quais são os procedimentos básicos para inferir filogenias? curso_mol/filogenetica.pdf ·...

25
Quais são os procedimentos básicos para inferir filogenias?

Upload: others

Post on 19-Jul-2020

5 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Quais são os procedimentos básicos para inferir filogenias? 

Page 2: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

FASTA DNA (unaligned)

>CowATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACGACAAAGCTGACCCATACAAGCACGATAGATGCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTAATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATAGGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAATCGAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAACCAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGCGGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCAATATTATAA

Page 3: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

NEXUS DNA

#nexus begin data;dimensions ntax=10 nchar=705;format datatype=dna interleave=yes gap=- missing=?;matrixCow ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACarp ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTTChicken ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTCHuman ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTT

Page 4: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

PIR DNA

>DL; CowCowATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTACTTCACTTTCATGACCACACGCTAATAATTGTCTTCTTAATTAGCTCATTAGTACTTTACATTATTTCACTAATACTAACGACAAAGCTGACCCATACAAGCACGATAGATGCACAAGAAGTAGAGACAATCTGAACCATTCTGCCCGCCATCATCTTAATTCTAATTGCTCTTCCTTCTTTACGAATTCTATACATAATAGATGAAATCAATAACCCATCTCTTACAGTAAAAACCATAGGACATCAGTGATACTGAAGCTATGAGTATACAGATTATGAGGACTTAAGCTTCGACTCCTACATAATTCCAACATCAGAATTAAAGCCAGGGGAGCTACGACTATTAGAAGTCGATAATCGAGTTGTACTACCAATAGAAATAACAATCCGAATGTTAGTCTCCTCTGAAGACGTATTACACTCATGAGCTGTGCCCTCTCTAGGACTAAAAACAGACGCAATCCCAGGCCGTCTAAACCAAACAACCCTTATATCGTCCCGTCCAGGCTTATATTACGGTCAATGCTCAGAAATTTGCGGGTCAAACCACAGTTTCATACCCATTGTCCTTGAGTTAGTCCCACTAAAGTACTTTGAAAAATGATCTGCGTCAATATTA---------------------TAA*

Page 5: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 6: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 7: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 8: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Classes de Métodos:

Algoritmos Uma seqüência específica de passos que leva a um determinado resultado

2 + 2 = 4

UPGMA

Distância

Page 9: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Take a look at the following 3 sequences of 3 nucleotides

1.AGC2.AAC3.ACC

Sequences 1 and 2 differs at 1 out of 3 positions = 1/3Sequences 1 and 3 differs at 1 out of 3 positions = 1/3Sequences 2 and 3 differs at 1 out of 3 positions = 1/3

and we obtain this matrix:

1. 2. 3.1. - 0.333 0.3332. 0.333 - 0.3333. 0.333 0.333 -

Page 10: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Jukes Cantor

A simple model of sequence evolution is the Jukes-Cantor model (JC). Under this model the distance between two sequences is given by

Where P is the proportion of nucleotides that are different (the observed differences above) in the two sequences and ln is the natural log function. To calculate the JC distances from the observed differences above:

The Jukes-Cantor matrix for the sequences above looks like this:

1. 2. 3.1. - 0.441 0.4412. 0.441 - 0.4413. 0.441 0.441 -

Page 11: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Kimura's Two Parameter model

Kimura's Two Parameter model (K2P) incorporates the observation that the rate of transitions per site (a) may differ from the rate of transversions (b), giving a total rate of substitiutions per site of (a + 2b)(there are three possible substitutions: one transition and two transversions). The transition:transversion ratio a/b is often represented by the letter kappa (k).

In the K2P model the number of nucleotide substitutions per site is given by:

1. 2. 3.1. - 0.549 0.4772. 0.549 - 0.5493. 0.477 0.549 -

Page 12: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Classes de Meetodos:Otimização por critérios, o que prevê uma escolha do pesquisador1- definir uma função2- usar um algoritmo para escolha de um modelo que descreva uma filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores.

Parsimony (MP)

Maximum likelihood (ML)

Minimum evolution (ME)

Page 13: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Termos utilizados para definir árvores

Page 14: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Sobre arvores filogenéticas: o formato da filogenia

Cladograma

FilogramaDendrogram

Page 15: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

((A, B), (C, D)), E), or if one wishes to add information on branch lengths ((A:0.1, B:0.2):0.2, (C:0.15, D:0.3):0.4):0.3, E:0.4).

Page 16: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 17: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 18: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 19: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 20: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

Models of evolution represent rate changes along the arrows changing a nucleotide from one to another. Often these rates are different and there is often a difference between transitions (changes within pyrimidines or purines) and transversions (changes among class).

Page 21: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

position1 2 3

Sequence1 T G CSequence2 T A CSequence3 A G GSequence4 A A G

* Position 1: Only one change is introduced if sequences 1 and 2 are grouped, while two changes will be necessary if sequences 1 and 3 or 1 and 4 are grouped.

* Position 2: Only one change is introduced if sequences 1 and 3 are grouped, while two changes will be necessary if sequences 1 and 2 or 1 and 4 are grouped.

* Position 3: Only one change is introduced if sequences 1 and 2 are grouped, while two changes will be necessary if sequences 1 and 3 or 1 and 4 are grouped.Then, from the three possible unrooted trees,try to find the tree that needs the fewest changes to explain the data:

* If 1 and 2 are grouped a total of four changes are needed.* If 1 and 3 are grouped a total of five changes are needed.* If 1 and 4 are grouped a total of six changes are needed.

Hence, the shortest tree is ((1,2)(3,4)).

Page 22: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores

The use of maximum likelihood (ML) algorithms in developing phylogenetic hypotheses requires a model of evolution

Page 23: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 24: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores
Page 25: Quais são os procedimentos básicos para inferir filogenias? curso_mol/Filogenetica.pdf · filogenia ótima.Há várias hipóteses alternativas varias arvores com diferentes valores