stress-induced nuclear depletion of entamoeba histolytica ... · phagocytosis, a process important...

Exonuclease EhRrp6 in growth stress

1

Stress-induced nuclear depletion of Entamoeba histolytica 3′-5′exoribonuclease EhRrp6 and its role

in growth and erythrophagocytosis

Shashi Shekhar Singh1, Sarah Naiyer1, Ravi Bharadwaj3, Amarjeet Kumar2, Yatendra Pratap

Singh1, Ashwini Kumar Ray1, Naidu Subbarao2, Alok Bhattacharya3, Sudha Bhattacharya1*

From the 1School of Environmental Sciences, Jawaharlal Nehru University, New Delhi, 110067, India; 2School of Computational & Integrative Sciences, Jawaharlal Nehru University, 110067, India; 3School of

Life Sciences, Jawaharlal Nehru University, New Delhi, 110067, India

Running Title: Exonuclease EhRrp6 in growth stress

*To whom correspondence should be addressed: Sudha Bhattacharya: School of Environmental Sciences,

Jawaharlal Nehru University, New Delhi 110067, India; [email protected]; Office: +91 11 26704308,

Cell: (0) 9818476740.

Keywords: Entamoeba histolytica, EhRrp6, Serum stress, Exosome complex, 5′-ETS, Exonuclease,

precursor ribosomal RNA (pre-rRNA), Phagocytosis, amoebiasis, amoebic dysentery

http://www.jbc.org/cgi/doi/10.1074/jbc.RA118.004632The latest version is at JBC Papers in Press. Published on August 31, 2018 as Manuscript RA118.004632

by guest on June 12, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on June 12, 2020

http://ww

w.jbc.org/

Dow

nloaded from


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/cgi/doi/10.1074/jbc.RA118.004632

http://www.jbc.org/

http://www.jbc.org/

http://www.jbc.org/


2

ABSTRACT

The 3′-5′ exoribonuclease Rrp6 is a key enzyme in

RNA homeostasis involved in processing and

degradation of many stable RNA precursors,

aberrant transcripts, and noncoding RNAs. We

previously have shown that in the protozoan

parasite Entamoeba histolytica, the 5′-external

transcribed spacer fragment of pre-rRNA

accumulates under serum starvation–induced

growth stress. This fragment is a known target of

degradation by Rrp6. Here, we computationally

and biochemically characterized EhRrp6 and

found that it contains the catalytically important

EXO and HRDC domains and exhibits

exoribonuclease activity with both unstructured

and structured RNA substrates, which required the

conserved DEDD-Y catalytic-site residues. It

lacked the N-terminal PMC2NT domain for

binding of the cofactor Rrp47, but could

functionally complement the growth defect of a

yeast rrp6 mutant. Of note, no Rrp47 homologue

was detected in E. histolytica. Immunolocalization

studies revealed that EhRrp6 is present both in the

nucleus and cytosol of normal E. histolytica cells.

However, growth stress induced its complete loss

from the nuclei, reversed by proteasome inhibitors.

EhRrp6-depleted E. histolytica cells were severely

growth restricted, and EhRrp6 overexpression

protected the cells against stress, suggesting that

EhRrp6 functions as a stress sensor. Importantly

EhRrp6 depletion reduced erythrophagocytosis, an

important virulence determinant of E. histolytica.

This reduction was due to a specific decrease in

transcript levels of some phagocytosis-related

genes (EhCaBP3 and EhRho1), whereas

expression of other genes (EhCaBP1, EhCaBP6,

EhC2PK, and EhARP2/3) was unaffected. This is

the first report of the role of Rrp6 in cell growth

and stress responses in a protozoan parasite.

INTRODUCTION

Ribosomal RNA genes in eukaryotes are generally

transcribed as precursor molecules (pre-rRNAs)

that carry the mature sequences of 18S, 5.8S, and

28S rRNAs interspersed with external and internal

transcribed spacers (ETS and ITS respectively).

The spacers are removed from the pre-rRNA and

degraded, while the mature rRNA species along

with ribosomal proteins assemble into the

ribosomal subunits (1). Since the transcription rate

of pre-rRNA is very high, rapid turnover of

aberrant pre-rRNAs and excised spacer regions is

important to maintain intracellular nucleotide

levels. The nuclear exosome has a role in various

steps of pre-rRNA processing, including

generation of 3′-end of 5.8S rRNA and

degradation of the excised 5′-ETS fragment (2-4).

The removal of 5′-ETS requires endonucleolytic

cleavages in Saccharomyces cerevisiae (5), and in

metazoans (6), following which the 5′-ETS sub

fragments are further degraded by cooperative

action of exonucleases and helicases (6). The

involvement of the nuclear exosome and

associated 3′-5′ exonuclease Rrp6 in degradation

of excised 5′-ETS has been well documented in S.

cerevisiae (2,7-9), Arabidopsis thaliana (10-12)

and mammals (13).

The exosome is a multi-subunit protein complex

which is highly conserved across eukaryotes

(14,15). It has important roles in RNA

homeostasis and is involved in RNA turnover (16),

and surveillance pathways (17), for a variety of

RNAs both in the nucleus and cytoplasm (18-

21).The core exosome is composed of nine

subunits (Exo9) that lack catalytic activity. The

core has a barrel-shaped structure with a central

channel for ssRNA to pass through. In S.

cerevisiae the Exo9 interacts in the cytoplasm with

Dis3 (or Rrp44), an enzyme with

endoribonuclease and processive 3′-5′ exonuclease

activities to form Exo10Rrp44. In the nucleus,

Exo10Rrp44 associates with Rrp6 along with its

cofactor C1D (or Rrp47), to form

Exo11Rrp44/Rrp6. Rrp6 is a distributive 3′-5′

exonuclease. Rrp6 and Rrp44 bind to opposite

sides of the core exosome. It is believed that the

active sites of these enzymes are sequestered by


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


3

the core exosome and are made available for

processing/ degradation of RNA that is threaded

through the Exo9 central channel (22,23). In yeast,

Rrp6 is found exclusively in the nuclear exosome,

whereas in human, it is concentrated in the

nucleoli and also found in nucleoplasmic and

cytoplasmic exosome (24). Though RRP6 is not

essential for viability, its deletion in S. cerevisiae

leads to temperature sensitivity, slow growth and

accumulation of 5′-ETS sequences (25).

RRP6 domain structure has been extensively

studied in yeast and human by crystal structure

analysis. The exonuclease (EXO) domain of yeast

and human RRP6, and that of bacterial RNase D

belongs to the DEDD superfamily (DEDD-Y

subfamily) of exonucleases that act by a hydrolytic

mechanism involving two divalent metal ions (26-

28). The EXO domain is flanked by a single C-

terminal helicase and RNase D C-terminal

(HRDC) domain (29). These two domains are

sufficient for catalytic activity in yeast (30).

However, both yeast and human RRP6 contain

additional domains. These include an N-terminal

PMC2NT domain that is needed for Rrp6 to bind

to its cofactor Rrp47 (a double-stranded RNA- and

DNA-binding protein) (31-34); a region C-

terminal to HRDC required for interaction with the

core exosome and with RNA (35); and a putative

NLS domain at the C terminus (28).

We have been studying the regulation of

ribosomal biogenesis in the primitive parasitic

protist, Entamoeba histolytica which causes

amoebiasis in humans. We have earlier shown that

transcription continued in E. histolytica cells

subjected to growth stress by serum starvation, but

pre-rRNA processing was inhibited, leading to

accumulation of unprocessed pre-rRNA and

partially processed fragments of the 5′-ETS (36).

The removal of 5′-ETS sub fragments in model

organisms is done by the 3′-5′ exonuclease activity

of Rrp6 (3,9,12). To investigate whether Rrp6

might be performing a similar function in a

primitive eukaryote like E. histolytica we

biochemically characterized EhRrp6. Here we

show that although EhRrp6 sequence differs from

the S. cerevisiae and human homologs as it has

large deletions at both the N- and C-termini, the

enzymatic properties of EhRrp6 are conserved,

and EhRRP6 could complement the growth defect

of Scrrp6 deletion mutant. EhRRP6 down-

regulation led to increase in levels of 5′-ETS sub

fragments. Further, we show that EhRrp6 is

essential for E. histolytica growth and acts as a

stress sensor. It is lost from the nuclei during

growth stress and is required to maintain the

transcript levels of key genes involved in

phagocytosis, a process important for E.

histolytica pathogenesis.

RESULTS

Identification of Exosome core subunits of E.

histolytica

The focus of this study is the characterization of

EhRrp6, which is implicated in 5′-ETS processing,

and is functionally associated with the core

exosome. We undertook a preliminary analysis to

computationally identify the exosome subunits of

E. histolytica. By performing a sequence

homology search we identified 8 of the 9 proteins

corresponding to the eukaryotic Exo9-core ring

and cap subunits in E. histolytica. These have also

been reported in an earlier study (37). For further

categorization, we performed a phylogeny

construction using the Exo9 protein sequences

from Homo sapiens, S. cerevisiae and

Trypanosoma brucei. As expected, the ring and

cap proteins clustered into two different groups

(supplemental Fig. S1), with the latter containing

three members; Rrp4, Rrp40 and Csl4. Of these

we could identify the E. histolytica homologs of

Rrp4 and Rrp40 (EHI_163510 and EHI_004770,

respectively), but the Csl4 homolog could not be

identified. This corroborates with the earlier study

(37). The remaining six E. histolytica proteins

grouped with the six eukaryotic ring subunits

(Rrp41, Rrp42, Rrp45, Rrp46, Rrp43, and Mtr3).

However, it was not possible to identify the

individual E. histolytica homologs for each of

these six subunits. Rather the sequences grouped

into two categories- Rrp41-like (EHI_040320 and

EHI_086520) and Rrp42-like (EHI_000580 and

EHI_188080). The remaining two sequences

(EHI_126330 and EHI_166910) also grouped in

the Rrp42-like category but with low confidence.

This was unlike the previous study where all six

had been classified as Rrp45-like (37). Our

analysis shows overall conservation of the core

exosome structure in E. histolytica; the major

difference being absence of Csl4 subunit.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


4

Comparative sequence and structure analysis

of EhRrp6

We looked for E. histolytica homologue of Rrp6

by NCBI-BLAST search performed against non-

redundant protein database of E. histolytica. Only

one protein (XP_650756) with Rrp6 like EXO

domain was found and it was referred to as

EhRrp6. EhRrp6 has a deduced size of 517 amino

acids and is encoded by a single copy gene

(EHI_021400) lacking any introns. Multiple

sequence alignment of EhRrp6 sequence with its

homologues from other organisms showed well-

conserved EXO and HRDC domains (Fig.1A).

Across its entire sequence EhRrp6 shared 30.5%

and 32.9% sequence identity with ScRrp6 and

HsRrp6 respectively. The EhRrp6 EXO domain

(183-373 amino acids) was of comparable length

to the EXO domains of ScRrp6 and HsRrp6, and

shared 50% and 51% sequence identity

respectively. The EhRrp6 HRDC domain (398-463

amino acids) was of comparable length to HRDC

domain of ScRrp6, while it was 15 amino acids

shorter than HRDC of HsRrp6 and the sequence

identity was 45% and 38% respectively. Unlike

Rrp6 homologues in other organisms we were

unable to find a conserved PMC2NT domain in

EhRrp6 (Fig. 1A). We also checked for the

presence of PMC2NT domain in E. histolytica as a

separate protein, or as part of some other protein

by taking the PMC2NT domain of HsRrp6,

ScRrp6 and TbRrp6 as query and searching the

database as described for EhRrp6 identification.

No significant hit was obtained. Phylogenetic

analysis using the amino acid sequence of

conserved domains (EXO and HRDC) of EhRrp6

showed that it was closer to the protein from lower

eukaryotes (Fig. 1B).

Amino acid sequence analysis showed that the

active site residues in the EXO domain, known to

play critical role in RNA degradation, were well

conserved in EhRrp6 (D212, E214, D270, Y335

and D339) (Fig. 2A). The structure of EhRrp6

(residues 183 to 463) containing the EXO and

HRDC domains was modelled through

comparative homology modelling (Fig. 2B). The

DOPE score (-33247.70), ProSA web Z score (-

7.49) and PROCHECK results (Ramachandran

plot; 93.6% and 6.4% residues in most favorable

and additional allowed region respectively)

suggested that the EhRrp6 modelled structure was

of good quality. Its overall structure was similar to

its homologs and had RMSD value of 0.531 Å,

0.763 Å and 0.714 Å over the aligned residues

with structures of Rrp6 from H. sapiens, S.

cerevisiae and T. brucei respectively (Fig. 2C).

Like Rrp6 of H. sapiens and T. brucei, the linker

of EhRrp6 was shorter (9 amino acids) than the

linker of S. cerevisiae (26 amino acids) (Fig. 2D).

The shorter linker has been suggested to make the

active site more accessible for both structured and

non-structured RNA substrates in H. sapiens and

T. brucei Rrp6 (38) suggesting a similar behaviour

for EhRrp6.

Further we performed MD simulation of 12 in

silico systems to determine the effect of absence of

Mg+2 ions or introduction of DEDD-Y mutations

on catalytic activity of EhRrp6 (Fig. 2E). In the

absence of Mg+2 ions, the structure of EhRrp6

deviated significantly from its native (modelled)

structure, suggesting that Mg+2 ions stabilize the

structure and are crucial for catalytic activity (data

not shown).

Enzymatic activity of EhRrp6

To assay for the exoribonuclease activity of

EhRrp6 we expressed the wild type protein in E.

coli (SHuffle), as a 6xHis fusion protein and

purified it by Ni-NTA affinity chromatography

and gel filtration. Mutants in the highly conserved

DEDD-Y active site residues were obtained to

determine their effect on enzyme activity. Two

double mutants (D212A, E214A; Y335A, D339A)

and a single mutant (D270A) were generated and

the recombinant proteins purified. The purity was

checked by SDS-PAGE electrophoresis

(supplemental Fig. S2). To assay for

exoribonuclease activity a 50 nt AU-rich RNA

substrate was used which lacked secondary

structure, since double-stranded regions could

potentially restrict enzyme activity (28). The

purified protein (0.1uM) was incubated with 5′-

radiolabeled AU-rich RNA (1uM). A time-course

assay was performed for the indicated time periods

(Fig. 3A). There was loss of full-length RNA

substrate with concomitant appearance of

progressively shorter molecules and final

accumulation of an end product <10 nt. This

pattern is very similar to that reported for the

distributive 3′-5′ exoribonuclease of yeast and


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


5

human Rrp6 (28,39). The EhRrp6 mutants in the

conserved active site residues (mentioned above)

were assayed with the same substrate under the

same reaction conditions. None of the mutant

proteins showed any activity (Fig. 3B), confirming

the conserved role of these residues in the active

site of EhRrp6. Activity of the wild-type enzyme

was also checked with another RNA substrate

expected to have secondary structure. This was a

60 nt RNA modified from an E. histolytica

sequence (3′-end of EhSINE1) (40). The sequence

was predicted by RNA-fold to have a 30 nt 3′-

overhang followed by a stem-loop (Fig. 3C). This

RNA was treated with EhRrp6 under the

conditions described for the AU-rich RNA

substrate. Unlike the latter substrate which was

progressively degraded to shorter fragments, the

60-nt structured substrate showed accumulation of

a 30-nt intermediate, in addition to the <10 nt end-

product (Fig. 3C). This could be due to stalling of

EhRrp6 at the base of the stem-loop, as shown for

Rrp6 from yeast and human (28). To further

characterize the properties of EhRrp6 we

determined the conditions of temperature and pH

with the 50 nt AU-rich RNA substrate and found

maximal activity at 37°C, pH 8.0 (Fig. 3D, E). The

requirement for Mg2+ was absolute as no activity

was found in the absence of Mg2+ or in the

presence of EDTA (Fig. 3F). The nuclease activity

of EhRrp6 was specific to RNA as no activity was

observed with either ss- or ds-DNA substrates

(Fig. 3G).

EhRRP6 complements the growth defect of

rrp6∆ yeast strain

To determine whether EhRRP6 could functionally

complement the S. cerevisiae rrp6 mutant, we

expressed EhRRP6 in temperature-sensitive rrp6∆

yeast strain (3). This strain grows normally at

30°C but is severely growth restricted at 37°C.

Successful transformation of yeast cells with the

wt and mutant EhRRP6 was confirmed by PCR

with EhRRP6-specific primers and expression of

EhRrp6 was confirmed by western analysis

(supplemental Fig. S3). Cells transformed with

EhRRP6 grew normally at both 30°C and 37°C,

while those transformed with the EhRRP6

catalytic domain double mutant (D212A, E214A),

or with vector alone were unable to grow at the

non-permissive temperature (Fig. 4). These data

demonstrate that EhRRP6 indeed encodes a

functional protein that can complement the growth

defect in yeast rrp6 mutant strain. Although

EhRRP6 lacks the N-terminal PMC2NT domain

and has shorter C-terminal region (by 164 amino

acids) compared with yeast sequence, its ability to

complement the yeast mutant strain indicates that

EhRRP6 contains the essential sequences required

for Rrp6 activity and the missing sequences could

be dispensable or redundant under the

experimental conditions.

Down-regulation of EhRRP6 leads to

accumulation of 5′-ETS

The role of RRP6 in the removal of 5′-ETS sub

fragments has been well documented both in yeast

and human (6,21,26). To demonstrate a direct

correlation of EhRrp6 levels with 5′-ETS

processing in E. histolytica we down-regulated the

expression of EhRRP6 by using the antisense

expression approach that has been successful in

expression knock-down of a variety of E.

histolytica genes (41,42). Cell-lines were

constructed for ectopically over expressing

EhRRP6 in the sense or antisense orientation using

a vector with tetracycline (tet)-inducible promoter

(43,44) (Fig. 5A). The levels of EhRrp6 were

determined by western blotting. In antisense

EhRRP6-overexpressing cells the levels of EhRrp6

came down by ~1.8 fold of cells transfected with

vector alone, after tet-induction; while conversely

the levels went up ~1.5 fold in sense-

overexpressing cells (Fig. 5B). The level of 5′-

ETS sub fragments was determined in these cell

lines by northern hybridization. We have earlier

shown accumulation of 5′-ETS sub fragments

(0.7-0.9 kb) which migrate as a broad band in

serum-starved E. histolytica cells (36). Very strong

accumulation of these fragments was seen in the

antisense cell line grown for 48 h with tet (Fig.

5C). There was no accumulation of 5′-ETS sub

fragments in sense cell line after 48 h of growth

with tet. Rrp6 is known to be involved in

generating the mature 3′-end of 5.8S rRNA. We

checked for the accumulation of 5.8S 3′-extended

precursor (equivalent to 5.8S+30 in (25,45)) by

quantitative RT-PCR using primer 30 nt

downstream of 5.8S (Fig. 5D). There was ~5-fold

accumulation of 5.8S extended precursor in

EhRrp6-down regulated cells. Down regulation of


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


6

EhRRP6 resulted in severe growth defect in E.

histolytica cells (Fig. 5E). Antisense expressing

cells showed slow growth phenotype even in the

absence of tet, presumably due to some leaky

expression. These cells attained stationary phase at

lower cell density compared with the sense cell

line. Growth of antisense cell line was very slow

in the presence of tet, although cell lysis was not

observed. Over-expression of EhRRP6 did not

seem to elicit a growth phenotype. These data

demonstrate a direct role of EhRRP6 in

degradation of processed 5′-ETS sub fragments

and show that EhRrp6 performs an essential

function in E. histolytica.

Subcellular localization of EhRrp6 in normal

and serum-starved E. histolytica cells

To determine the subcellular distribution of

EhRrp6 protein in E. histolytica we used

polyclonal antibody raised against the recombinant

protein. The specificity of the antibody was

checked by western blot analysis of E. histolytica

total cell lysate (supplemental Fig. S4). The

antibody cross-reacted with a single band of 60

kDa, corresponding to the expected size of

EhRrp6. Trophozoites were stained with this

antibody and co-localization was determined in

nuclei stained with Hoechst. In normal E.

histolytica cells EhRrp6 was concentrated in the

nuclei and there was substantial staining of the

cytosol as well (Fig. 6A). The relative intensity of

nuclear versus cytoplasmic staining was

determined by selecting five random regions of the

cytosol and nucleus per cell and averaging out the

data for ten cells (Fig. 6C). The nuclear staining

intensity was ~3 times higher than cytosol in

normal cells. Thus our data show dual localization

of Rrp6 in nuclei and cytosol of normal E.

histolytica trophozoites. Such dual localization

was also seen in human cell lines and in T. brucei

(12,24,46,47), while in yeast cells the protein was

detected only in the nucleus (26,48). Interestingly,

when E. histolytica cells were subjected to serum

starvation for 24 hrs there was ~3-fold reduction in

the total levels of EhRrp6 in cell-lysates, as

measured by western blotting (Fig. 6D) Transcript

levels, determined by RNA-seq (two biological

replicates), were reduced by ~1.7-fold, indicating a

greater reduction of protein levels (Fig. 6D). In

both cases normalization was done with EhCaBP1

which did not change in starved cells.

Immunofluorescence analysis of these cells

showed almost complete loss of EhRrp6 from

nuclei of serum-starved cells while the cytosolic

staining was maintained (Fig. 6A). Upon

replenishment of serum to starved cells there was

gradual increase in EhRrp6 levels in nuclei, and by

12 hrs the nuclear:cytoplasmic ratio was restored

to that in normal cells (Fig. 6B). The

disappearance of the accumulated 5′-ETS sub

fragments in 24 hrs serum-starved cells after

serum replenishment paralleled the nuclear

restoration of EhRrp6 (Fig. 6E). The preferential

loss of EhRrp6 from nuclei of serum-starved cells

was also demonstrated by sub cellular

fractionation to obtain lysates from cytoplasmic

and nuclear fractions. The protein was detected by

western blotting (Fig. 6F). The E. histolytica

calcium-binding proteins, EhCaBP1 and EhCaBP6

were used as cytoplasmic and nuclear markers,

respectively, as they are known to be exclusively

localized in these compartments (49,50). The data

showed a ~3.5-fold drop in total EhRrp6 levels in

starved cells compared with control (Fig. 6F). The

protein concentration in the cytosolic fraction was

not significantly altered, while there was ~30-fold

reduction of protein in the nuclear fraction. Our

data suggest that the loss of EhRrp6 from nuclear

fraction was not due to increased localization to

the cytosol, as the cytosolic fraction showed no

increase. Interestingly, the mechanism is totally

reversible, with the nuclear:cytoplasmic ratio

being restored within 12 hrs of serum

replenishment.

Further we checked whether depletion of EhRrp6

from the nucleus was specific to serum-starvation

or was a more general stress response.

Immunofluorescence analysis was done with cells

subjected to heat stress or oxidative stress, using

the methods described (51). In both cases the

nuclear staining of EhRrp6 dropped significantly

within 60 min of stress induction and by 90 min

the protein was almost completely lost from the

nucleus (Fig. 6G-I). There was no significant

change in cytoplasmic staining intensity. Hoechst

staining showed that nuclei retained their integrity

in stressed cells and the loss of staining was not

due to nuclear breakdown. Thus the nuclear loss of

EhRrp6 appears to be a general response to growth

stress.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


7

The depletion of EhRrp6 from the nucleus in

serum-starved cells provides an explanation for

our earlier observation that the 5′-ETS sub

fragments, which are known substrates of Rrp6,

accumulate to high levels in serum-starved E.

histolytica cells (36).

The proteasome system is involved in nuclear

loss of EhRrp6 in serum-starved cells

The presence of proteasome has earlier been

demonstrated in E. histolytica (52). Treatment of

cells with specific proteasome inhibitors like

lactacystin and MG-132 has been shown to result

in growth defect and also inhibition of encystation

in Entamoeba invadens (53). To check whether

proteasome inhibition could stall the loss of

EhRrp6 during serum starvation we treated serum

starved cells with lactacystin or MG-132 and

checked EhRrp6 levels by western blotting. In

untreated cells EhRrp6 levels began to decline

within 8 hrs of serum starvation and were <28% of

control by 12 hrs. This decline was not observed in

serum starved cells treated with lactacystin or

MG-132 (Fig 7A) at the concentrations of the

inhibitors shown to block Entamoeba growth (53).

EhRrp6 levels were >79% of control in cells

treated with the inhibitors. This suggests the role

of proteasome in targeting EhRrp6 for degradation

during growth stress.

EhRrp6 is required for E. histolytica growth

and phagocytosis

As already shown, EhRrp6 down regulation led to

severe growth defect (Fig. 5E). To further

understand the involvement of EhRrp6 in cell

growth we determined the time taken for EhRrp6

levels to decrease following tet addition in

antisense cell lines. Tet was added to the culture

six hours after inoculating cells into fresh growth

medium. Cells were removed at different time

points and the levels of EhRrp6 were measured by

western blotting. Tet addition to antisense cells

resulted in gradual decline of EhRrp6 levels, and

by 36 hrs the levels in antisense (+tet) cells were

~25% of cells grown without tet (Fig. 7B).

Conversely, the EhRrp6 levels were elevated ~1.3-

fold in sense cells (+tet). Subsequent experiments

were carried out after 36 hr of tet addition. We

checked whether EhRrp6-depleted cells showed

any hallmarks of apoptosis. From Hoechst staining

we found nuclear integrity to be maintained in

these cells (Fig. 7C). We determined the extent of

blebbing which generally increases in apoptotic

cells. We found ~2-fold reduction in the average

number of blebs per cell in antisense (+tet) cells

(Fig. 7D), which may be due to reduced cell

motility. Indeed, we found ~30% reduction in cell

motility in the antisense (+tet) cells (Fig. 7E), as

determined by trans-well cell migration assay (51).

No appreciable change in cell size was observed.

Thus it is unlikely that EhRrp6-depleted cells

underwent apoptosis. Rather, the reduction in cell

growth may be due to block in cell proliferation.

Since EhRrp6 levels were severely reduced during

growth stress and conversely, reduction of EhRrp6

led to growth arrest (Figs. 5, 6), we checked

whether over expression of EhRrp6 could have a

protective effect during growth stress. The EhRrp6

sense cell line was grown with tet, and at 48 hrs

the cells were subjected to serum starvation. There

was significant increase in cell number in the

EhRrp6 over-expressing cells even after serum

starvation, compared with control cell lines in

which the cell number increased very slightly after

starvation (Fig. 7F). This suggests that the

presence of EhRrp6 could delay the onset of stress

signaling.

Phagocytosis is an essential process for E.

histolytica growth and is required for

pathogenesis. We checked whether EhRrp6 down

regulation had any effect on erythrophagocytosis.

Cells were incubated with RBCs, 36 hrs after tet

addition, by which time the EhRrp6 levels had

declined in the antisense (+tet) cells. RBC uptake,

determined by measuring the absorbance at

different time points, was severely reduced in the

EhRrp6 antisense cells (Fig. 8A). After 10 min,

uptake was only ~50% compared with cells

transfected with vector (+tet). The average number

of phagocytic cups per cell was ~40% in the

antisense cells compared with vector control (Fig.

8B). The sense (+tet) cells behaved the same as

control cells. This showed that EhRrp6 down

regulation had a marked inhibitory effect on

erythrophagocytosis.

To further understand the involvement of EhRrp6

in erythrophagocytosis we checked localization of

EhRrp6 in normal cells during RBC uptake.

EhRrp6 did not localize to the phagocytic cups,


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


8

which were strongly stained with TRITC-

phalloidin due to enrichment of F-actin (Fig. 8C),

nor was it associated with the phagosome. This

indicates that physical involvement of EhRrp6

with the phagocytic machinery was unlikely.

A subset of phagocytosis-related genes are

down regulated in EhRrp6-depleted cells

A large number of E. histolytica genes have been

demonstrated to have direct roles in phagocytosis

(41,49,54-57). We checked the expression levels

of some of these genes in EhRrp6 down regulated

cells by western blotting of total cell lysates with

gene-specific antibodies (Fig. 9A). Expression of

two of the genes (EhCaBP3 and EhRho1) was

significantly reduced in the antisense (+tet) cells

compared with control cells (TOC vector +tet).

Expression was reduced by 1.8-fold and 1.6-fold

of control, respectively. Three of the tested genes

(EhCaBP1, EhCaBP6, EhC2PK) showed no

change in expression, while EhARP2/3 expression

was slightly reduced (85% of vector control).

However, this apparent decrease in EhARP2/3 is

probably not significant as the AS (-tet) cells also

showed the same expression (Fig. 9A).

Immunolocalization studies were done with

EhCaBP3 and EhRho1 (which were down

regulated in antisense cells) and EhCaBP1, which

remained unchanged, was used as control. In the

vector (+tet) and sense (+tet) cell lines EhCaBP3,

EhRho1 and EhCaBP1 all co-localized with

Ehactin at the phagocytic cups, as expected for

normal E. histolytica cells. All of these proteins

were significantly enriched in phagocytic cups

compared with cytosol as determined

quantitatively (Fig. 9B). However, in the

antisense (+tet) cell line the pattern was different.

As expected, staining for EhRrp6 was very low in

these cells and it was low both in the nucleus and

cytosol. Staining intensity of EhRho1 and

EhCaBP3 was also extremely low in these cells,

whereas the level of EhCaBP1 was comparable

with control. No enrichment of EhRho1 and

EhCaBP3 could be seen at the phagocytic cups,

whereas Ehactin and EhCaBP1 were enriched at

phagocytic cups in these cells and were

colocalized (Fig. 9B). We conclude that EhRrp6

down regulation specifically affected the levels of

selected proteins in the phagocytic pathway rather

than a generalized inhibitory effect on all genes.

To determine whether the drop in protein levels of

EhRho1 and EhCaBP3 could be due to

translational defect we checked the transcript

levels of these genes by quantitative RT-PCR and

found ~6.3-fold and ~3.2-fold reduction of

EhCaBP3 and EhRho1 transcripts, respectively

and no change in EhC2PK. EhCaBP1 was used as

internal control (Fig. 9C). Since the fold-reduction

in protein levels did not exceed the drop in

transcript levels, it appears unlikely that EhRrp6

down regulation affects the translation of

EhCaBP3 and EhRho1. We conclude that EhRrp6

is required for maintaining the transcript levels of

these key phagocytosis-related genes.

DISCUSSION

The 3′-5′ exoribonuclease encoded by RRP6 is

involved in 3′-end processing of a variety of stable

RNA precursors including pre-rRNAs, snRNAs

and snoRNAs and in transcription termination and

regulation of poly (A) tail length. It is also

required for removal of aberrant transcripts and

cryptic unstable transcripts and is thus a key

enzyme in RNA homeostasis (58,59). Here we

have undertaken a detailed study of this

exonuclease in the protozoan parasite E.

histolytica, in which the 5′-ETS sub fragments of

pre-rRNA are found to accumulate under growth

stress. The excised 5′-ETS is a known target of

degradation by Rrp6 in other organisms and

accumulates in rrp6 mutant cells (2,12,60).

Rrp6 works in conjunction with the exosome. We

found overall conservation of the core exosome in

E. histolytica; the major difference being absence

of Csl4 subunit. While CSL4 is essential in yeast,

mutant strains with truncated versions that lack

NTD or S1 domain are viable, and the Zn-ribbon

domain is not essential in vivo. In addition it has

been shown that Csl4 is not stably associated with

exosomes in vitro (61). Absence of CSL4 has also

been reported in another protozoan parasite, G.

lamblia (37) and may be a more common feature

in early eukaryotic evolution.

Sequence analysis and comparative modelling of

EhRrp6 showed high conservation of structure in

the catalytic EXO domain and HRDC domain.

EhRrp6 lacked the N-terminal PMC2NT domain

found in both yeast and human Rrp6. This domain

is also present in the T. brucei Rrp6 (38) and in


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


9

one of the three Rrp6 isoforms of Arabidopsis

thaliana (12). It interacts with Rrp47 which

promotes the catalytic activity of Rrp6 and may

also have a role in maintaining appropriate

expression levels of Rrp6 (33,62). Rrp47 both

from yeast and human (called C1D) binds

structured nucleic acids and is thought to promote

Rrp6 activity by facilitating its binding to

structural elements within RNA, for example

helices at the 3′ termini (32,33). We could not find

any sequence homologous to RRP47 in the E.

histolytica data base. It appears that this gene may

be missing in E. histolytica and consequently its

interacting domain in EhRRP6 is also absent. In

this context it was interesting that EhRRP6 could

complement the ts growth defect of Scrrp6∆

mutant. The same observation was also made in A.

thaliana in which the isoform that lacked

PMC2NT domain (AtRRP6L1) could complement

the ts growth defect of Scrrp6∆, while AtRRP6L2

in which this domain is present could not (11,12).

It is possible that Rrp6 enzymes that have evolved

to function in the absence of PMC2NT domain

could use alternative mechanisms for structured

RNA recognition. In yeast the N-terminal domains

of Rrp6 and Rrp47 interact to provide a surface for

the binding of MTR4 helicase (63), which is

involved in unwinding the 3′-tail of RNA substrate

so that it can be threaded into the exosome channel

(64,65). The homologue of MTR4 is present in E.

histolytica and it may be recruited to the exosome

by a different mechanism independent of Rrp47.

In yeast the Rrp6 C-terminal domain (CTD) is

required for binding to the core exosome and for

degrading poly(A)+ rRNA processing products

(35). The CTD encompasses amino acid residues

518–733 which contain two distinct elements.

Residues 518–616 constitute the Exosome

Associating Region (EAR), and adopt structure

when associated with Exo9 (23). Residues 634–

733 are disordered and are rich in lysine and

arginine, with a calculated isoelectric point of

10.3. This C-terminal tail is called lasso as it binds

RNA and stimulates RNase activities of Rrp44 and

Rrp6 within the exosome. The CTD of EhRrp6 is

very short and encompasses only 54 amino acids.

Although its calculated isoelectric point is basic

(8.32), it is not as much enriched in lysine and

arginine residues as the yeast and human Rrp6

lasso. The prokaryotic RNase D family also lacks

a highly basic lasso (27). Further analysis of Rrp6

from a variety of eukaryotes is required to

establish the extent of conservation of highly basic

lasso in eukaryotic Rrp6 (23).

Human Rrp6 has been shown to more efficiently

degrade generic RNA substrate, with secondary

structure, beyond the stem-loop compared with

yeast Rrp6. This is attributed to the structure of

yeast catalytic domain in which the active site is

located in a deep cleft. In comparison, the

structure of the human catalytic domain shows the

active site to be more solvent exposed, which

could allow access to the 3′-end of structured RNA

(28). This structural difference in Rrp6 is due to

difference in the length of linker that connects the

EXO and HRDC domains (28,29). In yeast the

linker is 26 residues, but in humans, the linker is

only 10 residues and in T. brucei it is 12 residues

(38). The shorter linker results in a more solvent

exposed Rrp6 active site in human and T. brucei

Rrp6. Our comparative modelling analysis showed

the linker length in EhRrp6 to be 9 residues and

the enzyme is predicted to have a more accessible

active site. Accordingly, EhRrp6 could efficiently

degrade a generic RNA substrate with secondary

structure.

Under normal growth conditions EhRrp6 was

located both in the nucleus and cytosol.

Interestingly, we show that EhRrp6 is almost

completely lost from the nucleus when cells are

subjected to growth stress by serum starvation.

Conversely, down regulation of this protein

resulted in severe growth stress (Fig. 5). It is

possible that this protein could be a stress sensor

in E. histolytica and its nuclear loss may trigger

cellular reprogramming in response to stress. A

similar observation has been reported in budding

yeast cells in response to changes in nutritional

status, like nitrogen starvation in the presence of a

non-fermentable carbon source which induces the

cells to undergo meiosis and sporulation. The Rrp6

protein which is stable during mitotic growth,

declines progressively as the developmental

program shifts from mitotic growth (fermentation)

to respiration and sporulation (66). Although

serum starvation is not known to induce E.

histolytica cells to differentiate in culture, this

nutritional limitation stops cell division and

possibly triggers pathways that prepare the cell to


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


10

survive in a maintenance mode. The loss of Rrp6

in sporulating yeast cells leads to elevated levels

of ncRNAs like MUTs, CUTs and rsSUTs which

are direct targets of Rrp6 during vegetative

growth. It is thought that Rrp6 negatively regulates

meiotic development by maintaining these

ncRNAs at low levels. It is possible that EhRrp6 is

also involved in degradation of specific ncRNAs,

which needs to be explored. The decline in

EhRrp6 protein levels in stressed cells could be

reversed with proteasomal inhibitors, suggesting

that the loss of EhRrp6 may be through

proteasomal degradation. It is not known whether

the same happens in sporulating yeast as well.

The down regulation of EhRrp6 resulted in a

severe growth phenotype, showing that this

protein is essential for E. histolytica cell

proliferation. The requirement of Rrp6 in proper

mitotic cell division has been demonstrated in

Drosophila as well. It was shown that dRrp6 is

needed for mitosis (in exosome-independent

manner), and that down regulation of dRrp6 led to

chromosome segregation defects and reduction in

the number of dividing cells (67). dRrp6 depletion

did not induce apoptosis but caused a loss of cell

proliferation. In our study also we did not find any

evidence of apoptosis in cells depleted of EhRrp6.

The mechanism by which Rrp6 depletion leads to

mitotic defect is not yet understood. Its depletion

could stabilize specific mRNAs or small

regulatory RNAs with roles in mitosis (67).

Interestingly, Rrp6 could also be involved in

physical stabilization of mitotic structures (68,69).

One of the determinants of E. histolytica

pathogenesis is its ability to phagocytose target

cells. The presence of ingested erythrocytes is a

hallmark of virulent strains (70). Depletion of

EhRrp6 resulted in marked reduction in

erythrophagocytosis, which was not due to general

down regulation of genes known to be essential for

E. histolytica phagocytosis (41,49,54-57). Of the

six genes tested, the expression of two of them

(EhCaBP3, EhRho1) came down (Fig. 9). Both the

mRNA and protein levels were reduced. Since

both these proteins have been shown to modulate

actin dynamics it is not surprising that reduction in

their levels led to reduced phagocytosis (54,55).

How EhRrp6 specifically targets selected genes is

intriguing and needs to be further investigated.

In conclusion, we have biochemically

characterized EhRrp6, a 3′-5′ exoribonuclease that

is lost from the nucleus during growth stress in E.

histolytica. Its down regulation adversely affected

amoebic growth and phagocytosis, a process

required for E. histolytica pathogenesis. This is

the first report of subcellular changes in Rrp6

levels in a parasite system responding to growth

stress. This important regulatory system may well

mediate parasite response to the host environment

and in pathogenesis.

EXPERIMENTAL PROCEDURES

Ethics statement

Mice used for generation of antibodies were

approved by the Institutional Animal Ethics

Committee (IAEC), Jawaharlal Nehru University

(IAEC code no.: 19/2013), New Delhi, India. All

animal experimentations were performed

according to the National Regulatory Guidelines

issued by CPSEA (Committee for the Purpose of

Supervision of Experiments on Animals), Ministry

of Environment and Forests, Govt. of India.

Cell culture, maintenance and stable

transfection of E. histolytica trophozoites Trophozoites of E. histolytica strain HM-1: IMSS

and all transformed strains were maintained and

grown in TY1-S-33 medium supplemented with

125 μl of 250 U ml− 1 penicillin G (potassium salt

from Sigma) and 0.25 mg ml− 1 streptomycin per

100 ml of medium as described before (71). For

serum starvation E. histolytica trophozoites

growing for 48 h in medium containing 15% adult

bovine serum were transferred to low-serum

(0.5%) medium. To make sense and antisense

EhRrp6 expressing cell lines, E. histolytica was

transfected by electroporation (42). Drug selection

was initiated after 2 days of transfection in the

presence of 10 μg ml−1 hygromycin B (for

tetracycline inducible vector) (44). For induction,

tetracycline (30 μg ml− 1) was added 6 to 12 hrs

after sub-culture to the medium for the indicated

time periods. Cells were harvested after 48 hrs for

western blot.

Comparative sequence analysis, Comparative

modeling and Molecular Dynamics simulation

of EhRrp6


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


11

To identify the Rrp6 protein in E. histolytica, we

took the Rrp6 protein sequences from H. sapiens

(NP_001001998), S. cerevisiae (NP_014643) and

T. brucei (XP_844313) and performed searches

using NCBI protein BLAST (two methods: blastp

and PSI-BLAST with default parameters) against

the non-redundant (nr) protein database of E.

histolytica HM-1:IMSS-A (taxid:885318)(72).

Two matrices BLOSSUM62 and PAM250 and

word size of 2, 3 and 6 were used to search for

suitable protein. The threshold value for cutoff

was set to 0.005 and all other parameters were

kept as default. Multiple sequence alignment and

phylogenetic tree construction methods are

explained in supplemental method SM1.1. EhRrp6

structure (EXO and HRDC domain, amino acid

sequence range 183 to 463) was modelled using

two templates in Modeller (v-9.14) (73). Two

Rrp6 proteins, one from H. sapiens (PDB ID:

3SAF) and other from S. cerevisiae (PDB ID:

2HBK) having sequence identity 44% (Query

coverage 99%) and 45% (Query coverage 90%)

respectively were selected as templates for

modelling after performing protein BLAST

against Protein Data Bank PDB (http://www.

rcsb.org/ ) through NCBI BLAST web interface

with default settings (72,74). EhRrp6 best

modelled structure was selected on the basis of

DOPE score and qualitatively evaluated using

ProSA web server

(https://prosa.services.came.sbg.ac.at/prosa.php)

(75) and PROCHECK (76). The two Magnesium

ions (Mg2+) in the catalytic pocket of EhRrp6 were

placed at the same position where Manganese

(Mn2+) and Magnesium (Mg2+) are located in

2HBK and 3SAF respectively through structural

alignment. Molecular Dynamics (MD) simulation

of native and mutant EhRrp6 forms is described in

supplemental methods SM1.2. Graphs were

plotted using Python Matplotlib library (77).

UCSF chimera (1.10.2) was used for structural

comparison and visualization (78).

Cloning, Protein expression and purification

The E.histolytica RRP6 gene (EHI_021400) was

PCR-amplified from genomic DNA using Phusion

DNA polymerase. Digested PCR products were

cloned in pET-30(b) vector. Point mutations of

EhRRP6 were introduced by site-directed

mutagenesis. The presence of mutations was

confirmed by nucleotide sequencing. S1 Table

shows the list of primers used to generate the wild

type and mutant constructs. E.coli Shuffle (DE3)

(Novagen) was transformed with the pET30b-

EhRRP6 constructs. For protein expression, 1% of

overnight grown culture of a single colony was

added to 2 liter of Luria-Bertani (LB) broth

(Sigma) containing kanamycin (50 μg/ml). Cells

were grown to OD600 of 0.6 at 37°C. The cell

culture was induced with 0.25 mM IPTG

(isopropyl-β-D-thiogalactopyranoside) and shaken

overnight at 18°C. The cells were harvested at

5,000 rpm for 20 min and stored at −80°C for later

use. The first step of purification was carried out

using Ni-NTA (Qiagen, Germany) affinity

chromatography. The cell pellets stored at −80°C

were thawed and mixed with lysis buffer (50 mM

Tris-HCl [pH 8.0], 300 mM NaCl, 10 mM

imidazole, 5% glycerol, 1mM β-mercaptoethanol

[βME], 1mM phenylmethylsulfonyl fluoride

[PMSF]). After the addition of lysozyme (0.15

mg/ml), the cell suspension was incubated at 4°C

for 30 min. The cell suspension was sonicated

(QSonica Ultrasonic Systems) in an ice-water

mixture at 25% of the amplitude with a pulse

(three to four cycles) of 30 s each interspersed

with a 1 min interval. Cell lysate was treated with

0.1% Triton X-100, followed by incubation for 30

min on a rotating rocker (Nulife) at 4°C.The lysate

was then centrifuged at 15,000 rpm for 30 min at

4°C. Supernatant was passed through Ni-NTA

column (QIAGEN) equilibrated with buffer (20

mM Tris-HCl [pH 8.0], 300 mM NaCl, 1 mM

βME, and 10 mM imidazole). After washing

(Washing buffer: 20 mM Tris-HCl [pH 8.0], 300

mM NaCl, 50mM KCl, 2mM ATP, 10mM

MgSO4, 1 mM βME) with a gradient of imidazole

from 25 to 150 mM, protein was eluted with buffer

(20 mM Tris-HCl, 150 mM NaCl, 1 mM βME, 5%

glycerol & 250 mM imidazole).The concentrated

protein was loaded on a gel permeation

chromatography Superdex 200 10/300 GL column

(GE Healthcare), which was previously

equilibrated with buffer (20 mM Tris-HCl [pH

8.0], 150 mM NaCl, 5% glycerol & 1mM

βME).The protein fractions were pooled and

dialyzed against (20 mM Tris-HCl [pH 8.0], 50

mM NaCl, 5% glycerol, & 1mM βME) then

concentrated using an Amicon Ultra-15

Centrifugal Filter Unit with Ultracel-30 membrane

(Millipore) to ∼2.5 mg/ml. The protein


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


12

concentration was determined by Bradford method

and stored at -80°C.

For tetracycline inducible expression of EhRRP6

in E. histolytica, CAT gene of the shuttle vector

pEhHYG-tet-O-CAT (44) was excised using KpnI

and BamHI and EhRRP6 gene was inserted in its

place in either the sense or the antisense

orientation.

EhRrp6 exonuclease assays

To check the 3′-5′ exoribonuclease activity of

purified EhRrp6, 5′ [32P] labeled RNA was taken

as substrate. The 50-nt AU-rich RNA and 60 nt

generic RNA had the sequences-

5′GAAUUAUUUAUUAUUUAUUUAUUAUUU

AUUUAUUUAUUAUUUAUUUAUUA3′and

5′GAGCUAGGAAGAAUAGAUGAAAAAUCU

AUUAAUAUAUAAUUAAUUACUUUUUUUU

UUUUU-3′. RNAs were heated at 95°C for 2 min

and cooled to room temperature prior to

determining activities. To label the in vitro–

transcribed RNA at its 5′ end, it was

dephosphorylated using Antarctic Phosphatase,

followed by rephosphorylation catalyzed by T4

polynucleotide kinase in the presence of

[γ32P]ATP. Exoribonuclease activities were

performed in a 10-μL reaction mixture of 10 mM

Tris-HCl (pH 8.0), 10 mM DTT, 50 mM KCl, 5

mM MgCl2, 1 U/μL RNAse inhibitor (NEB),

10µM RNA and 1uM protein at 37°C. Single-

point assays of mutant EhRrp6 were conducted for

120 min. Reactions were quenched by the addition

of 10 μL of loading buffer (95% formamide, 20

mM EDTA, 1% DNA loading dye) and snap

chilled in ice-water. Samples were loaded onto a

15% polyacrylamide-8M urea gel for

electrophoresis. Gels were imaged using a Fuji

FLA-5000 scanner. For DNA substrates the

following sequence (40) was used as ssDNA and

was annealed with its homologue to obtain ds

DNA, which was checked on native gel.

>SINE-1ssDNA

5′CCCCTGAGCTAGGAAGAATAGATGAAAA

ATCTATTAATACTTAATTAATTACTTTTTTC

TTTTTA-3′

Yeast complementation

EhRRP6 cDNAs were cloned into pRS 426-GPD

and transformed into wild-type (BY4742) and

rrp6Δ (Dharmacon 11777) yeast strains using the

lithium acetate method (79). Following selection

at 30°C, the cells were tested for growth at 30°C

and 37°C.

Immunofluorescence staining

Immunofluorescence staining of E. histolytica

cells was performed as described before (41). In

brief, E. histolytica cells were collected by

centrifugation and washed before re-suspending in

TYI-S-33 medium. The cells were transferred onto

acetone-cleaned coverslips placed in a petri dish

and allowed to adhere for 10 min at 35.5 °C. The

culture medium was removed and cells were fixed

with 3.7% pre-warmed paraformaldehyde for 30

min. Cells were permeabilized with 0.1% Triton

X-100/PBS for 3 min. The fixed cells were then

washed with PBS and quenched for 30 min in PBS

containing 50 mM NH4Cl. The coverslips were

blocked with 1% BSA/PBS for 30 min, followed

by incubation with primary antibody at 37 °C for 1

h. The coverslips were washed with PBS followed

by 1% BSA/PBS before incubation with secondary

antibody for 30 min at 37 °C. Antibody dilutions

used were: anti-EhRrp6/anti-EhARPC2/anti-

EhRho1 at 1:100, anti-EhCaBP1/anti-

EhCaBP3/anti-EhC2PK/anti-EhCaBP6 at 1:200

and anti-r-EhCaBP6 at 1:300, anti-rabbit/mice

Alexa 488, Pacific blue-410 (Molecular Probes) at

1:250, TRITC-Phalloidin at 1:250. The

preparations were further washed with 1X PBS

and stained with Hoechst (20 μg/ml) for 10 min at

37°C. The cells were washed thoroughly with 1X

PBS and mounted on a glass slide using DABCO

(1, 4-diazbicyclo (2,2,2) octane (Sigma) 10 mg/ml

in 80% glycerol). The edges of the coverslip were

sealed with nail-paint to avoid drying. Confocal

images were visualized using a Nikon Real Time

Laser Scanning Confocal Microscope (Model

A1R).The raw images were processed using NIS

element 3.20 (Nikon) that included merging of

AlexaFluor 488, Hoechst and DIC channels,

acquisition of intensity profile, determination of

intensity at the region of interest.

RNA isolation and northern hybridization

Cells were removed at different time points. Total

RNA from ∼5 × 106 cells was purified using


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


13

TRIzol reagent (Invitrogen) according to the

manufacturer’s instructions. For northern analysis

10 μg of total RNA was resolved on 1.2%

formaldehyde agarose gel in gel running buffer

[0.1 M MOPS (pH 7.0), 40 mM sodium acetate,

5 mM EDTA (pH 8.0)] and 37% formaldehyde at

4 V/cm. The RNA was transferred on to

GeneScreen plus R membrane (PerkinElmer). α-

P32dATP labeled probe was prepared by random

priming method using DecaLabel DNA labeling

kit (Thermo Scientific). Hybridization and

washing conditions for RNA blots were as per

manufacturer instructions.

Total cell lysate preparation

E. histolytica trophozoites were harvested at

280xg for 7 min/ 4°C. The pellet was washed with

cold PBS # 8, resuspended in 50 mM Tris-Cl pH

7.0, 5% glycerol, 2% SDS and 1X protease

inhibitor cocktail (Sigma) and kept at 95°C/ 5 min.

The sample was centrifuged at 13000 g/ 5 min.

The supernatant was collected and quantification

was done by bicinchoninic acid (BCA). Yeast cell

lysate was prepared according to Shirai A, et al

(80). Cells were harvested, 0.7N NaOH solution

was added and sample was incubated for 3

min/RT. The cells were centrifuged and SDS-

PAGE sample buffer was added. The sample was

heated at 95°C/10 min and supernatant obtained

after centrifugation was loaded.

Sub-cellular fractionation

Separation of nuclear and cytosolic fractions was

essentially done as described (81). Briefly, ∼107

cells growing in log phase were harvested at

280xg for 7 min at 4°C and cell pellet was washed

with PBS # 8. The washed pellet was resuspended

in 2ml lysis buffer [10mM HEPES pH=7.5,

1.5mM MgCl2, 10mM KCl, 0.5mMDTT, 0.2%

NP-40 detergent and protease inhibitor cocktail)

and incubated on ice, 15 min followed by

centrifugation at 3000xg for 10 min at 4°C. The

pellet contained the nuclear fraction and

supernatant contained cytoplasmic fraction.

Nuclear integrity was checked by microscopy.

Nuclear pellet was resuspended in 50ul of lysis

buffer added with 0.5% Triton X-100 and protein

content of each fraction was estimated by BCA

assay.

Western blotting

Samples were separated on 15% SDS–PAGE and

the gel was transferred on to a polyvinylidine

fluoride (PVDF) membrane by wet transfer

method and processed using standard protocols.

The antigens were detected with polyclonal anti-

EhRrp6 (1∶2000), EhCoactosin (1:5000) (raised in

mice) or anti-EhCaBP1, EhCaBP6 raised in

rabbits (1∶5000, raised in our laboratory) and anti-

α-tubulin antibody (Sigma Cat No.T6199)

followed by secondary anti-rabbit or anti-mouse

immunoglobulins conjugated to HRPO at 1∶10,000

dilution (Sigma, Cat No. A6667 or A2554). ECL

reagents were used for visualization (Millipore).

Protein concentration was estimated by BCA assay

using BSA as a standard. Quantification of band

intensity in each lane was done by densitometry

using ImageJ software and values were normalized

using respective internal control.

RNA-Seq transcriptome sequencing

Total RNA was purified from exponentially

growing E. histolytica cells (and 24h serum

starved cells) using TRIzol reagent (Invitrogen)

and used for selection of polyA plus RNA and

library preparation was done after oligo (dT)

selection. RNA-Seq libraries were generated by

performing RNA fragmentation, random hexamer

primed cDNA synthesis, linker ligation and PCR

enrichment. These libraries were then sequenced

on the Illumina HiSeq 2500 (v3 Chemistry)

platform. From paired-end reads low quality

sequences were removed including non-polyA

tailed RNAs using bowtie2 (version 2.2.2) and in-

house Perl scripts. About 35 million reads were

obtained and on an average, ∼90.13% of total

reads passed > = 30 Phred score. The reads were

aligned to the E. histolytica (HM1:IMSS) total

genome, downloaded from AmoebaDB, using

RSEM v1.2.31 with default parameters and

commands: “rsem- prepare-reference” and “rsem-

calculate-expression”. The data were obtained for

two biological replicates.

Erythrophagocytosis assay

The assay was performed essentially as described

(41). E. histolytica trophozoites were harvested in

1X PBS (pH 7.2) and equal numbers (105 cells)

were incubated with 107 RBCs for the indicated

times, at 37°C in 0.5 ml of culture medium. The

amoebae and erythrocytes were centrifuged and


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


14

cold distilled water was added to lyse the non-

engulfed RBCs and re-centrifuged at 1,000 g for 2

min. This step was repeated twice, followed by re-

suspension in 1 ml formic acid to lyse Entamoeba

cells containing engulfed RBCs. The absorbance

was measured at 400 nm with formic acid as

blank.

Cell proliferation and cell migration assay

Growth kinetics was studied by inoculating equal

number of cells (3x104 cells/ml). The cells were

allowed to grow at 35.5°C in 5 ml or 7 ml tubes

and harvested at 12, 24, 36, 48, and 72 h post

inoculation. The cells were harvested in 1X PBS

(pH 7.2) by chilling on ice followed by

centrifugation at 1,500Xg for 5 min. The cell

pellet was resuspended in 1 ml 1X PBS (pH 7.2).

The cells were counted with haemocytometer by

mixing cells with 0.4% Trypan blue in a ratio of

1:1. At every time point, the cells were harvested

and counted as mentioned above. For motility

assay, experiments were carried out as described

before (51). 1.5 × 105 harvested amoebic cells

were added to top chamber of transwell containing

8 μM pore size (Costar, USA) in incomplete TYI

medium. TYI medium with 15% serum was placed

in lower chamber. A 24‐well plate was sealed with

parafilm and placed in anaerobic bag for 2 hr at

35.5°C. Parasites migrated in the bottom chamber

were chilled, transferred to a microcentrifuge tube,

centrifuged at 1,000 g for 5 min, resuspended in

TYI medium, and quantified with a

haemocytometer. Each experiment was performed

in triplicate. The standard error bars were

calculated and represented.

Real-time quantitative reverse transcriptase

PCR

Total RNA was extracted by the TRIzol reagent

(Invitrogen) and cDNA was synthesized by the

Verso cDNA Synthesis kit (Thermo Scientific),

followed by PCR amplification, using the listed

primers: EhCaBP3 forward primer

5′atggacaagaagtagattcaaccgaagat 3′; reverse primer

5′agctctgaagctgaaatgtagcc3′; EhRho1 forward

primer 5′tgatatgaacactggtgctggt 3′; reverse primer

5′agcggttgggatttcaccttt3′; EhCaBP1 forward

primer 5′aatcataaactaatggctgaagcac3′; reverse

primer 5′cataagagacagctccatctcca3′; EhC2PK

forward primer 5′ccacaagaacgagctacagca3′;

reverse primer 5′cattcattgatgctgtgggatga3′. FP1

(5.8S rRNA) 5′ctttggatagtttagtttcctgggc3′; RP1

(5.8S rRNA) 5accttgaagttcataagtatactttc3′; FP2

(5.8S+30nt rRNA) 5′ tgtgaatatccaaaatttgaatgc 3′;

RP2 (5.S+30 rRNA)

5′ctctgttgtacttgcattggattttaatatatgctc3′ Reactions

were carried out using Power SYBR Green PCR

Master Mix (Applied Biosystems) on the 7500

Fast Real-Time PCR System (Applied Biosystems)

by denaturation at 95°C for 10 min, followed by

40 cycles at 95°C for 15 s and 60°C for 40 s.

Melting curve analyses were performed to verify

the amplification specificity. Relative

quantification of gene expression was performed

according to the ΔΔ-CT method using 7500

Software v2.3 (Applied Biosystems).

Statistical analysis

Statistical comparisons were made using ANOVA

test. Experimental values were reported as the

mean ± SD. Differences in mean values were

considered significant at “one black star” p-value

≤0.05, “two black star” p-value ≤0.01, “three black

star” p-value ≤0.001. All calculations of statistical

significance were made using the GraphPad InStat

software package (GraphPad Prism 7).

ACKNOWLEDGMENTS: This work was supported by J.C. Bose national fellowship and Board of

Research in Nuclear Sciences (BRNS) to SB, Council of Scientific and Industrial Research fellowship to

SSS, AK, and SN. NS acknowledges University Grant Commission funded UPE-II for providing partial

financial assistance. We acknowledge AIRF, JNU, for providing instrumental support and Dr. Prabhat

Kumar for confocal microscopy. We are grateful to Biswadip Das for helpful comments and suggestions.

CONFLICT OF INTEREST: The authors declare that they have no conflicts of interest with the

contents of this article.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


15

AUTHOR CONTRIBUTIONS: Study design: SSS, SB; Study conduct: SSS, AK, RB; Data analysis:

SSS, SB, AB, NS, AK, SN, RB, YPS, and AKR; Data interpretation: SB, SSS, NS, AK and AB; Drafting

manuscript: SB, SSS. Approving final version of manuscript: SB, AB and NS; SB, SSS, AK and RB take

responsibility for the integrity of data analysis.

FOOTNOTES

Abbreviation used are: nt, nucleotide; ts, temperature sensitive; ncRNA, non-coding RNA.

REFERENCES:

1. Woolford, J. L., Jr., and Baserga, S. J. (2013) Ribosome biogenesis in the yeast Saccharomyces cerevisiae. Genetics 195, 643-681

2. Allmang, C., Mitchell, P., Petfalski, E., and Tollervey, D. (2000) Degradation of ribosomal RNA precursors by the exosome. Nucleic acids research 28, 1684-1691

3. Allmang, C., Petfalski, E., Podtelejnikov, A., Mann, M., Tollervey, D., and Mitchell, P. (1999) The yeast exosome and human PM-Scl are related complexes of 3' --> 5' exonucleases. Genes & development 13, 2148-2158

4. de la Cruz, J., Kressler, D., Tollervey, D., and Linder, P. (1998) Dob1p (Mtr4p) is a putative ATP-dependent RNA helicase required for the 3' end formation of 5.8S rRNA in Saccharomyces cerevisiae. The EMBO journal 17, 1128-1140

5. Henras, A. K., Soudet, J., Gerus, M., Lebaron, S., Caizergues-Ferrer, M., Mougin, A., and Henry, Y. (2008) The post-transcriptional steps of eukaryotic ribosome biogenesis. Cellular and molecular life sciences : CMLS 65, 2334-2359

6. Sloan, K. E., Bohnsack, M. T., Schneider, C., and Watkins, N. J. (2014) The roles of SSU processome components and surveillance factors in the initial processing of human ribosomal RNA. Rna 20, 540-550

7. Lebreton, A., Tomecki, R., Dziembowski, A., and Seraphin, B. (2008) Endonucleolytic RNA cleavage by a eukaryotic exosome. Nature 456, 993-996

8. Schaeffer, D., Tsanova, B., Barbas, A., Reis, F. P., Dastidar, E. G., Sanchez-Rotunno, M., Arraiano, C. M., and van Hoof, A. (2009) The exosome contains domains with specific endoribonuclease, exoribonuclease and cytoplasmic mRNA decay activities. Nature structural & molecular biology 16, 56-62

9. Delan-Forino, C., Schneider, C., and Tollervey, D. (2017) Transcriptome-wide analysis of alternative routes for RNA substrates into the exosome complex. PLoS genetics 13, e1006699

10. Zakrzewska-Placzek, M., Souret, F. F., Sobczyk, G. J., Green, P. J., and Kufel, J. (2010) Arabidopsis thaliana XRN2 is required for primary cleavage in the pre-ribosomal RNA. Nucleic acids research 38, 4487-4502

11. Sikorski, P. J., Zuber, H., Philippe, L., Sement, F. M., Canaday, J., Kufel, J., Gagliardi, D., and Lange, H. (2015) Distinct 18S rRNA precursors are targets of the exosome complex, the exoribonuclease RRP6L2 and the terminal nucleotidyltransferase TRL in Arabidopsis thaliana. The Plant journal : for cell and molecular biology 83, 991-1004

12. Lange, H., Holec, S., Cognat, V., Pieuchot, L., Le Ret, M., Canaday, J., and Gagliardi, D. (2008) Degradation of a polyadenylated rRNA maturation by-product involves one of the three RRP6-like proteins in Arabidopsis thaliana. Molecular and cellular biology 28, 3038-3044

13. Wang, M., and Pestov, D. G. (2011) 5'-end surveillance by Xrn2 acts as a shared mechanism for mammalian pre-rRNA maturation and decay. Nucleic acids research 39, 1811-1822


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


16

14. Makino, D. L., Baumgartner, M., and Conti, E. (2013) Crystal structure of an RNA-bound 11-subunit eukaryotic exosome complex. Nature 495, 70-75

15. Mitchell, P., Petfalski, E., Shevchenko, A., Mann, M., and Tollervey, D. (1997) The exosome: a conserved eukaryotic RNA processing complex containing multiple 3'-->5' exoribonucleases. Cell 91, 457-466

16. Parker, R., and Song, H. (2004) The enzymes and control of eukaryotic mRNA turnover. Nature structural & molecular biology 11, 121-127

17. van Hoof, A., Frischmeyer, P. A., Dietz, H. C., and Parker, R. (2002) Exosome-mediated recognition and degradation of mRNAs lacking a termination codon. Science 295, 2262-2264

18. Kadaba, S., Krueger, A., Trice, T., Krecic, A. M., Hinnebusch, A. G., and Anderson, J. (2004) Nuclear surveillance and degradation of hypomodified initiator tRNAMet in S. cerevisiae. Genes & development 18, 1227-1240

19. Maquat, L. E., and Carmichael, G. G. (2001) Quality control of mRNA function. Cell 104, 173-176 20. Isken, O., and Maquat, L. E. (2007) Quality control of eukaryotic mRNA: safeguarding cells from

abnormal mRNA function. Genes & development 21, 1833-1856 21. Allmang, C., Kufel, J., Chanfreau, G., Mitchell, P., Petfalski, E., and Tollervey, D. (1999) Functions

of the exosome in rRNA, snoRNA and snRNA synthesis. The EMBO journal 18, 5399-5410 22. Wasmuth, E. V., Januszyk, K., and Lima, C. D. (2014) Structure of an Rrp6-RNA exosome complex

bound to poly(A) RNA. Nature 511, 435-439 23. Wasmuth, E. V., and Lima, C. D. (2017) The Rrp6 C-terminal domain binds RNA and activates the

nuclear RNA exosome. Nucleic acids research 45, 846-860 24. Lykke-Andersen, S., Tomecki, R., Jensen, T. H., and Dziembowski, A. (2011) The eukaryotic RNA

exosome: same scaffold but variable catalytic subunits. RNA biology 8, 61-66 25. Briggs, M. W., Burkard, K. T., and Butler, J. S. (1998) Rrp6p, the yeast homologue of the human

PM-Scl 100-kDa autoantigen, is essential for efficient 5.8 S rRNA 3' end formation. The Journal of biological chemistry 273, 13255-13263

26. Phillips, S., and Butler, J. S. (2003) Contribution of domain structure to the RNA 3' end processing and degradation functions of the nuclear exosome subunit Rrp6p. Rna 9, 1098-1107

27. Zuo, Y., Wang, Y., and Malhotra, A. (2005) Crystal structure of Escherichia coli RNase D, an exoribonuclease involved in structured RNA processing. Structure 13, 973-984

28. Januszyk, K., Liu, Q., and Lima, C. D. (2011) Activities of human RRP6 and structure of the human RRP6 catalytic domain. Rna 17, 1566-1577

29. Midtgaard, S. F., Assenholt, J., Jonstrup, A. T., Van, L. B., Jensen, T. H., and Brodersen, D. E. (2006) Structure of the nuclear exosome component Rrp6p reveals an interplay between the active site and the HRDC domain. Proceedings of the National Academy of Sciences of the United States of America 103, 11898-11903

30. Assenholt, J., Mouaikel, J., Andersen, K. R., Brodersen, D. E., Libri, D., and Jensen, T. H. (2008) Exonucleolysis is required for nuclear mRNA quality control in yeast THO mutants. Rna 14, 2305-2313

31. Mitchell, P., Petfalski, E., Houalla, R., Podtelejnikov, A., Mann, M., and Tollervey, D. (2003) Rrp47p is an exosome-associated protein required for the 3' processing of stable RNAs. Molecular and cellular biology 23, 6982-6992

32. Schilders, G., van Dijk, E., and Pruijn, G. J. (2007) C1D and hMtr4p associate with the human exosome subunit PM/Scl-100 and are involved in pre-rRNA processing. Nucleic acids research 35, 2564-2572

33. Stead, J. A., Costello, J. L., Livingstone, M. J., and Mitchell, P. (2007) The PMC2NT domain of the catalytic exosome subunit Rrp6p provides the interface for binding with its cofactor Rrp47p, a nucleic acid-binding protein. Nucleic acids research 35, 5556-5567


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


17

34. Costello, J. L., Stead, J. A., Feigenbutz, M., Jones, R. M., and Mitchell, P. (2011) The C-terminal region of the exosome-associated protein Rrp47 is specifically required for box C/D small nucleolar RNA 3'-maturation. The Journal of biological chemistry 286, 4535-4543

35. Callahan, K. P., and Butler, J. S. (2008) Evidence for core exosome independent function of the nuclear exoribonuclease Rrp6p. Nucleic acids research 36, 6645-6655

36. Gupta, A. K., Panigrahi, S. K., Bhattacharya, A., and Bhattacharya, S. (2012) Self-circularizing 5'-ETS RNAs accumulate along with unprocessed pre ribosomal RNAs in growth-stressed Entamoeba histolytica. Scientific reports 2, 303

37. Williams, C. W., and Elmendorf, H. G. (2011) Identification and analysis of the RNA degrading complexes and machinery of Giardia lamblia using an in silico approach. BMC genomics 12, 586

38. Barbosa, R. L., Legrand, P., Wien, F., Pineau, B., Thompson, A., and Guimaraes, B. G. (2014) RRP6 from Trypanosoma brucei: crystal structure of the catalytic domain, association with EAP3 and activity towards structured and non-structured RNA substrates. PloS one 9, e89138

39. Burkard, K. T., and Butler, J. S. (2000) A nuclear 3'-5' exonuclease involved in mRNA degradation interacts with Poly(A) polymerase and the hnRNA protein Npl3p. Molecular and cellular biology 20, 604-616

40. Gaurav, A. K., Kumar, J., Agrahari, M., Bhattacharya, A., Yadav, V. P., and Bhattacharya, S. (2017) Functionally conserved RNA-binding and protein-protein interaction properties of LINE-ORF1p in an ancient clade of non-LTR retrotransposons of Entamoeba histolytica. Molecular and biochemical parasitology 211, 84-93

41. Babuta, M., Mansuri, M. S., Bhattacharya, S., and Bhattacharya, A. (2015) The Entamoeba histolytica, Arp2/3 Complex Is Recruited to Phagocytic Cups through an Atypical Kinase EhAK1. PLoS pathogens 11, e1005310

42. Bharadwaj, R., Arya, R., Shahid Mansuri, M., Bhattacharya, S., and Bhattacharya, A. (2017) EhRho1 regulates plasma membrane blebbing through PI3 kinase in Entamoeba histolytica. Cellular microbiology 19

43. Ramakrishnan, G., Vines, R. R., Mann, B. J., and Petri, W. A., Jr. (1997) A tetracycline-inducible gene expression system in Entamoeba histolytica. Molecular and biochemical parasitology 84, 93-100

44. Hamann, L., Buss, H., and Tannich, E. (1997) Tetracycline-controlled gene expression in Entamoeba histolytica. Molecular and biochemical parasitology 84, 83-91

45. Thomson, E., and Tollervey, D. (2010) The final step in 5.8S rRNA processing is cytoplasmic in Saccharomyces cerevisiae. Molecular and cellular biology 30, 976-984

46. Lejeune, F., Li, X., and Maquat, L. E. (2003) Nonsense-mediated mRNA decay in mammalian cells involves decapping, deadenylating, and exonucleolytic activities. Molecular cell 12, 675-687

47. Haile, S., Cristodero, M., Clayton, C., and Estevez, A. M. (2007) The subcellular localisation of trypanosome RRP6 and its association with the exosome. Molecular and biochemical parasitology 151, 52-58

48. Feigenbutz, M., Jones, R., Besong, T. M., Harding, S. E., and Mitchell, P. (2013) Assembly of the yeast exoribonuclease Rrp6 with its associated cofactor Rrp47 occurs in the nucleus and is critical for the controlled expression of Rrp47. The Journal of biological chemistry 288, 15959-15970

49. Verma, D., Murmu, A., Gourinath, S., Bhattacharya, A., and Chary, K. V. R. (2017) Structure of Ca2+-binding protein-6 from Entamoeba histolytica and its involvement in trophozoite proliferation regulation. PLoS pathogens 13, e1006332

50. Yadava, N., Chandok, M. R., Prasad, J., Bhattacharya, S., Sopory, S. K., and Bhattacharya, A. (1997) Characterization of EhCaBP, a calcium-binding protein of Entamoeba histolytica and its binding proteins. Molecular and biochemical parasitology 84, 69-82


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


18

51. Rastew, E., Vicente, J. B., and Singh, U. (2012) Oxidative stress resistance genes contribute to the pathogenic potential of the anaerobic protozoan parasite, Entamoeba histolytica. International journal for parasitology 42, 1007-1015

52. Scholze, H., Frey, S., Cejka, Z., and Bakker-Grunwald, T. (1996) Evidence for the existence of both proteasomes and a novel high molecular weight peptidase in Entamoeba histolytica. The Journal of biological chemistry 271, 6212-6216

53. Makioka, A., Kumagai, M., Ohtomo, H., Kobayashi, S., and Takeuchi, T. (2002) Effect of proteasome inhibitors on the growth, encystation, and excystation of Entamoeba histolytica and Entamoeba invadens. Parasitology research 88, 454-459

54. Aslam, S., Bhattacharya, S., and Bhattacharya, A. (2012) The Calmodulin-like calcium binding protein EhCaBP3 of Entamoeba histolytica regulates phagocytosis and is involved in actin dynamics. PLoS pathogens 8, e1003055

55. Bharadwaj, R., Sharma, S., Janhawi, Arya, R., Bhattacharya, S., and Bhattacharya, A. (2018) EhRho1 regulates phagocytosis by modulating actin dynamics through EhFormin1 and EhProfilin1 in Entamoeba histolytica. Cellular microbiology, e12851

56. Jain, R., Santi-Rocca, J., Padhan, N., Bhattacharya, S., Guillen, N., and Bhattacharya, A. (2008) Calcium-binding protein 1 of Entamoeba histolytica transiently associates with phagocytic cups in a calcium-independent manner. Cellular microbiology 10, 1373-1389

57. Somlata, Bhattacharya, S., and Bhattacharya, A. (2011) A C2 domain protein kinase initiates phagocytosis in the protozoan parasite Entamoeba histolytica. Nature communications 2, 230

58. Wasmuth, E. V., and Lima, C. D. (2012) Structure and Activities of the Eukaryotic RNA Exosome. The Enzymes 31, 53-75

59. Fox, M. J., and Mosley, A. L. (2016) Rrp6: Integrated roles in nuclear RNA metabolism and transcription termination. Wiley interdisciplinary reviews. RNA 7, 91-104

60. Lange, H., Sement, F. M., and Gagliardi, D. (2011) MTR4, a putative RNA helicase and exosome co-factor, is required for proper rRNA biogenesis and development in Arabidopsis thaliana. The Plant journal : for cell and molecular biology 68, 51-63

61. Malet, H., Topf, M., Clare, D. K., Ebert, J., Bonneau, F., Basquin, J., Drazkowska, K., Tomecki, R., Dziembowski, A., Conti, E., Saibil, H. R., and Lorentzen, E. (2010) RNA channelling by the eukaryotic exosome. EMBO reports 11, 936-942

62. Feigenbutz, M., Garland, W., Turner, M., and Mitchell, P. (2013) The exosome cofactor Rrp47 is critical for the stability and normal expression of its associated exoribonuclease Rrp6 in Saccharomyces cerevisiae. PloS one 8, e80752

63. Schuch, B., Feigenbutz, M., Makino, D. L., Falk, S., Basquin, C., Mitchell, P., and Conti, E. (2014) The exosome-binding factors Rrp6 and Rrp47 form a composite surface for recruiting the Mtr4 helicase. The EMBO journal 33, 2829-2846

64. Lykke-Andersen, S., Brodersen, D. E., and Jensen, T. H. (2009) Origins and activities of the eukaryotic exosome. Journal of cell science 122, 1487-1494

65. Zinder, J. C., and Lima, C. D. (2017) Targeting RNA for processing or destruction by the eukaryotic RNA exosome and its cofactors. Genes & development 31, 88-100

66. Lardenois, A., Liu, Y., Walther, T., Chalmel, F., Evrard, B., Granovskaia, M., Chu, A., Davis, R. W., Steinmetz, L. M., and Primig, M. (2011) Execution of the meiotic noncoding RNA expression program and the onset of gametogenesis in yeast require the conserved exosome subunit Rrp6. Proceedings of the National Academy of Sciences of the United States of America 108, 1058-1063

67. Graham, A. C., Kiss, D. L., and Andrulis, E. D. (2009) Core exosome-independent roles for Rrp6 in cell cycle progression. Molecular biology of the cell 20, 2242-2253


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


19

68. Van Hooser, A. A., Yuh, P., and Heald, R. (2005) The perichromosomal layer. Chromosoma 114, 377-388

69. Blower, M. D., Nachury, M., Heald, R., and Weis, K. (2005) A Rae1-containing ribonucleoprotein complex is required for mitotic spindle assembly. Cell 121, 223-234

70. Nozaki, T., and Bhattacharya, A. (2015) Amebiasis: Biology and Pathogenesis of Entamoeba, Springer

71. Diamond, L. S., Harlow, D. R., and Cunnick, C. C. (1978) A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Transactions of the Royal Society of Tropical Medicine and Hygiene 72, 431-432

72. Johnson, M., Zaretskaya, I., Raytselis, Y., Merezhuk, Y., McGinnis, S., and Madden, T. L. (2008) NCBI BLAST: a better web interface. Nucleic Acids Res 36, W5-9

73. Eswar, N., Webb, B., Marti-Renom, M. A., Madhusudhan, M. S., Eramian, D., Shen, M. Y., Pieper, U., and Sali, A. (2007) Comparative protein structure modeling using MODELLER. Current protocols in protein science Chapter 2, Unit 2 9

74. Berman, H. M., Westbrook, J., Feng, Z., Gilliland, G., Bhat, T. N., Weissig, H., Shindyalov, I. N., and Bourne, P. E. (2000) The Protein Data Bank. Nucleic acids research 28, 235-242

75. Wiederstein, M., and Sippl, M. J. (2007) ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins. Nucleic Acids Research 35, W407-W410

76. Laskowski, R. A., MacArthur, M. W., Moss, D. S., and Thornton, J. M. (1993) PROCHECK: a program to check the stereochemical quality of protein structures. Journal of Applied Crystallography 26, 283-291

77. Hunter, J. D. (2007) Matplotlib: A 2D graphics environment. Computing In Science & Engineering 9, 90-95

78. Pettersen, E. F., Goddard, T. D., Huang, C. C., Couch, G. S., Greenblatt, D. M., Meng, E. C., and Ferrin, T. E. (2004) UCSF Chimera--a visualization system for exploratory research and analysis. Journal of computational chemistry 25, 1605-1612

79. Gietz, R. D., and Schiestl, R. H. (2007) High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method. Nature protocols 2, 31-34

80. Shirai, A., Matsuyama, A., Yashiroda, Y., Arai, R., and Yoshida, M. (2006) Rapid and reliable preparation of total cell lysates from fission yeast.

81. Dey, A., Chitsaz, F., Abbasi, A., Misteli, T., and Ozato, K. (2003) The double bromodomain protein Brd4 binds to acetylated chromatin during interphase and mitosis. Proceedings of the National Academy of Sciences of the United States of America 100, 8758-8763

FIGURES LEGENDS

Figure 1. Domain analysis of EhRrp6. (A) Comparison with Saccharomyces cerevisiae, Homo sapiens

and Trpanosoma brucei Rrp6 is shown. Percent identity and, in parentheses, similarity with respect to

ScRrp6 are indicated below each domain. Amino acid positions of each domain are indicated. (B)

Phylogenetic analysis of Rrp6 homologues. After multiple sequence alignment of all the sequences, 100

replicates (bootstrap) of the sample were generated and the tree was constructed on the basis of distance

from PAM matrix and neighbourhood joining method. Bootstrap values are indicated at the nodes. (Eh, E.

histolytica; Sc, S. cerevisiae; Hs, H. sapiens; Mm, Mus musculus; Dm, D. melanogaster; Tb, T. brucei;

At, A. thaliana)

Figure 2. Sequence and structure comparison of EhRrp6. (A) Active site residues are colored on the

basis of percent identity across the listed species. Asterisks denote the conserved DEDDY residues. The

method used for alignment is described in supplemental method SM 1.1. (B) Modeled structure of


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


20

EhRrp6. The EXO, Linker and HRDC domains are shown. (C) Comparison of EhRrp6 structure (red)

with Rrp6 structures of H. sapiens (Green; PDB ID: 3SAF), S. cerevisiae (Blue; PDB ID: 2HBK) and T.

brucei (Cyan; PDB ID: 4NLB) through structural alignment. (D) Comparison of linker region of EhRrp6

and Rrp6 of H. sapiens, S. cerevisae and T. brucei. The linker regions of respective proteins are colored

as in (C) and the sequences are shown below. The molecular surface of EhRrp6 is visualized in grey and

the conserved DEDD-Y active site residues in the EXO domain are colored in red. (E) Active site of

EhRrp6 is shown. Active site residues D212, E214, D270, Y335 and D339 are labeled along with two

magnesium ions (MgA and MgB).

Figure 3. Exoribonuclease activity of EhRrp6. (A) Purified recombinant 6x-His-tagged WT EhRrp6

(0.1uM) was incubated with 5′-radiolabeled RNA substrate (1uM) in reaction buffer. Composition of

buffer and sequence of the 50 nt AU-rich RNA substrate is given in methods section. The reaction was

performed for the indicated time periods. (B) EhRrp6 mutants in the indicated active site residues (Fig.

2A) were assayed for enzyme activity under the same reaction conditions as in (A) for 120min. (C)

EhRrp6 activity with 60 nt generic RNA substrate. The RNA-fold predicted folding pattern of this RNA

is shown on the right. The reaction conditions were as described in (A). (D-F) The activity of WT EhRrp6

was determined under different conditions of temperature, pH (quantification of gel shown in

supplementary Fig. S5), and Mg2+ ion. In panel F the reaction was performed for 120 min. (G) EhRrp6

(0.1uM) was incubated with 65 nt 5′ radiolabelled ssDNA (1uM) or dsDNA (1uM) for 60 min at 37ᵒC in

reaction buffer as in panel A. The sequence of DNA substrate is given in methods section.

Figure 4. Complementation of growth defect of rrp6∆ yeast strain by EhRRP6. Yeast cells were

transformed with WT or mutant EhRRP6. The mutated active site residues are indicated. Growth is shown

at permissive (30°C) and non-permissive (37°C) temperature.

Figure 5. EhRrp6 down regulation affects 5′-ETS degradation. (A) Schematic representation of E.

histolytica Tet-O-CAT cloning vector with tet- inducible expression of EhRRP6 in sense and antisense

orientation. (B) Western blot analysis of EhRRP6 expression in sense and anti-sense cell lines upon

induction with 30 ug/ml tet. Coactosin is shown as loading control. Band intensity was determined by

densitometry using ImageJ software. Normalized values obtained from an average of three experiments

are plotted below, showing mean ± SD. (*p-value ≤ .05, **p-value ≤ .01 and ***p-value ≤ .001). (C)

Northern blot analysis of total RNA (10 ug) from the indicated cell lines, using 5′-ETS probe; SS, serum

starved. The 5′-ETS sub fragments (indicated by vertical line) migrate as a broad band of 0.7-0.9 kb.

Vertical lines between lanes indicate the spliced borders. (D) Quantitative real time RT-PCR analysis of

relative transcript level of 5.8S and 5.8S+30nt rRNA in the EhRrp6 down regulated cell lines. Primer sets

used are indicated. 18S rRNA was used as an internal control. (Group data represent mean ± SD) (E)

Growth kinetics of various cell lines over a period of 72 h. Equal numbers of cells (3x104/ml) were

inoculated into fresh growth medium. The cells were harvested at indicated time points, resuspended in

PBS and counted by haemocytometer. Data are reported as mean ± SD of 3 independent experiments.

Figure 6. Immuno localization of EhRrp6 in E. histolytica trophozoites. (A) Normal and 24 h serum

starved E. histolytica trophozoites were stained with polyclonal anti-EhRrp6 antibody. Alexa-488 (green)

conjugated secondary antibodies were used for visualization. Nucleus was stained with Hoechst 33342

(blue). In the right panel a few selected cells are enlarged, with nucleus marked by arrow. (B) After 24 hrs

of serum starvation, serum was replenished (SR) for 4 h and 12 h. (C) Quantitative analysis of fluorescent

signals obtained from panels A & B. Intensity of immunostain (EhRrp6) was measured at multiple

locations in the cytosol and nucleus. Five random regions were selected from cytosol and nucleus and

average intensity was computed for each region. This was repeated for ten such cells (N = 10, bars

represent standard error; scale bar, 20 µm). (D) Western blot and RNA-Seq analyses of total cell lysate

from normal and serum starved cells. Anti-EhRrp6 antibody was used for western analysis. Anti-

EhCaBP1 was used as loading control. Band intensity was quantified by densitometric scanning using

ImageJ and the normalized values of EhRrp6 expression were obtained from an average of three


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


21

experiments are plotted, showing mean ± SD. RNA-Seq data were obtained from two biological

replicates. (E) Northern blot analysis of total RNA (10 ug) from normal and 24 h serum starved cells and

after serum replenishment of starved cells, using 5′-ETS probe. The 5′-ETS sub fragments (indicated by

vertical line) migrate as a broad band of 0.7-0.9 kb. Vertical lines between lanes indicate the spliced

borders. (F) Western blot analysis of total cell lysate (TCL), cytoplasmic fraction (CF) and nuclear

fraction (NF) from normal and serum starved cells, using the indicated antibodies. Normalized values of

band intensity are plotted from an average of three experiments. (G and H) EhRrp6 immunolocalization

in trophozoites exposed to heat (42˚C) or oxygen stress (1mM H2O2) for the indicated time periods.

Nuclei are marked by white arrows. (I) Quantitative analysis of fluorescent signals obtained from panels

G and H. Data are reported as mean ± SD of 3 independent experiments (***p-value ≤ .001).

Figure 7. (A) The proteasome system is involved in nuclear loss of EhRrp6p. Normal (N) and serum

starved (SS) cells were treated with either 10 µM lactacystin or 100 µM MG132 for the indicated times.

Equal amounts of nuclear extracts were analysed by western blot using antibodies against EhRrp6 (and

EhCaBP6 as loading control). Normalized values of band intensity from an average of three experiments

are plotted below. The mean values (± SD) are shown. (B- F). EhRrp6 is required for E. histolytica

growth and cell motility. (B). Western blot analysis of EhRRP6 expression in sense and anti-sense cell

lines upon induction with 30 µg/ml tet. Ehcoactosin was used as loading control. Band intensity in each

lane was determined by densitometry using ImageJ software. Normalized values were obtained from an

average of three experiments and values relative to tet (-) are plotted in the respective lower panel. (C)

Hoechst staining of nuclei in AS cells from with tet for 36h. (D) DIC images of indicated cell lines to

show the effect of EhRrp6 on blebbing in E. histolytica. Quantitative analysis of blebs in indicated cell

lines was carried out by selecting 30 cells randomly, and the analysis was carried out three times. (E) Cell

migration was measured by transwell assay (51) . Cells 1.5 × 105 were loaded in the upper chamber and

incubated for 2 hr at 35.5°C. Cells that had migrated towards lower chamber were collected and counted

in a haemocytometer. (F) Growth kinetics of EhRrp6- overexpressed cells during serum starvation. Equal

numbers of cells (3X104/ml) were inoculated into fresh growth medium and tet was either added after 12

hrs. Growth was continued, and at 48 h the cells were subjected to serum starvation. The cells were

harvested at indicated time points, resuspended in PBS and counted by haemocytometer. Mean ± SD for

duplicate cultures are plotted.

Figure 8. EhRrp6 is required for E. histolytica phagocytosis. (A) Spectrophotometric assay for

erythrophagocytosis. RBC uptake assay was performed in the indicated cell lines. Cells were incubated

with RBCs for different time points and the amount of RBC uptake was determined

spectrophotometrically using RBC solubilisation assay as described in “Experimental procedures”. The

experiments were carried out three times independently. (B) Quantitative analysis of phagocytic cups.

Thirty cells were randomly selected (in three independent experiments) and the number of phagocytic

cups were counted for each cell line grown with tet. (C) To look at EhRrp6 localization with respect to

phagocytic cups, cells grown for 48h were harvested and incubated with RBCs for indicated time periods

at 37°C and subsequently fixed for further processing. Cells were immunostained with EhRRP6-specific

antibody, followed by Alexa-488-conjugated secondary antibody (green). F-actin was stained with

TRITC-conjugated phalloidin (red). Slides were viewed using Nikon confocal microscope. Arrowhead

indicates phagocytic cups, cross marks the closure of cups before scission, and star marks the phagosome.

Figure 9. Effect of EhRrp6 depletion on expression of phagocytosis related genes. (A) Selected genes

known to be involved in phagocytosis (EhCaBP3, EhRho1, EhCaBP1, EhCaBP6, EhC2PK, EhARP2/3)

and EhCoactosin were studied. Protein levels were determined by western blotting in the indicated cell

lines. Tet addition (30µg/ml) was for 36hrs. Ehcoactosin was used as loading control. Band intensity in

each lane was determined by densitometry using ImageJ software. Normalized values were obtained from

an average of three experiments and values relative to TOC (+tet) cells are indicated at the bottom of each

lane. (B) Immunolocalization of phagocytosis related proteins in EhRrp6-depleted cells and control cells,

grown for 36h in presence of tet and incubated with RBCs for 10 min. Phagocytic cups were visualized


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


22

by Ehactin staining with TRITC-phalloidin (red). Indicated proteins were immunostained with specific

antibodies, followed by secondary antibodies conjugated with Alexa-488 (green) (for EhRrp6) and Alexa-

405(blue) (for EhCaBP1, EhRho1 and EhCaBP3). Arrow shows the phagocytic cups. Scale bar indicates

10μm. For quantitative analysis (shown in panels on the right), relative pixel intensity of fluorescent

signals from cells stained with indicated proteins were calculated from actively phagocytosing amoebic

cells. Relative intensities were calculated for each marker by NIS‐Elements AR 3.0. This analysis was

carried out with 30 randomly selected cells. (N = 30, bar represents standard error). (C) Quantitative real-

time PCR analysis of relative transcript levels of EhRrp6, EhCaBP3, EhRho1 and EhC2PK genes in the

indicated cell lines. EhCaBP1 was used as internal control. (Group data represent mean ± SD).


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


23

Figure 1.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


24

Figure 2.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


25

Figure 3.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


26

Figure 4.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


27

Figure 5.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


28

Figure 6.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


29

Figure 7.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


30

Figure 8.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/


31

Figure 9.


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Singh, Ashwini Kumar Ray, Naidu Subbarao, Alok Bhattacharya and Sudha BhattacharyaShashi Shekhar Singh, Sarah Naiyer, Ravi Bharadwaj, Amarjeet Kumar, Yatendra Pratap

EhRrp6 and its role in growth and erythrophagocytosis 3'-5'exoribonucleaseEntamoeba histolyticaStress-induced nuclear depletion of

published online August 31, 2018J. Biol. Chem.

10.1074/jbc.RA118.004632Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here


ww

.jbc.org/D

ownloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.RA118.004632

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;RA118.004632v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2018/08/31/jbc.RA118.004632

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2018/08/31/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2018/08/31/jbc.RA118.004632

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/

VOLUME 293 (2018) PAGES 16242–16260DOI 10.1074/jbc.AAC118.006754

Correction: Stress-induced nuclear depletion ofEntamoeba histolytica 3�-5� exoribonuclease EhRrp6 andits role in growth and erythrophagocytosis.Shashi Shekhar Singh, Sarah Naiyer, Ravi Bharadwaj, Amarjeet Kumar,Yatendra Pratap Singh, Ashwini Kumar Ray, Naidu Subbarao,Alok Bhattacharya, and Sudha Bhattacharya

A grant was inadvertently omitted from the grant support footnote.The following grant should be included: This work was supported inpart by DST-PURSE (to N. S.).

ADDITIONS AND CORRECTIONS

19510 J. Biol. Chem. (2018) 293(50) 19510 –19510

© 2018 Singh et al. Published under exclusive license by The American Society for Biochemistry and Molecular Biology, Inc.

stress-induced nuclear depletion of entamoeba histolytica ... · phagocytosis, a process important...

Documents