463–469.

20. Juni, P., L. Nartey, S. Reichenbach, R. Sterchi, P. A. Dieppe and M. Egger (2004) Risk of cardiovascular events and rofecoxib: Cumulative meta-analysis. Lancet 364, 2021–2029.

21. Zhang, W., R. W. Moskowitz, G. Nuki, S. Abramson, R. D. Altman, N. Arden, S. Bierma-Zeinstra, K. D. Brandt, P. Croft, M. Doherty, M. Dougados, M. Hochberg, D. J. Hunter, K. Kwoh, L. S. Lohmander and P. Tugwell (2008) OARSI recom- mendations for the management of hip and knee osteoarthritis, part II: OARSI evidence-based, expert consensus guidelines. Osteoarthr. Cartil. 16, 137–162.

22. Rawson, N. S., P. Nourjah, S. C. Grosser and D. J. Graham (2005) Factors associated with celecoxib and rofecoxib utilization. Ann. Pharmacother. 39, 597–602.

23. Goldstein, J. L., F. E. Silverstein, N. M. Agrawal, R. C. Hubbard, J. Kaiser, C. J. Maurath, K. M. Verburg and G. S. Geis (2000)

93

35. Elwakil, T. F. (2006) An in-vivo experimental evaluation of He–Ne laser photostimulation in healing Achilles tendons. Lasers Med. Sci. 22, 53–59.

36. Fillipin, L. I., J. L. Mauriz, K. Vedovelli, A. J. Moreira, C. G. Zettler, O. Lech, N. P. Marroni and J. Gonzalez-Gallego (2005) Low-level laser therapy (LLLT) prevents oxidative stress and reduces fibrosis in rat traumatized Achilles tendon. Lasers Surg. Med. 37, 293–300.

37. Reddy, G. K., L. Stehno-Bittel and C. S. Enwemeka (1998) Laser photostimulation of collagen production in healing rabbit Achilles tendons. Lasers Surg. Med. 22, 281–287.

38. Salate, A. C., G. Barbosa, P. Gaspar, P. U. Koeke, N. A. Pariz- otto, B. G. Benze and D. Foschiani (2005) Effect of In–Ga–Al–P diode laser irradiation on angiogenesis in partial ruptures of Achilles tendon in rats. Photomed. Laser Surg. 23, 470–475.

39. Bjordal, J. M., R. A. Lopes-Martins, J. Joensen, A. E. Ljunggren, C. Couppe, A. Stergioulas and M. I. Johnson (2008) A systematic review with procedural assessments and meta-analysis of low level laser therapy in lateral elbow tendinopathy (tennis elbow). BMC Musculoskelet Disord. 9, 75.

40. Gross, A. R., C. Goldsmith, J. L. Hoving, T. Haines, P. Peloso, P. Aker, P. Santaguida and C. Myers (2007) Conservative management of mechanical neck disorders: A systematic review. J. Rheumatol. 34, 1083–1102.

41. Chow, R. T., M. I. Johnson, R. A. Lopes-Martins and J. M. Bjordal (2009) Efficacy of low-level laser therapy in the management of neck pain: A systematic review and meta-analysis of randomised placebo or active-treatment controlled trials. Lancet 374, 1897–1908.

42. Bjordal, J. M., M. I. Johnson, R. A. Lopes-Martins, B. Bogen, R. Chow and A. E. Ljunggren (2007) Short-term efficacy of physical interventions in osteoarthritic knee pain. A systematic review and meta-analysis of randomised placebo-controlled trials. BMC Musculoskelet Disord. 8, 51.

43. Brosseau, L., V. Welch, G. Wells, R. deBie, A. Gam, K. Harman, M. Morin, B. Shea and P. Tugwell (2000) Low level laser therapy (classes I, II and III) for the treatment of osteoarthritis. Cochrane Database Syst. Rev. 2, CD002046.

felipe de moura messias - bibliotecatede.uninove.br de... · a parede abdominal anterior foi...

Documents