disfunção da sinalização por insulina hipocampal na doença de alzheimer · 2016-01-19 ·...
TRANSCRIPT
Universidade Federal do Rio de Janeiro
Disfunção da sinalização por insulina hipocampal na Doença de Alzheimer
Theresa Rachel Jacinto de Souza Bomfim
Tese submetida ao Programa de Pós-Graduação em Química Biológica do Instituto de Bioquímica Médica da Universidade Federal do Rio de Janeiro, como parte dos requisitos
para a obtenção do grau de Doutor em Ciências (Química Biológica)
Rio de Janeiro 2014
ii
Theresa Rachel Jacinto de Souza Bomfim
Disfunção da sinalização por insulina hipocampal na Doença de Alzheimer
Tese submetida ao Programa de Pós-Graduação em Química Biológica do Instituto de Bioquímica Médica da Universidade Federal do Rio de Janeiro, como parte dos requisitos para a obtenção do grau de Doutor em Ciências (Química Biológica)
Orientadora: Profa. Fernanda G. De Felice
Co-orientador: Prof. Sérgio Teixeira Ferreira
Rio de Janeiro 2014
iii
Ficha Catalográfica
Rachel Jacinto de Souza Bomfim, Theresa. Disfunção da sinalização por insulina hipocampal na Doença de
Alzheimer – Theresa Rachel Jacinto de Souza Bomfim. Rio de Janeiro: UFRJ/IBqM, 2014.
115 fl.: 9 Il. Orientadora: Fernanda G. De Felice Tese (Doutorado) – UFRJ / Instituto de Bioquímica Médica /
Programa de Pós-graduação em Química Biológica, 2014. Referências Bibliográficas: f. 90-115
1. Doença de Alzheimer. 2. Oligômeros do peptídeo beta-amilóide 3. Resistência à insulina. 4. Sinalização por insulina. 5. GLP-1. 6. Inflamação – Tese. I. De Felice, Fernanda Guarino. II. Universidade Federal do Rio de Janeiro, Instituto de Bioquímica Médica, Programa de Pós-graduação em Química Biológica. III. Título.
iv
Theresa Rachel Jacinto de Souza Bomfim
Disfunção da sinalização por insulina hipocampal na Doença de Alzheimer
Rio de Janeiro, 03 de setembro de 2014.
_______________________________________________
Fernanda Guarino De Felice (Orientadora, Professora Adjunta do Instituto de Bioquímica Médica, UFRJ)
_______________________________________________ Sérgio Teixeira Ferreira
(Co-orientador, Professor Titular do Instituto de Bioquímica Médica, UFRJ)
________________________________________________ José Roberto Meyer Fernandes
(Professor Titular do Instituto de Bioquímica Médica, UFRJ)
________________________________________________ José Donato Júnior
(Professor Doutor do Departamento de Fisiologia e Biofísica do ICB/USP)
________________________________________________ Ricardo Augusto de Melo Reis
(Professor Associado III do Instituto de Biofísica Carlos Chagas Filho, UFRJ)
________________________________________________ Antônio Galina Filho
(Revisor, Professor Adjunto do Instituto de Bioquímica Médica, UFRJ)
________________________________________________ Rogério Arena Panizzutti
(Professor Adjunto do Instituto de Ciências Biomédicas, UFRJ)
v
Esta Tese foi realizada no Laboratório de Doenças Neurodegenerativas,
do Instituto de Bioquímica Médica da Universidade Federal do Rio de Janeiro, sob
a orientação da Professora Fernanda Guarino De Felice e co-orientação do
Professor Sérgio T. Ferreira, com auxílios financeiros da Fundação de Amparo à
Pesquisa do Estado do Rio de Janeiro (FAPERJ), do Conselho Nacional do
Desenvolvimento Científico e Tecnológico (CNPq) do Instituto Nacional de
Neurociência Translacional (INNT) e do Human Frontiers Science Program
(HFSP).
vi
“Meu filho, se você aceitar as minhas palavras e guardar no coração os meus mandamentos; se der ouvidos à sabedoria e inclinar o coração para o discernimento; se
clamar por entendimento e por discernimento gritar bem alto, se procurar a sabedoria como se procura a prata e buscá-la como quem busca um tesouro escondido, então você
entenderá o que é temer ao Senhor e achará o conhecimento de Deus. Pois o Senhor é quem dá sabedoria; de sua boca procedem o conhecimento e o discernimento. Ele
reserva a sensatez para o justo; como um escudo protege quem anda com integridade, pois guarda a vereda do justo e protege o caminho de seus fiéis. Então você entenderá o
que é justo, direito e certo, e aprenderá os caminhos do bem. Pois a sabedoria entrará em seu coração, e o conhecimento será agradável à sua alma.” Provérbios 2:1-10
vii
Dedico essa Tese à minha querida mãe e melhor amiga, Vera Jacinto, por ser exemplo
de amor e cuidade em cada detalhe de minha vida! E à minha doce e querida avó, Águeda Jacinto,
por ser exemplo de sabedoria e amor em todas as circunstâncias.
viii
AGRADECIMENTOS
Em primeiro lugar, quero agradecer a Deus, por caminhar comigo todos os
dias nesta jornada acadêmica, sem me deixar faltar nada e por providenciar cada
detalhe necessário para alcançar mais essa etapa. Toda honra e toda glória ao
meu Deus, porque sem Ele, eu não estaria aqui.
Agradeço à minha querida e grande mãe, Vera Jacinto, por todos os muitos
sacrifícios e privações pelos quais passou para permitir que eu pudesse estudar e
morar em outra cidade, por todas as ligações de encorajamento, todos os abraços,
palavras de carinho, conselhos, direcionamentos, por curtir e acompanhar com
grande expectativa cada conquista e vitória no laboratório. Como agradecer por
cada detalhe do seu cuidado incomparável, não tenho palavras para agradecer
por tanto amor e dedicação! Compartilho com você, mãe, essa conquista é nossa!
À minha doce irmã e melhor amiga! Obrigada por sempre ser minha
companheira nesta batalha, por me apoiar em todos os momentos de todas as
formas! Obriagda por todas as vezes que confortou meu coração, me aconselhou,
pela comidinha quentinha e gostosa que fazia. Essa conquista também é nossa
por tudo que passamos juntas!
Ao meu Pai, Valdir Bomfim, por ser amigo, me apoiar em diversos
momentos, nas mudanças, nas lutas e batalhas vividas aqui no Rio. Seu apoio foi
fundamental
A toda minha família, que é minha base, meu suporte, por todas as vezes
que se alegrou comigo em cada conquista, por torcer em todos os momentos.
Agradeço por todo o apoio durante essa fase de estudos, principalmente aos
meus tios Nestor e Maria Célia, e meu avô Antônio Jacinto, que sem exitar me
ajudaram de forma significativa.
Agradeço aos meus Orientadores, Fernanda De Felice e Sérgio Ferreira por
toda confiança, ensinamentos, conselhos, por tantas vezes que se preocuparam
comigo como uma filha! Agradeço por toda paciência e dedicação. Mais do que
Professores, para mim são como amigos queridos que tanto me ajudaram!
ix
Aos meus queridos amigos do LDN, são tantos durante essa longa
caminhada. Mas não podia me esquecer destes queridos que desde o início me
ensinaram tanto e para não cometer nenhuma falta ou injustiça, não mencionarei
nomes. São todos muito imporante na minha formação como aluna e como
pessoa.
Ainda do LDN, não poderia deixar de agradecer às três guerreiras que
sempre estão dispostas a nos ajudar, e mesmo nos casos em que eu chegava aos
45 do segundo tempo! Minhas queridas, Claudinha, Maíra e Mariangela, vocês
conseguem de forma completa deixar nossos dias de tarabalho mais leves!
Agradeço também a uma mulher muito amável e generosa que me iniciou
com tanto carinho na caminha científica, e se fez muito presente para minha
formação. Agradeço a ela, Profª. Martha M. Sorenson, por todas as conversas,
apoio, suporte e ajuda. Nunca me esquecerei de tudo que fez por mim! A Profª
Verônica Salerno, por ter me recebido com tanto carinho, por me apoiar e motivar
sempre a crescer!
Ao Prof. Antônio Galina, que sempre foi mais do que um Revisor, foi uma
grande amigo e Mestre que me ensinou que um Professor, além de ensinar o
conteúdo, também transforma a visão do aluno em relação ao conhecimento.
Nunca me esquecerei de nossas conversas, conselhos e risadas!
Aos membros da Banca, Prof. José Roberto Meyer, Prof. José Donato
Júnior, Prof. Ricardo Reis e Prof. Rogério Panizzutti, muito obrigada por aceitar ao
convite, e tornar esse momento mais rico com as suas contribuições!
x
RESUMO BOMFIM, Theresa Rachel Jacinto de Souza. Disfunção da sinalização por insulina hipocampal na Doença de Alzheimer. Rio de Janeiro, 2014. Tese (Doutorado em Química Biológica) Instituto de Bioquímica Médica, Universidade Federal do Rio de Janeiro, Rio de Janeiro, 2014 Estudos recentes sugerem que existe uma correlação entre a doença de Alzheimer (DA) e a diabetes melitus tipo 2, uma vez que a disfunção na sinalização de insulina ocorre no hipocampo de pacientes com DA. Acredita-se que essa disfunção possa contribuir para o declinio cognitivo na DA. Embora essa conexão entre a DA e o diabetes seja sugerida, o mecanismo pelo qual a inibição da via de sinalização de insulina ocorre no cérebro ainda é desconhecido. No presente trabalho, procuramos investigar os mecanismos que levam a sinalização deficiente de insulina em neurônios hipocampais. Amostras de tecido de cérebro humano com DA apresentaram níveis elevados de IRS-1pSer e JNK ativada, similar ao que ocorre nos tecidos periféricos em pacientes com diabetes. Nossos resultados demonstraram que oligômeros do peptíeo β amiloide (Aβ), sinaptotoxinas que acumulam no cérebro de pacientes DA, ativam a via de sinalização TNF-α/JNK, induzindo a fosforilação do IRS-1 em múltiplos resíduos de serina, e inibem a fosforilação fisiológica IRS-1pTyr em culturas maduras de neurônios hipocampais. A inibição do IRS-1 também foi observada no hipocampo de camundongos transgênicos para a doença de Alzheimer. Interessantemente, a injeção intracerebroventricular de oligômeros de Aβ induziu a ativação da JNK e consequente inibição do IRS-1 em macacos cinomolgos. As patologias neuronais induzidas pelos oligômeros de Aβ, incluindo disfunção no transporte axonal, foram prevenidas pela exposição à exendina-4 (exenatida), um agente anti-diabético. Em camundongos transgênicos, a exendina-4 diminuiu os níveis de IRS-1pSer e JNK ativada no hipocampo e contribuiu para melhores resultados em testes comportamentais de memória. Dados adicionais indicaram que a citocina IL-1β tem uma importante participação tanto na inibição do IRS-1, quanto no prejuízo cognitivo induzido pelos oligômeros. Por estabelecer um link molecular entre a desregulação da sinalização por insulina na doença de Alzheimer e o diabetes, nossos resultados abrem caminhos para investigação de novas abordagens terapêuticas em Alzheimer.
xi
ABSTRACT
BOMFIM, Theresa Rachel Jacinto de Souza. Disfunção da sinalização por insulina hipocampal na Doença de Alzheimer. Rio de Janeiro, 2014. Tese (Doutorado em Química Biológica) Instituto de Bioquímica Médica, Universidade Federal do Rio de Janeiro, Rio de Janeiro, 2014 Defective brain insulin signaling has been suggested to contribute to the cognitive deficits in patients with Alzheimer’s disease (AD). Although a connection between AD and diabetes has been suggested, a major unknown is the mechanism(s) by which insulin resistance in the brain arises in individuals with AD. Here, we show that serine phosphorylation of IRS-1 (IRS-1pSer) is common to both diseases. Brain tissue from humans with AD had elevated levels of IRS-1pSer and activated JNK, analogous to what occurs in peripheral tissue in patients with diabetes. We found that amyloid-β peptide (Aβ) oligomers, synaptotoxins that accumulate in the brains of AD patients, activated the JNK/TNF-α pathway, induced IRS-1 phosphorylation at multiple serine residues, and inhibited physiological IRS-1pTyr in mature cultured hippocampal neurons. Additional data suggest that IL-1β also contributs to IRS-1 inhibition and cognition disfunction induced by Aβ oligomers. Impaired IRS-1 signaling was also present in the hippocampi of Tg mice with a brain condition that models AD. Importantly, intracerebroventricular injection of Aβ oligomers triggered hippocampal IRS-1pSer and JNK activation in cynomolgus monkeys. The oligomer-induced neuronal pathologies observed in vitro, including impaired axonal transport, were prevented by exposure to exendin-4 (exenatide), an anti-diabetes agent. In Tg mice, exendin-4 decreased levels of hippocampal IRS-1pSer and activated JNK and improved behavioral measures of cognition. By establishing molecular links between the dysregulated insulin signaling in AD and diabetes, our results open avenues for the investigation of new therapeutics in AD.
xii
SUMÁRIO
1) Introdução ........................................................................................................ 14 1.1) Doença de Alzheimer ..................................................................................... 14 1.2) Peptídeo β-amilóide (Aβ) ............................................................................... 19 1.3) Oligômeros de Aβ .......................................................................................... 22 1.4) Sinalização por Insulina ................................................................................. 28
1.4.1) Mecanismos Moleculares ........................................................................ 29 1.4.2) Resistência a insulina ............................................................................. 34 1.4.3) Sinalização por Insulina no Sistema Nervoso Central ............................ 36
1.5) Doença de Alzheimer e resistencia a insulina ................................................ 37 1.6) Doença de Alzheimer e Inflamação ............................................................... 41 1.7)Transporte Axonal ........................................................................................... 43
1.7.1) Transporte Axonal, envelhecimento e doença de Alzheimer .................. 47 1.8) Uso da exendina-4 na estimulação da sinalização por insulina ..................... 49 2) Objetivos .......................................................................................................... 52 3) Metodologia ..................................................................................................... 53 3.1) Materiais ......................................................................................................... 53 3.2) Preparo e caracterização dos oligômeros de Aβ ............................................ 54
3.2.1) Gel-filtração por HPLC ............................................................................ 55 3.2.2)Western blot para Oligômeros de Aβ (ADDLs) ........................................ 56
3.3) Culturas primárias de hipocampo de rato....................................................... 58 3.4) Neuropatologia de cérebro humano ............................................................... 59 3.5) Injeção intracerebroventricular de Aβ (i.c.v.) em camundongos..................... 61 3.6) Injeção de Aβ no cérebro de macacos e estudos neuropatológicos ............. 62 3.7) Tarefa de Reconhecimento de Objetos .......................................................... 63 3.8) Tratamento com os oligômeros de Aβ e agentes farmacológicos .................. 65 3.9) Animais transgênicos ..................................................................................... 65 3.10) Administração exendina-4 em animais transgênicos ................................... 66 3.11) Imunocitoquímica ......................................................................................... 67 3.12) Análise por western blot das amostras de hipocampo dos animais transgênicos e das culturas de neurônios hipocampais ........................................ 68 3.13) Análise dos dados ........................................................................................ 69 3.14) Expressão dos plasmídeos .......................................................................... 70 4) Resultados ....................................................................................................... 72 4.1) Agentes antidiabéticos protegem o cérebro de camundongos de uma disfunção na sinalização por insulina causada pelos oligômeros de Aβ associados a doença de Alzheimer. ......................................................................................... 72 4.2) Resultados Adicionais I .................................................................................. 73
xiii
4.3) Resultados Adicionais II ................................................................................. 77 5) Discussão ........................................................................................................ 80 6) Conclusões ...................................................................................................... 89 7) Referências ...................................................................................................... 90 Anexos ............................................................................................................... 115
14
1) INTRODUÇÃO
1.1) Doença de Alzheimer
Poucos diagnósticos na medicina moderna evocan uma apreensão tão
profunda no paciente e em sua família. A possibilidade de desenvolver doenças
cardiovasculares, câncer ou doenças metabólicas é bastante preocupante, mas
existem algumas indicações de que as pessoas tem mais medo de desenvolver
Alzheimer. Isso porque esta doença nos rouba de nossas qualidades mais
humanas: raciocínio, memória, abstração, lingagem, controle emocional
(ALZHEIMER e cols., 1995; WALSH e SELKOE, 2004). E ainda é uma doença
cujo tratamento está muito além de nosso alcance. A doença de Alzheimer (DA) é
o tipo de demência mais comum que atinge o homem durante o envelhecimento.
Uma em cada oito pessoas com 65 anos ou mais é acometida pela DA, com uma
incidência de 13% (Plassman e cols., 2007). Entretanto, esse número aumenta
para 33% para indivíduos com 85 anos ou mais (SESHADRI e cols., 2006). Um
relatório publicado pela Associação Americana de Alzheimer (Alzheimer’
Association) mostrou que aproximadamente 35,6 milhões de pessoas no mundo
foram acometidas pela doença de Alzheimer em 2010 (World Alzheimer Report,
2009). Com o aumento da expectativa de vida, estima-se que este número deverá
dobrar para 65,7 milhões em 2030, avançando ainda mais em 2050 podendo
atingir um número de 115,4 milhões de pessoas (FERRI e cols., 2005;
BROOKMEYER e cols., 2007; KALARIA e cols., 2008).
15
A doença de Alzheimer é uma demência predominantemente esporádica, já
que mais de 95% dos casos não apresentam uma causa genética definida e as
possíveis causas ambientais tem sido amplamente debatidas (BALLARD e cols.,
2011). Atualmente, sabe-se que o envelhecimento é o maior fator de risco para o
desenvolvimento da DA esporádica, embora um desequilibrio no metabolismo
corporal ao longo da vida seja recentemente considerado como um importante
fator que parece contribuir para o seu estabelecimento (DAVIGLUS e cols., 2011;
MATTSON, 2012; DE FELICE, 2013). Entretanto, não existem evindências
consistentemente suficientes para concluir e assumir a associação de algum fator
modificável com o risco para desenvolver Alzheimer (DAVIGLUS e cols., 2011).
O diagnóstico definitivo é realizado após análise histopatológica post-
mortem, o que dificulta a detecção precoce dessa doença. Existem, no entanto,
diversos testes neuropsicológicos específicos com escalas propedêuticas que
fornecem indicações funcionais do estado cognitivo dos pacientes. A partir da
aplicação destas escalas, sugere-se um estado cognitivo normal ou demente, em
diversos níveis (NOWRANGI e cols., 2011).
O avanço da doença de Alzheimer ocorre de forma lenta e progressiva. Nos
casos esporádicos, os primeiros sintomas cognitivos geralmente aparecem após
os 65 anos, sendo na maioria das vezes confundidos com alterações relacionadas
ao envelhecimento. Nos casos genéticos, os sintomas aparecem mais cedo,
dependendo da severidade das mutações apresentadas (BERTRAM e cols.,
2010).
Inicialmente, verifica-se a incapacidade de evocar lembranças recentes,
enquanto que acontecimentos mais antigos conseguem ser recuperados. Em
16
estágios mais avançados, o paciente desenvolve déficit cognitivo severo, confusão
mental, alteração de humor, deficiências na fala, inabilidade motora e,
eventualmente, é levado a óbito (GREENE e cols., 1995).
É importante observar que grande parte dos pacientes que desenvolverão
demência passa por um estágio prodrômico conhecido como disfunção cognitiva
leve (MCI, do inglês mild cognitive impairment). Embora já seja possível ter
indícios de demência nesta etapa, não há garantias de que esta progredirá para a
DA (PETERSEN e cols., 2009). Ainda assim, o MCI é um fenômeno clínico
bastante relevante, pois causa deficiências efetivas no paciente e aumenta
consideravelmente o risco de evolução para a doença de Alzheimer.
Morfologicamente, o cérebro DA, em um estágio bastante avançado, é
caracterizado pela redução da formação hipocampal e do cótex cerebral, além do
alargamento dos ventrículos laterais e estreitamento dos giros (Figura 1 A e B).
As primeiras descrições clínicas e histopatológicas da DA foram feitas, pelo
médico alemão Alois Alzheimer, a partir do estudo do cérebro de sua paciente
Auguste D em 1906 (para uma tradução em inglês do artigo original de Alois
Alzheimer, ver ALZHEIMER e cols., 1995). Nas análises histopatológicas do córtex
dessa paciente o Dr. Alzheimer identificou dois marcadores que são considerados
como lesões bastante importantes para a caracterização desta doença (Figura 1 C
e D).
Uma das caracteríscticas é a presença de inclusões intracelulares que
demarcam o corpo celular e parte dos processos neuronais, hoje conhecidas
como emaranhados neurofibrilares (Figura 1C). Estes agregados são constituídos
de proteína tau hiperfosforilada. Nesta condição, a tau perde sua função fisiológica
17
de associar-se aos microtúbulos e estabilizá-los, formando assim, filamentos
helicoidais pareados que agregam no interior das células neuronais. Esses
emaranhados são observados principalmente no hipocampo, no córtex entorrinal e
na amígdala, principais regiões afetadas na DA (THAL e cols., 2006).
Outros marcadores importantes presentes em todo o córtex cerebral são as
placas senis (Figura 1 D). Alguns anos mais tarde, percebeu-se que essas lesões
eram positivamente marcadas com o corante vermelho-de-Congo, que possui
afinidade por estruturas amilóides. Assim, surgiram os primeiros indícios de que os
componentes destas placas teriam esta natureza, o que permitiu a criação do
termo “placas amilóides”. A caracterização completa destas placas somente viria a
acontecer várias décadas após sua descrição inicial, quando se verificou que o
peptídeo beta-amilóide (Aβ) é o principal componente das placas amilóides
(GLENNER e WONG, 1984; MASTERS e cols., 1985), embora várias outras
proteínas também estejam associadas às placas (WELANDER e cols., 2009).
18
Figura 1: Marcadores histopatológicos da doença de Alzheimer. A) Cérebro acometido pela doença (à direita), exibindo considerável alargamento dos sulcos e estreitamento dos giros, além de notável redução do volume cerebral em comparação a um cérebro de um indivíduo não demenciado (à esquerda). B) Cortes coronais de um cérebro de um paciente com Alzheimer (à direita) revelam o aumento do volume ventricular e a perda de massa cerebral quando comparado com um cérebro de um indivíduo não demenciado (à esquerda). C) Emaranhados neurofibrilares (intracelulares) corados por prata. D) Placas senis (extracelulares) coradas por prata. Adaptado de www.alzheimer.sk.ca.
19
1.2) Peptídeo β-amilóide (Aβ)
Quase um século após a primeira descrição das placas amilódes pelo Dr.
Alois Alzheimer, no meio da década de 80, bioquímicos se esforçaram para
identificar seu principal componente. Foi então que a partir do isolamento de
placas amilóides associadas à vasculatura cerebral de pacientes com Alzheimer
que Glenner e Wong indetificaram um fragmente de aproximadamente 4kDa, o
qual eles nomeram como proteína β-amilóide (GLENNER e WONG, 1984). No ano
seguinte Masters e colaboradores confirmaram a presença do peptídeo β amiloide
nas placas senis isoladas de córtices de pacientes com Alzheimer (MASTERS e
cols., 1985). Estes trabalhos foram fundamentais para dar início a diversos
estudos com o propósito de melhor entender a participação deste peptídeo na
fisiopatologia da DA.
O peptídeo Aβ é originado a partir da clivagem proteolítica da proteína
precursora amilóide (APP do inglês amyloid precursor protein). A APP é uma
proteína integral de membrana codificada pelo gene app, localizado no
cromossomo 21. A APP é expressa em diversos tipos celulares e pode sofrer
diferentes regulações pós-transcricionais e pós-traducionais de acordo com a
sinalização celular. A isoforma mais expressa em neurônios é a APP695, que está
presente nas sinapses e parece exercer uma importante função em regular a
adesão, migração e sinalização neuronal (GRALLE e FERREIRA, 2007).
O resultado do processamento da APP por diferentes complexos
enzimáticos multiproteicos (α, β e γ secretases) é a geração de fragmentos
peptídicos bioativos, dentre os quais o peptídeo beta-amilóide (Aβ). A formação
20
deste peptídeo ocorre a partir da clivagem inicial da APP na membrana
plasmática, primeiramente pela β-secretase (BACE), sendo formado um fragmento
solúvel (sAPPβ) e outro que ainda transpassa a membrana (C99). Posteriormente
o complexo enzimático γ-secretase cliva o peptídeo C99 originando o fragmento
AICD e o peptídeo beta-amilóide na porção extracelular da membrana (ZHANG e
cols., 2012). Dependendo do ponto exato desta última clivagem pela γ-secretase a
geração do peptídeo Aβ pode apresentar um número variável de aminoácidos
(entre 39 e 43) (GU e cols., 2004). Este processamento da APP é conhecido como
amiloidogênico devido à produção de monômeros de Aβ.
Por outro lado, a APP pode ser clivada inicialmente pelo complexo α-
secretase, gerando os fragmentos sAPPα e C83. A posterior clivagem destes
fragmentos não gera o peptídeo beta-amilóide, o que torna este processamento
não-amiloidogênico (Figura 2).
A quantidade relativa de Aβ1-42 formado é particularmente notável, devido
ao fato desta forma mais longa do Aβ ter uma altíssima capacidade de agregar em
comparação a forma mais abundantemente gerada, o peptídeo Aβ1-40 (BURDICK
e cols., 1992; JARRETT e cols., 1993). A produção do peptíeo Aβ é um processo
normal, mas em um pequeno número de indivíduos essa condição biológica
parece estar alterada. O Aβ produzido é liberado no meio extracelular, e
dependendo da concentração e condições físico-químicas tende a agregar
anormalmente. O tamanho destes agregados pode variar desde oligômeros
solúveis até fibras que se depositam nas placas amilóides (SNYDER e cols.,
1994). Embora seja pouco conhecido sobre a regulação da formação destes
agregados, sabe-se que estes podem se interconverter e que podem ser desfeitos
21
através da ação enzimática de duas proteases extracelulares: neprilisina e enzima
degradante de insulina (IDE, do inglês insulin-degrading enzyme) (MINERS e
cols., 2011).
Figura 2: Processamento da proteína precursora amilóide (APP). Processamento amiloidogênico e não amiloidogênico da APP na membrana plasmática. Na via não amiloidogênica, a clivagem da APP pela α-secretase libera um ectodomínio solúvel (SAPPα) para o meio extracelular e gera um fragmento residual de 83 aminoácidos C-terminal (C-83) na membrana. O C-83 é clivado pela γ-secretase liberando o peptídeo p3. Na via amiloidogênica a APP é clivada pela β-secretase, o que resulta na secreção da molécula levemente truncada sAPPβ e na retenção de um fragmento de 99 resíduos C-terminal (C-99). O C-99 é clivado pela γ-secretase gerando o peptídeo Aβ (destacado em verde). A clivagem de ambos os fragmentos, C83 e C99, libera o fragmento intracelular AICD. Figura produzida e gentilmente cedida por Marcelo Nunes Vieira.
22
1.3) Oligômeros de Aβ
A descoberta do Aβ como principal componente das placas amilóides
motivou o interesse pela potencial toxicidade dessa molécula. Em poucos anos,
um grande conjunto de evidências demonstrou que agregados deste peptídeo são
neurotóxicos, o que poderia explicar a neurodegeneração observada em estágios
avançados da doença de Alzheimer (GEULA e cols., 1998; WANG e cols., 2004;
KLEIN, 2006; FERREIRA e cols., 2007). Essas evidências são resultados de
estudos genéticos de casos de uma forma familiar (hereditária) da doença de
Alzheimer. Estes, ocorrem precocemente, em torno da quarta ou quinta decada de
vida, com uma incidência aproximada de 10% dos casos (SELKOE, 2004;
BERTRAM e TANZI, 2005). Os achados desses estudos genéticos apontam
fortemente para o gene da APP como um importante sítio de mutações
causadoras da doença.
O primeiro caso de mutação foi descoberto em uma família com amiloidose
cerebrovascular com múltiplas hemorragias (LEVY e cols., 1990). Nos anos
seguintes, uma distinta mutação na APP foi identificada em uma família que
desenvolvia precocemente a doença de Alzheimer (GOATE e cols., 1991), no
mesmo período foram detectadas mutações adicionais em outras famílias
(CHARTIER-HARLIN e cols., 1991; MULLAN e cols., 1992). Estes e outros
estudos levaram a proposta de que estas mutações na APP, ou nas enzimas
responsáveis pelo seu processamento proteolítico resultaria na geração
exacerbada de Aβ (BERTRAM e cols., 2010; SELKOE, 2000; DE e cols., 2010).
Entretanto, a maioria dos casos da DA é esporádica, não tendo sido ainda
identificado nenhum fator genético determinante desta condição (SELKOE, 2004;
23
ROBERSON e MUCKE, 2006). Nesses casos, a doença está bastante associada
ao envelhecimento. É importante ressaltar que o acúmulo de Aβ é o ponto comum
a todos os casos de DA, esporádicos e hereditários. No entanto, o que promove o
acúmulo de Aβ nos casos esporádicos da DA é ainda um grande mistério.
Pouco tempo depois da associação entre o peptídeo Aβ e a doença de
Alzheimer, ainda não havia uma proposta de mecanismo que explicasse como a
presença e agregação deste peptídeo poderiam desencadear o quadro de
demência observado. Neste sentido, os pesquisadores John Hardy e Gerald
Higgins publicaram, em 1992, um pequeno trabalho onde propunham, pela
primeira vez, uma sequência de eventos que serviu de paradigma para o
entendimento do processo que rege a DA (HARDY e HIGGINS, 1992).
Esta proposta, que ficou conhecida como hipótese da cascata amilóide,
postulava que o evento patogênico inicial seria um aumento nos níveis de Aβ no
cérebro do paciente, iniciando uma cascata de sinalização tóxica que leva à morte
neuronal, resultando em um estado de demência.
No entanto, apesar do sólido embasamento da hipótese amilóide proposta,
estudos seguintes forneceram evidências de que havia falhas neste mecanismo.
Por exemplo, a existência de deposição de placas amilóides em indivíduos não-
demenciados (MOCHIZUKI e cols., 1996) e a falta de correlação entre a
intensidade de deposição das placas e a severidade da disfunção cognitiva
(SLOANE e cols., 1997; RICHARDSON e cols., 2003) comprometeram as
predições desta proposta. Com as contribuições destes e de outros estudos que
sucederam a proposta inicial da cascata amilóide, uma nova versão foi elaborada
por Hardy e Selkoe (HARDY e SELKOE, 2002). Essa hipótese revisada apresenta
24
algumas modificações importantes, como incluir o impacto neurotóxico do
peptídeo beta amilóide, especialmente na sua forma oligomérica (Figura 3).
Desde a década de 90, muitos estudos têm focado seus esforços sobre a
forma oligomérica do peptídeo Aβ, em vista das crescentes evidências de que
estas formas são neurotóxicas, mesmo na ausência dos depósitos amilóides
(MUCKE e cols., 2000). Um estudo pioneiro demonstrou que os oligômeros de Aβ
(também conhecidos como ADDLs, do inglês Aβ-Derived Diffusible Ligands),
prejudicam mecanismos de plasticidade sináptica por inibir a potenciação de longa
duração (LTP, do inglês long-term potentiation) no hipocampo, evento fisiológico
crucial para a aquisição e formação de memória (LAMBERT e cols., 1998).
Adicionalmente, os oligômeros inibem a reversão da depressão de longa duração
(LTD, do inglês long-term depression) (WALSH e cols., 2002), que é um processo
inicial de depressão sináptica que culmina com a eliminação da espinha (HSIEH e
cols., 2006) e estão presentes no cérebro de pacientes com DA (GONG e cols.,
2003; FERREIRA e cols., 2007). De fato, estudos identificaram os oligômeros de
Aβ em concentrações significativamente mais altas em extratos de cérebros com
DA comparados com indivíduos controles não demenciados, e revelaram ainda,
que as características físico-químicas destes oligômeros endógenos são muito
similares a dos sintetizados in vitro (GONG e cols., 2003, DE FELICE e cols.,
2008). Esses dados reforçam e validam a relevância clínica do uso dos oligômeros
do peptídeo β-amilóide como modelo experimental e ainda como alvo terapêutico
para a Doença de Alzheimer.
Uma dramática redução do número de espinhas dendríticas é observada
após períodos prolongados de incubação com os oligômeros (Hsieh e cols., 2006;
25
LACOR e cols., 2007; De Felice e cols., 2009). Como as espinhas são protrusões
especializadas dos dendritos nas quais ocorrem as sinapses excitatórias, o
impacto dos oligomeros nas sinapses sugere a base para a perda da
conectividade neuronal e conseqüentemente para o déficit cognitivo observado
nos pacientes com a DA. Estes efeitos deletérios sobre as sinapses são
provavelmente resultado da capacidade dos oligômeros de se ligarem com grande
especificidade a sítios sinápticos excitatórios (LACOR e cols., 2004), evento este,
de particular relevância para o mecanismo da perda de memória.
Recentes estudos têm investigado os mecanismos utilizados pelos
oligômeros para danificar a plasticidade sináptica. Um destes, a transmissão
glutamatérgica, é considerada a base para os estímulos excitatórios associados
com aprendizado e memória (BENNETT, 2000). Os receptores de glutamato do
tipo AMPA e NMDA realizam um papel central na transmissão glutamatérgica e
são requeridos para indução de LTP e fortalecimento sináptico (DERKACH e cols.,
2007; LAU e ZUKIN, 2007). Trabalhos adicionais demonstraram uma maciça
redução dos níveis de receptores AMPA e NMDA da membrana neuronal
plasmática (Lacor e cols., 2007; Snyder e cols., 2005; Almeida e cols., 2005;
ROSELLI e cols., 2005; HSIEH e cols., 2006; GOTO e cols., 2006).
De forma significativa, a densidade pós-sináptica 95 (PSD-95, do inglês
post-density-95), uma proteína que forma um arcabouço fundamental para o
ancoramento e estabilização dos receptores AMPA e NMDA, também é reduzida
após tratamento com os oligômeros de Aβ (Roselli e cols., 2005). Dentre os
receptores acima citados, podemos ainda destacar que os receptores de insulina,
que também desempenham um papel crucial para a plasticidade neuronal,
26
encontram-se reduzidos de forma significativa na membrana plasmática após
exposição neuronal aos oligômeros (DE FELICE e cols., 2009; Zhao e cols.,
2008).
É importante ressaltar que, a perda patológica de espinhas e suas
moléculas associadas estão bem descrita para os casos de doença de Alzheimer
(SCHEIBEL e cols., 1975; SHIM e LUBEC, 2002; SCHEFF e PRICE, 2003) e
modelos de camundongos trangênicos para DA (LANZ e cols., 2003; CALON e
cols., 2004; MOOLMAN e cols., 2004; SPIRES e cols., 2005; JACOBSEN e cols.,
2006). Adicionalmente, outros trabalhos demonstraram que tanto pacientes com
DA (GONG e cols., 2003; Lacor e cols., 2004) quanto modelos de animais
transgênicos para DA (Chang e cols., 2003; Oddo e cols., 2006; Ohno e cols.,
2006) acumulam níveis substanciais de oligômeros de Aβ.
Eventos adicionais causados pelos oligômeros, que também interferem com
processos sinápticos importantes, incluem a fosforilação aberrante de tau em
resíduos que característicamente estão hiperfosforilados em cérebros de
pacientes com DA (De Felice e cols., 2008), além de estresse oxidativo e um
influxo neuronal excessivo de cálcio, possivelmente causado pela disregulação
das funções dos receptores NMDA (De Felice e cols., 2007). A reunião destes
achados sugere que as sinapses são o principal alvo dos oligômeros, e que esta
interação leva a mudanças morfológicas e na composição de receptores
resultando na disfunção sináptica, provavelmente responsável pelo declínio
cognitivo inicial que acomete indivíduos com DA (KLEIN, 2006; FERREIRA e
KLEIN, 2011).
27
Figura 3: Hipótese da cascata amilóde revisada. Esquema representativo da provável sequência de eventos que devem levar à doença de Alzheimer. As setas curvas indicam que os oligômeros de Aβ podem diretamente afetar as sinapses. Adaptado de (HARDY e SELKOE, 2002).
28
1.4) Sinalização por Insulina
O tecido muscular esquelético, o tecido adiposo, e o fígado são
classicamente descritos como órgãos sensíveis a insulina, e que desempenham
um papel central, através da sinalização insulinérgica, na regulação periférica do
metabolismo de carboidratos, lipídeos e proteínas. Por outro lado, desde a
primeira descrição da insulina (BANTING e cols., 1922), o cérebro já era
considerado como um órgão insensível à insulina. Entretanto, 30 anos mais tarde,
surgiram as primeiras evidências da ação da insulina sobre o cérebro (WOODS e
cols., 1979), e anos mais tarde, foi demonstrado que seus receptores encontram-
se amplamente distribuídos pelo encéfalo (ZHAO e cols., 2004). Descreveremos
aqui e nos subtópicos seguintes, a sinalização por insulina periférica e central,
respectivamente.
Um dilema interessante que precisa ser enfrentado por todos os animais é
o ciclo de alimentação, seguido pelo jejum que se dá entre as refeições. Os
mamíferos resolvem bem este problema através da estocagem de nutrientes, de
forma que esse estoque possa ser utilizado como fonte de energia durante os
períodos longos de jejum.
Um dos importantes agentes que regulam este processo é a insulina, um
hormônio peptídico de 5,8 kDa, majoritariamente produzido pelas células beta
pancreáticas e liberado na corrente sanguínea. Esta proteína desempenha uma
função bastante importante em regular o ciclo jejum-alimentação, cujo bom
funcionamento é essencial para o suprimento das demandas energéticas e para o
gerenciamento do metabolismo corporal.
29
O aumento da concentração plasmática de glicose, devido a ingestão e
metabolismo de alimentos, estimula a liberação de insulina, a qual induz a
captação de glicose por tecidos-alvo, promove a atividade de processos
anabólicos e inibe a quebra de macromoléculas energéticas no fígado e no tecido
adiposo. Conjuntamente, suas funções antagonizam a ação do glucagon, o qual
apresenta uma atividade máxima em situações de jejum. Neste sentido, os
organismos conseguem atender à demanda corporal por energia e estocá-la
quando em excesso (CARVALHEIRA e cols., 2002).
Complementando às suas funções metabólicas clássicas, a insulina, como
um hormônio anabólico, desempenha um importante papel durante o
desenvolvimento e crescimento, regulando a proliferação e sobrevivência celular.
Inclusive no organismo maduro a insulina é fundamental na modulação dos
processos de envelhecimento e expectativa de vida (TAGUCHI e cols., 2007).
1.4.1) Mecanismos Moleculares
O esclarecimento mais profundo dos mecanismos moleculares da
sinalização por insulina sempre foi de grande interesse de muitos pesquisadores,
diante da complexa ação apresentada por este hormônio (WHITE, 2003). A
cascata de sinalização intracelular da insulina começa com a sua ligação a um
receptor específico de membrana, que pertence a uma subfamília de receptores
tirosina quinase. O receptor de insulina (RI) é uma proteína heterotetramérica
constituído por dímeros intrínsecos ligados por pontes disulfeto, estes, são
compostos por domínios extracelulares (subunidades α) que controlam a atividade
30
tirosina quinase dos domínios transmembrana (subunidades β) (PATTI e KAHN,
1998; Ebina e cols., 1985; ULLRICH e cols., 1985; CARVALHEIRA e cols., 2002).
Após a ligação da insulina na subunidade α, ocorre um aumento da
atividade tirosina quinase das subunidades β, resultando na autofosforilação dos
resíduos de tirosina desta subunidade do receptor de insulina. A fosforilação de
tirosina realiza um papel importante em diversos processos fisiológicos modulando
a atividade de receptores e/ou enzimas presentes em passos iniciais de algumas
cascatas de sinalização, e ainda por coordenar o ancoramento de
multicomponentes de um complexo de sinalização próximo aos receptores
ativados (PAWSON, 1995). É sabido que grande parte dos sinais intracelulares da
sinalização de insulina é gerada através de complexos de sinalização formados
por substratos proteicos que se ancoram próximo aos resíduos de fosfotirosina
após a ativação do receptor de insulina (CARVALHEIRA e cols., 2002; TAGUCHI
e WHITE, 2008).
Atualmente, dez substratos intracelulares do RI tem sido identificados,
dentre os quais, quatro pertencem à família dos substratos do receptor de insulina
(IRS, do inglês insulin receptor substrate protein) (WHITE e YENUSH, 1998;
WHITE, 2006). Outros substratos incluem as proteínas adaptadoras Shc, Gab-1,
p60dok,Cbl, JAK2 e APS (BAUMANN e cols., 2000; PAWSON e SCOTT, 1997;
WHITE e YENUSH, 1998). Embora o papel de cada uma destas proteínas mereça
atenção, estudos sugerem que a maioria das respostas a insulina são amplamente
mediadas através de duas isoformas do substrato do receptor de insulina, IRS-1 e
IRS-2 (WHITE, 2003; TAGUCHI e WHITE, 2008).
31
As proteínas IRS não apresentam uma atividade catalítica intrínseca, sendo
compostas por múltiplos domínios de interação e sítios de fosforilação. No mínimo,
três isoformas de IRS estão presentes em humanos e camundongos, sendo estas
IRS-1 e IRS-2 que são amplamente expressos, e ainda IRS-4, o qual tem sua
expressão limitada ao timo, cérebro, rim e possivelmente a células β pancreáticas.
Roedores também expressam IRS-3, o qual é bastante restrito ao tecido adiposo e
demonstra atividades similares ao IRS-1 (UCHIDA e cols., 2000). Todas as
proteínas IRS apresentam domínios protéicos em sua estrutura denominados a
partir de sua homologia com proteínas já descritas. Dentre os domínios que
permitem o reconhecimento dos IRSs pelo RI e por outras proteínas da via,
podemos citar os domínios PH (do inglês pleckstrin homology), o PTB (phospho-
tyrosine binding) e o SH (Src homology, podendo ser denominados SH2 e SH3),
que são os mais bem descritos e de maior importância (LIZCANO e ALESSI,
2002;Yenush e cols., 1998).
As proteínas IRS são suscetíveis a diversas modificações pós-traducionais
que regulam seus estados de ativação. A fosforilação em resíduos de tirosina, por
exemplo, confere ao IRS a capacidade de ligação a outras proteínas adaptadoras
com domínios SH. Esta propriedade do IRS é fundamental para a amplificação
intracelular do sinal da insulina (ZHAO e ALKON, 2001).
Dentre as moléculas com domínio SH, o alvo mais conhecido do IRS é a
PI3K (do inglês, phosphatidylinositol-3 kinase). Esta enzima, quando ativada pelo
IRS, regula positivamente outros alvos subjacentes que coletivamente propagam
sinais de suma importância para a homeostase corporal, como por exemplo o
crescimento e proliferação celular, além de estimular a exposição dos
32
transportadores de glicose na superfície das células (LIZCANO e ALESSI, 2002;
SALTIEL e KAHN, 2001; WHITE, 2003; PIROLA e cols., 2004).
O balanço da fosforilação do IRS-1 é um dos principais fatores envolvidos
na modulação da amplitude e duração da sinalização por insulina nos órgãos
periféricos, como no fígado e no músculo esquelético. Entretanto, esta via de
sinalização pode sofrer intervenções diversas, como pelo cruzamento de vias
independentes, retroalimentação negativa ou até mesmo pelo balanço energético
celular (TANTI e JAGER, 2009). Portanto a sinalização efetora clássica mediada
pela insulina envolve a ativação de quinases bastante conhecidas, como por
exemplo, a PI3K e Akt/PKB, dentre outras que são apresentados com mais
detalhe abaixo na Figura 6.
33
Figura 4: Sinalização pela insulina e seus amplos efeitos celulares. Esquema
representativo dos mecanismos moleculares decorrentes da ligação da insulina ao
receptor e suas conseqüências celulares. Adaptado de MOSTOSLAVSKY, 2008.
34
1.4.2) Resistência à insulina
A insulina é um dos principais hormônios anabólicos em mamíferos e por
isso se torna essencial para a homeostase metabólica. A ligação da insulina ao
seu receptor dispara a fosforilação em resíduos de tirosina nos seus substratos, tal
como o IRS. Estas moléculas são cruciais para mediar os efeitos biológicos da
insulina (WELLEN e HOTAMISLIGIL, 2005; TANIGUCHI e cols., 2006). Condições
de estresse celular e inflamação podem inibir esse importante componente da via
de sinalização por insulina através de modificações pós-traducionais, tais como
fosforilação em resíduos de serina no IRS, as quais são reguladas por vias
intracelulares regulatórias (ZICK, 2005). Esta inibição é observada na maioria dos
casos em indivíduos obesos que sofrem de resistência a insulina sistêmica e
Diabetes tipo 2 (HOTAMISLIGIL, 2006).
A disfunção na sinalização por insulina resultante da fosforilação em
resíduos de serina pode ser iniciada por elevados níveis de citocinas pró-
inflamatórias, tais como TNFα e IL-1β dentre outros, indicando que mediadores
inflamatórios podem ter um papel regulatório crucial na homeostase sistêmica de
glicose (HOTAMISLIGIL e cols., 1996; HORNG e HOTAMISLIGIL, 2011). A
elucidação dos mecanismos que levam a esta inibição da sinalização por insulina
vem sendo uma das principais questões em muitos laboratórios nos últimos anos.
Estudos prévios estabelecem que o IRS-1 pode ser fosforilado em resíduos
de serina por diferentes quinases resultando na inibição desta proteína em
transmitir o sinal iniciando pela insulina em seu receptor (TANIGUCHI e cols.,
2006).
35
Dentre as principais quinases envolvidas nesta fosforilação do IRS-1, estão
a JNK (do inglês, c-Jun n-terminal kinase), a IKK (IκB kinase), a mTOR (doi inglês,
mammalian target of rapamycin) e a PKR (do inglês, dsRNA-dependent protein
kinase). A hiperativação destas porteínas é um passo crucial para levar a
resistência à insulina em resposta a diversos estímulos de estresse celular
(HIROSUMI e cols., 2002; ARKAN e cols., 2005; NAKAMURA e cols., 2010).
E embora diversas vias inflamatórias possam contribuir para uma
desregulação metabólica em diferentes níveis, a modulação da via de sinalização
por insulina talvez seja a mais crucial, por ser esta uma via metabólica altamente
dominante e conservada no controle da homeostase energética e de nutrientes.
A identificação de um link entre inflamação e a sinalização por insulina vem
apresentando uma sólida plataforma para explorar outros pontos ainda não
elucidados entre as respostas imunes e o controle metabólico (HOTAMISLIGIL e
cols., 1993; XU e cols., 2003). Adicionalmente as citocinas, outros fatores, como
por exemplo, o excesso de lipídeos circulantes, ativam sinalizações inflamatórias
que diretamente inibem a sinalização do receptor de insulina. Em paralelo, vias
pró-inflamatórias também são induzidas por estresse de organelas devido à
sobrecarga de nutrientes, resultando em um processamento anormal que culmina
com o estresse metabólico celular (HOTAMISLIGIL, 2006).
É importante destacar que esse quadro patológico é um fator de risco
chave para o desenvolvimento de diabetes tipo 2, podendo ainda ser agravado
quando associado a outros fenômenos da síndrome metabólica, como obesidade,
hipertensão e hipercolesterolemia (HOTAMISLIGIL e cols., 1996; SAVAGE e
SEMPLE, 2010; FU e cols., 2012; CALAY e HOTAMISLIGIL, 2013).
36
1.4.3) Sinalização por Insulina no Sistema Nervoso Central
Antes da década de 80, pensava-se que o Sistema Nervoso Central (SNC)
seria insensível à estimulação por insulina e que a captaçãode glicose no cérebro
ocorreria de forma independente da ação da insulina. Após as primeiras
descrições da presença da insulina e de seus receptores em diversas regiões do
cérebro, começou-se a especular qual seria a sua origem e papel neste órgão
(HAVRANKOVA e cols., 1983;HAVRANKOVA e cols., 1978;PLUM e cols., 2005).
Estudos posteriores demosntraram que a insulina periférica poderia cruzar
a barreira hematoencefálica e atingir o parênquima cerebral. Este achado pareceu
esclarecer a origem da insulina cerebral, embora trabalhos posteriores tenham
detectado a expressão local de insulina no SNC (MADADI e cols., 2008; VAN DER
HEIDE e cols., 2006). Apesar dessas evidências, a questão da produção de
insulina local no cérebro ainda permanece controversa (ZHAO e ALKON, 2001;
MCNAY e RECKNAGEL, 2011).
A existência clara dos receptores de insulina e seus efetores subjacentes
em diversas estruturas cerebrais, inclusive uma notável presença nas espinhas
dendríticas, levantou sugestões de que esse hormônio apresenta uma importante
função neuronal. Fortes evidências indicam um potencial neurotrófico e
neuroprotetor contra insultos tóxicos (BRUNING e cols., 2000; DI e cols., 2010).
Estudos recentes demonstram que a insulina pode induzir respostas
eletrofisiológicas imediatas (KOVACS e HAJNAL, 2009) e proteção contra morte
neuronal por apoptose no córtex e cerebelo (TANAKA e cols., 1995; RYU e cols.,
1999). De forma interessante, a insulina também pode estimular a plasticidade
37
sináptica, promover sinaptogênese e ainda recupera déficits de LTP induzidos por
Aβ (VAN DER HEIDE e cols., 2005; CHIU e cols., 2008; LEE e cols., 2009).
Portanto, a sinalização por insulina parace ser essencial para os processos
de formação e consolidação de memória (ZHAO e cols., 2004; MCNAY e cols.,
2010; MCNAY e RECKNAGEL, 2011). Estudos recentes demonstram a sua
capacidade de potencializar a função cognitiva em roedores e humanos saudáveis
(DOU e cols., 2005; HAJ-ALI e cols., 2009; OTT e cols., 2012).
Adicionalmente, a sinalização por insulina desenvolve um importante papel
durante o desenvolvimento do sistema nervoso, contribuindo nos processos de
expressão gênica tecidual, proliferação de progenitores, neurogênese e
organogênese (VAN DER HEIDE e cols., 2006; SOUSA-NUNES e cols., 2011;
FERNANDEZ e TORRES-ALEMAN, 2012). Neste sentido, observamos que a
insulina se apresenta como um importante neuromodulador da função cerebral.
1.5) Doença de Alzheimer e resistência à insulina
A idéia de que uma disfunção na sinalização por insulina contribui para a
patogênese da doença de Alzheimer, foi inicialmente proposta há mais de 20
anos, por Hoyer e colaboradores (HOYER e NITSCH, 1989). Poucos anos depois,
um estudo demonstrou que pacientes com diabetes tipo 2 apresentavam uma
chance duas vezes maior de desenvolver a doença de Alzheimer (OTT e cols.,
1996). Estudos clínicos e epidemiológicos posteriores reforçaram essa associação
demontrando que a longa duração do diabetes tipo 2 se correlacionam com
alterações cerebrais significativas e déficits cognitivos nos pacientes (CRAFT e
38
cols., 1998; BIESSELS e cols., 2002; CRAFT e WATSON, 2004; SCHRIJVERS e
cols., 2010).
A associação entre DA e diabetes também foi reforçada em modelos
experimentais de resistência a insulina, os quais demonstram alterações
bioquímicas e comportamentais relacionadas ao déficit cognitivo (WANG e cols.,
2010). De acordo com esta evidência, outro estudo demonstrou que animais
transgênicos para a DA, quando expostos à indução de diabetes experimental,
apresentam um agravamento do quadro cognitivo (TAKEDA e cols., 2010).
Somente recentemente, as bases moleculares para esta correlação entre o
diabetes e a doença de Alzheimer começaram a ser estabelecidas. Um achado
interessante determinou que os níveis de RNAm para insulina, IGF 1/2 e para o
receptor de insulina estão reduzidos no cérebro de pacientes da DA (STEEN e
cols., 2005). Ao mesmo tempo observou–se que a atividade da PI3K e da Akt
estão reduzidas nestes pacientes, sugerindo ums disfunção na sinalização por
insulina cerebral.
As primeiras evidências de como o cérebro de pacientes da DA apresenta
uma disfunção insulinérgica, surgem de dois estudos cruciais, demonstrando que
oligômeros de Aβ se ligam a neurônios hipocampais e disparam a remoção dos
receptores de insulina das membranas plasmáticas das células (Figura 5) (ZHAO
e cols., 2008; DE FELICE e cols., 2009). Pouco depois, foi observado este mesmo
evento no cérebro de pacientes da DA (MOLONEY e cols., 2010). Os neurônios
atacados pelos oligômeros apresentam elevados níveis de receptores de insulina
no corpo celular, sugerindo uma redistribuição subcelular dos receptores (Figura
5). O resultado é uma redução da resposta à insulina, como revelado pela
39
reduzida atividade tirosina quinase do RI em neurônios hipocampais em cultura,
expostos aos oligômeros de Aβ (ZHAO e cols., 2008). De forma interessante,
outro grupo mostrou que os oligômeros de Aβ induzem a disfunção dos RIs,
sugerindo que esta disfunção é o fator principal no mecanismo que leva a inibição
da LTP (TOWNSEND e cols., 2007).
A partir desses estudos, surgiram questionamentos sobre os mecanismos
através do qual as espécies oligoméricas de Aβ pertubariam a sinalização por
insulina. Sabe-se que no diabetes, existe uma conexão bem estabelecida entre a
participação de mecanismos inflamatórios, a ativação de quinases de estresse
celular e o quadro de resistência à insulina (HOTAMISLIGIL, 2006; VALLERIE e
HOTAMISLIGIL, 2010).
Trabalhos recentes apontam para a ativação de quinases de estresse
celular, como por exemplo, a JNK, em cérebros de pacientes da DA, assim como
em modelos experimentais expostos aos oligômeros de Aβ (MA e cols., 2009). No
diabetes tipo 2, essas quinases podem ser estimuladas em resposta à ligação de
citocinas pró-inflamatórias, como por exemplo, o TNF-α (HOTAMISLIGIL e cols.,
1996; HIROSUMI e cols., 2002).
Deste modo, vem sendo fortalecida a idéia de que a doença de Alzheimer
seria um terceiro tipo de diabetes, cujo evento fisiopatológico central é o
desenvolvimento de uma resistência à insulina especificamente no cérebro (DE LA
MONTE e WANDS, 2008). Contudo, tanto a doença de Alzheimer como o diabetes
são causas comuns de morbidade e mortalidade, ressaltando assim a urgente
necessidade de desvendar como a resistência à insulina se desenvolve no cérebro
de pacientes com Alzheimer. O desafio atual é investigar em detalhes os
40
mecanismos moleculares responsáveis por induzir a disfunção da sinalização
insulinérgica cerebral, objetivando o desenvolvimento de uma terapia eficiente
para a DA.
Figura 5: Oligômeros de Aβ removem os receptors de insulin da superfície da membrana neuronal. Uma composição criada pela sobreposição de imagens de imunofluorescencia de um neurônio controle (imagem da esquerda) e um neurônio exposto aos oligômeros de Aβ (AβO) imagem da direita. Imagem da esquerda: Um neurônio saudável na ausência de AβO (nenhuma marcação AβO- positiva em vermelho observada) apresenta uma abundante marcação dendrítica de RI (pontos verdes). Um esquema de um segmento dendrítico é representado no círculo a esquerda. Níveis fisiológicos de Aβ são produzidos e não ocorre acúmulo dos mesmos. A presence do RI na membrane permite a função da sinalização por insulina. Imagem da direita: AβO se ligam aos neurônios (pontos vermelhos) causando a remoção dos receptores de insulina da superfície da membrana (pontos verdes) (ZHAO e cols., 2008; DE FELICE e cols., 2009; FERNANDEZ e TORRES-ALEMAN, 2012). Um esquema de um segmento de um dendrito está representado na direita: AβO se acumulam pelo elevado nível de Aβ gerado pela clivagem da APP. Adaptado de DE FELICE, 2013.
41
1.6) Doença de Alzheimer e Inflamação
Inflamação é parte de um mecanismo de defesa do corpo contra multiplas
ameaças, incluindo infecções e injúrias. Trata-se de uma complexa rede de sinais
envolvendo fatores solúveis e células especializadas que são recurtados a fim de
neutralizar as ameaças e restaurar as codições fisiológias do organismo (BROWN
e cols., 2007). No sistema nervoso central, o processo inflamatório ocorre de
forma muito similar aos órgãos periféricos. No cérebro, as células da glia,
especialmente os astrócitos e as micróglias, são ativados em condições pró-
inflamatórias, elevando a produção de citocinas inflamatórias. Tanto no cérebro,
como no sistema periférico, o quadro de inflamação crônica torna-se deletério, e
pode contribuir para o desenvolvimento de diversas doenças, incluindo as
neurodegeneratvas.
A inflamação possui um papel crucial na patogênese da doença de
Alzheimer. Diversos estudos estabeleceram a presença de características
inflamatórios no cérebro de pacientes da DA, incluindo níveis elevados de
citocinas e marcadoeres de gliose nas regiões atingidas pela doença (PERRY e
cols., 2010; CZIRR e WYSS-CORAY, 2012; AGUZZI e cols., 2013). Um estudo
recente revelou que análises plasmáticas de pacientes com DA apresentam níveis
elevados de mediadores inflamatórios, incluindo fator de nercose tumoral – α
(TNF-α, do inglês tumor necrosis factor-alpha), e interleucina-1β (IL-1β do inglês,
Interleukin-1β) (SWARDFAGER e cols., 2010).
No cérebro, TNF-α é secretado principalmente pelas microglias, em
resposta a algum tipo de trauma, infecção ou estresse celular resultante de
42
acúmulo de agregados protéicos (PARK e BOWERS, 2010). Níveis elevados
desta citocina foram identificados no líquor e no cérebro de pacientes DA
(GRAMMAS e OVASE, 2001; TOBINICK, 2007), assim como no cérebro de
modelos transgênicos para a doença (JIN e cols., 2008; RUAN e cols., 2009).
Adicionalmente, pacientes com transtorno cognitivo leve apresentavam aumento
significativo de TNF-α, indicando a participação desta citocina em eventos iniciais
da patogênese da DA (TARKOWSKI e cols., 2003).
Um dos eventos neurotóxicos induzidos pelos oligômeros de Aβ é a
exacerbada ativação de microglia com elevação dos níveis de mediadores
proinflamatórios como citocinas, como o TNF-α (MCGEER e cols., 2006).
Entretanto, o preciso mecanismo pelo qual o Aβ inicia a resposta inflamatória
mediada pela microglia, ainda é desconhecido (LUE e cols., 2001).
Sabe-se que os elevados níveis de TNF-α são considerados como ponto
central na patogênese do diabetes tipo 2, induzindo um quadro de resistência a
insulina (HOTAMISLIGIL e cols., 1995; HOTAMISLIGIL e cols., 1996). Em
conjunto com essas informações, a associação entre o diabetes tipo 2 e a doença
de Alzheimer têm levantado aspectos ainda não compreendidos sobre essa
conexão. Portanto, seria razoável pensar na correlação entre o impacto tóxico e
inflamatório induzido pelos oligômeros de Aβ, mediado por citocinas como o TNF-
α, sobre a sinalização por insulina nos neurônios. Como de fato, sabe-se que
oligômeros de Aβ induzem a disfunção da sinalização por insulina em neurônios
hipocampais (ZHAO e cols., 2008; DE FELICE e cols., 2009), sinalização que é
fundamental nos processos de aprendizado e memória (DOU e cols., 2005).
43
Possivelmente esta hipótese poderia explicar o efeito deletério destas
neurotoxinas sobre a memória em pacientes com a doença de Alzheimer.
1.7) Transporte axonal
O transporte intracelular é fundamental para todas as células de mamíferos,
especialmente para os neurônios. Um típico neurônio tem uma estrutura altamente
polarizada, com corpo celular diversos dendritos curtos e afilados além de um
longo e fino axônio. A maioria das proteínas que são necessárias ao axônio e ao
terminal sináptico são sintetizadas no corpo celular e transportadas ao longo do
axônio em organelas membranosas ou complexos protéicos (GRAFSTEIN e
FORMAN, 1980). Embora as proteínas dendríticas também sejam transportadas
do corpo celular, diversos RNAm específicos, são transportados até os dendritos
para suportar a síntese protéica local (JOB e EBERWINE, 2001). Além destes,
outros componentes celulares são transportados pelos axônios, sendo estes,
endossomos, mitocôndrias, vesículas sinápticas e vesículas secretoras densas
(DCV´s, do inglês Dense Core Vesicles). Estas são formadas no corpo celular, e
percorrem grandes distancias através de axônios e dendritos, até os sítios pré e
pós sinápticos, onde finalmente liberam seu conteúdo de proteínas e
neuropeptídeos (Wu e cols., 2004). A distância percorrida pelas vesículas são
mais longas, em comparação com outros tipos celulares, pois o axônio de um
neurônio motor humano, pode medir cerca de 1 metro de comprimento (STOKIN e
44
GOLDSTEIN, 2006). O mecanismo de liberação das vesículas em seus sítios de
ação é baseado no transporte de longo alcance sobre os microtúbulos.
Em ambos, dendritos e axônios, os microtúbulos são orientados
longitudinalmente (HIROKAWA, 1982), e servem como trilhos ao longo dos quais,
organelas e macromoléculas podem ser transportadas (HIROKAWA, 1998) (Fig.
5). Os microtúbulos são estruturas protéicas que fazem parte do citoesqueleto das
células, são filamentos longos, como cilindros ocos com aproximadamente 25nm.
São constituídos de um polímero de α e β-tubilina que é dinâmico e instável
(DESAI e MITCHISON, 1997). Esta dinâmica é controlada por proteínas
associadas à microtúbulos (MAP, do inglês microtubules-associated proteins) in
vivo e in vitro (STOKIN e GOLDSTEIN, 2006). Evidências com relação aos
mecanismos que regulam a direção do transporte surgem da determinação da
polaridade dos microtúbulos, altamente organizadas nos axônios. A polaridade
dos microtúbulos direciona o transporte da região proximal (próximo ao corpo
celular) para a região distal (próximo a terminação pré-sináptica) dos axônios
(STOKIN e GOLDSTEIN, 2006). Essas regiões de diferentes polaridades são
reconhecidas por proteínas motoras, como as kinesinas e dineínas, as quais
transformam energia química em movimento mecânico (Lawrence e cols., 2004).
Enquanto o transporte axonal anterógrado regulado por diversas proteínas
motoras da família das kinesinas, estudos sugerem que as dineínas sejam as
principais proteínas motoras envolvidas no transporte axonal retrógrado (STOKIN
e GOLDSTEIN, 2006). A dineína é composta por duas cadeias pesadas, duas
cadeias leves e duas cadeias intermediárias leves. Acredita-se que o transporte
45
mediado por dineína seja regulado pela sua interação com o complexo dinactina, o
qual consiste de diversas proteínas (SCHROER, 2004).
A regulação da atividade das kinesinas e das dineínas, assim como a
regulação do transporte axonal, é pouco compreentendida até os dias de hoje. Em
principio, a regulação pode ocorrer em um dos diversos passos, incluindo o
reconhecimento do cargo e a ligação deste a proteína motora, a velocidade do
transporte, e ainda, o reconhecimento do destino correto pelo complexo proteína
motora-cargo. Dados demonstram que a kinesina-1 pode ser regulada diretamente
pela ligação do cargo (FRIEDMAN e VALE, 1999).
Dentre muitos cargos e parceiros de ligação identificados para as proteínas
motoras anterógradas e retrógradas, alguns parecem estar envolvidos com um
mecanismo de regulação. Estes parceiros incluem a proteína precurssora amilóide
(APP) (KAMAL e cols., 2000), a proteína c-Jun N-terminal kinase (JNK) e as
proteínas que com ela interagem (JIP1, JIP2, JIP3/Sunday driver) (CAVALLI e
cols., 2005). Evidências adicionais sugerem um importante papel da fosforilação
na regulação de proteínas motoras, envolvendo as quinases glicogênio sintase
cinase 3β (GSK3 β) e a quinase dependente de ciclina 5 (CDK 5).
46
Figura 6: Transporte axonal e dendrítico. a. Um típico neurônio, projetando diversos dendritos (esquerda) e um único axônio do corpo celular. b. Proteínas da família das quinesinas transportando vesículas contendo APP, apolipoproteína E, mitocôndrias e vesículas sinápticas, no sentido anterógrado c. Receptores AMPA e NMDA, grânulos de RNAm transportados por quinesinas, no sentido retrógrado, nos dendritos. Adaptado de HIROKAWA e TAKEMURA, 2005.
47
1.7.1) Transporte axonal, envelhecimento e Doença de Alzheimer
Estudos sugerem que no envelhecimento podem ocorrer problemas no
transporte axonal, já que existe uma redução dos trilhos de microtúbulos (CASH e
cols., 2003), assim como mudanças na distribuição de proteínas associadas à
microtúbulos, como a proteína tau e neurofilamentos (NIEWIADOMSKA e
BAKSALERSKA-PAZERA, 2003; UCHIDA e cols., 2004). Outro trabalho observou
um aparente acúmulo de proteínas ao longo do axônio, como a APP
(KAWARABAYASHI e cols., 1993). O entendimento dessas mudanças
relacionadas com a idade na estrutura e função dos axônios permanece não
esclarecido, pois em particular não se sabe se todas as proteínas de transporte
são afetadas, ou se somente algumas vias de sinalização são prejudicadas no
envelhecimento.
Existe uma considerável quantidade de dados consistentes com a hipótese
de que a deficiência do transporte axonal desempenha um papel central na
patogênese de algumas doenças neurodegenerativas, incluindo Huntington
(TRUSHINA e cols., 2004), ALS (LAMONTE e cols., 2002) e da DA (TERRY,
1996). Uma evidência da ampla patologia axonal é a presença de anormalidades
como o intenso acúmulo de diversas moléculas ao longo do trajeto do axônio,
como a APP (CRAS e cols., 1991) e seus metabólitos, neurotransmissores e
proteínas relacionadas, neurofilamentos, tau e glicogênio, assim como uma
redução do trilhos de microtúbulos (CASH e cols., 2003). Dados sugerem que os
defeitos axonais podem coincidir com estágios iniciais da DA (STOKIN e cols.,
2005).
48
Camundongos que possuem uma expressão reduzida de kinesina-1
desenvolveram defeitos axonais, assim como, o aumento excessivo da produção
de Aβ e da deposição de placas (Stokin e cols., 2005). Evidências vêm
demonstrando que o Aβ pode induzir anormalidades axonais (PIKE e cols., 1992),
contribuindo diretamente para a deficiência no transporte axonal (HIRUMA e cols.,
2003). A hiperfosforilação de tau, um macardor da doença de Alzheimer, pode
também afetar diretamente o transporte axonal de APP e de outras moléculas
(STAMER e cols., 2002). Em adição a estes dados, drogas que estabilizam os
microtúbulos foram capazes de prevenir os déficits de transporte observados em
camundongos transgênicos para tau (TROJANOWSKI e cols., 2005). De forma
bastante interessante, o cérebro de indivíduos com DA apresentaram uma
significante redução do transporte axonal (DAI e cols., 2002).
Dados recentes muito interessantes do nosso grupo demonstram que o
tratamento de neurônios hipocampais com oligômeros do peptídeo Aβ é capaz de
reduzir de forma significativa o transporte axonal, demonstrando um novo impacto
dos oligômeros nos neurônios (DECKER e cols., 2010).
49
1.8) Uso da exendina-4 na estimilação da sinalização por insulina cerebral
A busca por novos fármacos para a diabetes específica do cérebro tem
convergido para medicamentos que estimulem a via de sinalização da insulina,
mas cuja ação independa da atividade do receptor de insulina e de seus
substratos imediatos. Os progressos mais recentes apontam as incretinas como
abordagem mais promissora para reparação dos danos neuronais na DA.
As incretinas são hormônios sintetizados primariamente no intestino e
liberados na corrente sanguínea (BARRERA e cols., 2011). Suas funções
consistem em sinalizar o aporte de nutrientes após as refeições e estimular a
liberação de insulina pelo pâncreas. As incretinas mais conhecidas são o peptídeo
insulinotrópico dependente de glicose (GIP, do inglês glucose-dependent
insulinotropic polypeptide), primeiro a ser descrito, e o peptídeo semelhante ao
glucagon (GLP-1, do inglês glucagon-like polypeptide 1) (VILSBOLL e cols., 2003).
O GLP-1 é subproduto do glucagon derivado após clivagem proteolítica
pelas enzimas prohormônio convertases 1 e 3 (PC1/3). Sua forma biologicamente
ativa tem em torno de 30 aminoácidos e tem uma curta meia-vida sérica, sendo
rapidamente metabolizada pela enzima dipeptidil peptidase (DPP) (KAZAFEOS,
2011).
Este peptídeo apresenta um potencial terapêutico enorme para diabetes, já
que reduz rapidamente a glicemia pós-prandial e aumenta a insulinemia
(VILSBOLL e cols., 2003). Contudo, a reduzida meia-vida inviabiliza o uso clínico
da sua forma nativa. Nos últimos anos, entretanto, agonistas modificados com
50
duração ampliada foram encontrados e tem sido alvos de diversos estudos (RYAN
e HARDY, 2011).
O primeiro deles é o exendin-4, que foi isolado da saliva de um lagarto e
não possui o sitio de clivagem da DPP, permanecendo por mais tempo na
circulação (GARBER, 2011). Mais recentemente, modificações orgânicas foram
implementadas à molécula do GLP-1, o que gerou agonistas com meia vida
prolongada (Val-8-GLP1 e liraglutídeo) já aprovados para uso clinico em diabetes
(MORAN e DAILEY, 2009).
O receptor de GLP-1 e de seus agonistas é uma proteína transmembranar
associada à proteína G estimulatória que, por sua vez, ativa a adenilato ciclase
(DONNELLY, 2012). A produção aumentada de AMP cíclico é o principal
transdutor e amplificador do sinal de GLP-1 e induz a ativação da via clássica de
PKA/CREB tanto em células pancreáticas quanto em neurônios. Por outro lado, a
sinalização de GLP-1 é conhecida por ativar a enzima PI3K de uma forma
independente de insulina, o que garante a ocorrência dos efeitos insulinotrópicos
(HOLSCHER e LI, 2010). De fato, a exendina-4 apresenta propriedades protetoras
contra o estresse de reticulo endoplasmático e a morte celular em células β
expostas a insultos tóxicos (YUSTA e cols., 2006; KIM e cols., 2012).
No sistema nervoso central, sabe-se que algumas populações de neurônios
produzem GLP-1, mas o seu receptor é expresso em diversas regiões do cérebro,
inclusive em neurônios hipocampais e corticais (HAMILTON e HOLSCHER, 2009).
Dados recentes sugerem que a sinalização por GLP-1 é importante para a
plasticidade sináptica e formação de memórias (DURING e cols., 2003; MATTSON
e cols., 2003; ABBAS e cols., 2009). A exendina-4 foi capaz de prevenir contra
51
insultos oxidativos e metabólicos em modelos celulares e animais de isquemia e
de doença de Parkinson (LI e cols., 2009).
Além disso, estes agonistas de GLP-1r reverteram a inibição de LTP
induzida por oligômeros de Aβ (GAULT e HOLSCHER, 2008). Uma evidência
adicional do papel central do GLP-1r na plasticidade sináptica é suportada por
dados interessantes que demonstram o déficit cognitivo apresentado por animais
que não expressam receptor de GLP-1 (ABBAS e cols., 2009). Adicionalmente, a
estimulação por GLP-1 parece induzir neurogênese em animais adultos
(HAMILTON e cols., 2011).
Este conjunto de dados recentes que apontam para os efeitos benéficos da
estimulação por GLP-1 no cérebro e nos tecidos periféricos abre caminhos para
aplicações farmacológicas destes conceitos na terapia contra a doença de
Alzheimer e motiva a realização de mais análises para elucidar o cenário completo
de atuação desta sinalização.
52
2) OBJETIVOS
- OBJETIVO GERAL
Investigar a disfunção na sinalização por insulina cerebral induzida pelos
oligômeros de Aβ e sua possível correlação com mecanismos inflamatórios
envolvidos na resistência à insulina periférica.
-OBJETIVOS ESPECÍFICOS
- Investigar se os oligômeros de Aβ induzem aumento de marcadores de
resistência à insulina em neurônios hipocampais;
- Enteder os mecanismos moleculares que propiciam esta condição de disfunção
inulinérgica cerebral;
- Analisar a possível relação entre a inibição da sinalização por insulina no
cérebro induzida pelos oligômeros com mecanismos já estabelecidos associados
ao diabetes;
- Compreender o papel da sinalização de insulina na manutenção da uma função
fisiológica importante da célula neuronal, o transporte axonal, diante do efeito
tóxico dos oligômeros.
- Investigar o possível papel de novas terapias anti-diabetes na prevenção ou
ainda reversão destes fenômenos.
53
3 METODOLOGIA
3.1) Materiais
Peptídeo Aβ1–42, Exendin-4 e o exendin 9-39 foram adquiridos da Bachem
Inc. (Torrance, CA). Peptídeo sintético com a ordem aleatória Aβ1–42 foi
comprado da Anaspec (San Jose, CA). Insulina Bovina e humana, 1,1,1,3,3,3,-
hexafluoro-2-propanol (HFIP), DMSO, poly-L-lysina foram comprados da Sigma
(St. Louis, MO). Reagentes/Meio de Cultura Neurobasal, Anticorpos secundários
Alexa Flúor e o reagente ProLong anti-fade foram comprados da Invitrogen
(Carlsbad, CA). Tampões de Eletroforese foram comprados da BioRad (Hercules,
California). Reagente de quimioluminescencia SuperSignal e kit de dosagemde
proteína BCA foram obtidos da Pierce (Deerfield, Illinois). Anticorpos contra
Substrato do Receptor de Insulina 1 (IRS-1) total, fosforilado na Tyr465, Ser-636,
307, 616, 312 foram obtidos da Santa Cruz Biotechnology (Santa Cruz, CA). Os
peptídeos Exendin 4 and exendin 9-39 foram obtidos na Bachem (Torrance, CA).
O Inibidor da JNK, SP600125, foi obtido da Tocris Bioscience (Ellisville, MO).
Plasmid pβ-actin-BDNF-mRFP foi doado pelo Dr. G. Banker (OHSU, Oregon,
USA). Marcador mitochondrial YFP foi doado pelo Dr. G. Rintoul (SFU, BC,
Canadá).
54
3.2) Preparação e caracterização dos Oligômeros de Aβ
Aβ1-42 (Bachem Inc., Torrance, CA) foi solubilizado a 1 mM em 1,1,1,3,3,3-
hexafluoro-2-propanol (HFIP; Merck) gelado e a solução límpida e incolor
resultante foi incubada à temperatura ambiente por 60 minutos. A solução foi
então colocada em gelo por 10 minutos e aliquotada, em fluxo laminar, em
microtubos. Os microtubos foram deixados abertos na capela de fluxo laminar
durante 12 horas para evaporação do HFIP. A eliminação completa do HFIP foi
feita por centrifugação em SpeedVac® por 10 minutos. As alíquotas contendo os
filmes de Aβ foram estocadas a -20 ºC para utilização posterior.
As preparações dos oligômeros de Aβ foram feitas, a partir destes
estoques, segundo protocolo previamente descrito (LAMBERT e cols., 1998). A
cada preparação dos oligômeros, uma alíquota de Aβ foi ressuspensa em
dimetilsulfóxido anidro (DMSO; Sigma, St. Louis, MO) de forma a obter uma
solução a 5 mM. Esta solução foi diluída em PBS estéril a 100 μM e incubada a 4
ºC por 24 horas. Uma amostra de mesmo volume de DMSO 2% em PBS foi
preparada e incubada a 4ºC por 24 horas, e usada experimentalmente como
controle (veículo). Após a incubação, a preparação foi centrifugada a 14.000 g por
10 minutos a 4ºC para remoção de agregados insolúveis de Aβ. O sobrenadante
da centrifugação, contendo os oligômeros, foi mantido a 4ºC até a sua utilização
em um período máximo de até 48 horas após o preparo. Para determinar a
concentração dos oligômeros nas preparações, utilizou-se o método de BCA
(Pierce, Rockford, IL).
55
Como são metaestáveis, as preparações dos oligômeros, realizadas
semanalmente no laboratório, são rotineiramente analisadas por Western blot e
cromatografia de gelfiltração para caracterizar as espécies oligoméricas presentes.
3.2.1) Gel-filtração por HPLC
As análises foram feitas com uma coluna de sílica SynChropak® GPC 100
com as seguintes características: dimensão da coluna: 250 x 4,6 mm; tamanho do
poro: 100 Å; limite de exclusão para proteínas: 3.000-300.000 kDa. A fase móvel
usada foi PBS pH 7, filtrado através de membrana de nitrocelulose Millipore
(Billerica, MA) 0,45 μm, mantido em gelo durante toda a análise. As análises foram
feitas através de cromatografia líquida de alto desempenho (high performance
liquid chromatography, HPLC), com detecção simul-tânea de absorção a 280 nm
e fluorescência com excitação a 275 nm e emissão a 305 nm. Antes da injeção da
amostra dos oligômeros, a coluna foi lavada durante 1 hora com água Milli-Q® e
equilibrada por 1 hora com a fase móvel, ambas com fluxo de 0,5mL/min.
Inicialmente, 50 μL de veículo (DMSO 2% em PBS) foram injetados, com fluxo de
0,5mL/ min e tempo de corrida de 15 minutos. Em seguida, a coluna foi re-
equilibrada com a fase móvel durante 15 minutos e 50 μL dos oligômeros foram
injetados, e a análise feita com os mesmos parâmetros usados para o veículo. Os
dados das cromatografias foram transferidos para o programa Microsoft® Excel
2002, onde os cromatogramas foram preparados para rela- tórios semanais de
caracterização das preparações.
56
Figura 7: Cromatograma representativo de gel-filtração dos Oligômeros (ADDLs). Através da gel-filtração é possível detectar duas populações de agregados. A primeira, formada por oligômeros de alto peso molecular (50-100 kDa), elui entre 3,5 – 4 minutos. Agregados de 2-3 monômeros eluem mais tarde, entre 7,5 – 8 minutos.
3.2.2) Western blot para Oligômeros de Aβ (ADDLs)
Amostras das preparações dos oligômeros foram adicionadas a tampão de
amostra e resolvidas por eletroforese em gel de gradiente de 10–20% de
acrilamida (Invitrogen) com tampão de corrida Tris/Tricina/SDS, a 120 V por 60
minutos à temperatura ambiente. O material no gel (20 pmol de Aβ/canaleta) foi
eletrotransferido para membranas de nitrocelulose Hybond ECL (Amersham
Biosciences, Piscataway, NJ) a 100 V por 1 hora a 4 °C, usando tampão contendo
25 mM Tris, 192 mM glicina, 20% (v/v) metanol, 0,02% SDS, pH 8,3. As
57
membranas foram bloqueadas com BSA 3 % em tampão Tris-HCl 20 mM
contendo Tween-20 0,1 % (TBS-T) por 1 h à temperatura ambiente. Um anticorpo
monoclonal murino específico contra oligômeros de Aβ (NU1), gentilmente doado
pelo Dr. William Klein, da Universidade Northwestern (Evanston, USA), foi diluído
a 1 μg/mL em BSA 3 %/TBS e incubado com as membranas por 90 minutos. Após
três lavagens de 10 minutos com TBS-T, as membranas foram incubadas com
anticorpo secundário anti-IgG de camundongo conjugado com peroxidase na
diluição de 1:50.000 (em TBS-T) por 1 hora. As membranas foram lavadas três
vezes por 10 minutos com TBS-T e reveladas com o substrato SuperSignal West
Femto Maximum Sensitivity (Pierce, Rockford, IL) diluído 1:1, e expostas em filme
Kodak.
58
Figura 8: Western blot representativo das preparações de Oligômeros de Aβ. O tamanho dos agregados varia de dímeros até oligômeros de ~50-100 kDa. Imagem de microscopia eletrônica de transmissão (aumento de 85.000x) obtida pela Dra. Andréa Paula-Lima.
3.3) Culturas primárias de hipocampo rato
Embriões de rato Sprague-Dawley foram obtidos de ratas com 18 dias de
gestação para preparo de culturas de hipocampo. Após decapitação dos
embriões, os encéfalos foram removidos e transferidos para uma placa de Petri
contendo solução estéril de PBS glicose 2% a 37ºC. Com o auxílio de lupa, os
hipocampos foram dissecados, as meninges foram retiradas e o tecido foi
fracionado com tesoura cirúrgica estéril. As células foram dissociadas
59
mecanicamente com pipetas Pasteur de pontas flambadas, e centrifugadas a 1000
X g por 4 minutos à temperatura ambiente. Após remoção do sobrenadante, as
células foram ressuspensas em meio Neurobasal suplementado com 2% de
suplemento B27 (Gibco, Grand Island, NY), 0.5 mM de glutamina (Gibco), 100
U/mL de penicilina/estreptomicina (Gibco) e 10 μg/mL de fungizona (Cristália,
Itapira, SP). Após quantificação em câmara de Neubauer, as células foram
plaqueadas com densidade de 1.500 células/mm2 (placas de 6 e 96 poços, 100 e
400 μL por poço respectivamente) e 1.000 células/mm2 (placas de 6 poços, 1,5 mL
por poço) . As placas foram previamente tratadas com solução de poli-L-lisina a 10
μg/mL. As culturas foram mantidas a 37ºC, em estufa umidificada contendo 5%
CO2/95% ar atmosférico, por períodos de 18-21 dias in vitro (DIV). Um terço do
volume de meio em cada poço foi trocado por meio Neurobasal suplementado
fresco a cada 7 DIV.
3.4) Neuropatologia de cérebro humano
Pacientes com a Doença de Alzheimer e indivíduos não demenciados (Non
congnitive impairment, NCI) foram submetidos à necropsia com o consentimento
do Centro de Pesquisas de Doenças Neurodegenerativas na Universidade da
Pensilvania (Center for Neurodegenerative Disease Research at the University of
Pennsylvania). O diagnóstico clínico de Alzheimer foi concedido com base no
critério de NINCDS-ADRDA, e foi adicionalmente confirmado pelo exame pós-
mortem do córtex cerebral e do hipocampo para a presença de placas senis e
emaranhados neurofibrilares. Uma combinação dos grupos foi usada para agrupar
60
22 indivíduos de cada caso (DA e não demenciados), com o mesmo sexo, idade
similar (variando no máximo 5 anos), e um intervalo pós-mortem similar ( dentro
de 7 horas). Esse conjunto de informações encontram-se reunidos na Tabela
Suplementar 1 (artigo Bomfim e cols, 2012). Tanto os indivíduos não-demenciados
controle, quanto os pacientes com Alzheimer não apresentaram histórias ou
sintomas de condições psiquiátricas ou distúrbios neurológicos diferentes da
doença de Alzheimer.
No processo de necropsia, cada cérebro foi seccionado em cortes coronais,
dos quais um semento rostrocaudal da região do hipocampo (por exemplo, giro
denteado, subiculum e giro parahipocampal) foi dissecada e fixada em fluido de
Bouin, tampão neutro de formalina 10% ou em etanol 70% em salina por 24-48
horas. Em cada um dos grupos, as amostras de tecido do grupo controle e dos
pacientes com Alzheimer foram escolhidas do mesmo hemisfério e preservadas
nas mesmas soluções de fixação. Após ficarem embebidas na parafina, os cortes
coronais foram seccionados em fatias de 6µm, montadas nas lâminas e em
seguida, submetidas às reações de imunohistoquímica para IRS-1636/639 com o
anticorpo da Cell Signaling Technology com o código 2388 com a diluição de
1:100 usando o método avidina-biotina peroxidase (TALBOT e cols., 2004)
Os cortes de todos os grupos reagiram juntos nas mesmas soluções e
foram expostos nos mesmos tempos necessários para quantificar a
imunohistoquímica. Um segundo grupo de fatias dos dois grupos foi submetido ao
mesmo processo novamente para confirmar os resultados. Uma série de
fotomicrografias (100x) cobrindo toda a região de CA1 Do hipocampo em cada
corte foram tiradas usando um suporte motorizado, e as montagens foram criadas
61
usando um software Image-Pro Plus (Media Cybernetics Inc.). Todas as imagens
do grupo controle e do grupo Alzheimer foram capturadas sob as mesmas
condições de exposição de luz. Cincos dos casos de Alzheimer foram testados
para a especificidade do anticorpo de IRS-1pSer636/639 usado nas analises de
imunocitoquímica (Figura Suplementar 1de Bomfim e cols., 2012).
3.5) Injeção intracerebroventricular (i.c.v.) em camundongos.
Camundongos fêmeas nocaute para o receptor de IL-1β em um backgound
C56/BL6 e os camundongos selvagens foram concedidos pela Professora Maria
Bélio (Instituto de Microbiologia Paulo Góes – IMPG/CCS, na Universidade
Federal do Rio de Janeiro – UFRJ). Os animais foram alocados em grupos de 5
em cada caixa com livre acesso a comida e água sob um ciclo de 12h
claro/escuro, com a temperatura e humidade controlada. Todos os procedimentos
usados no presente estudo seguiram os “Princípios de cuidados de animais de
Laboratório” (Instituto Nacional de Saúde, EUA) e foram aprovados pelo Comitê de
cuidados e uso de animais Instituicional da Universidade Federal do Rio de
Janeiro (protocolo IBqM 075-05/16).
Para iniciar o processo de injeção i.c.v. de oligômeros, os animais foram
anestesiados por 7 minutos com 2.5% de isofluorano (Cristália, São Paulo, Brasil)
usando um sistema de vaporizador (Norwell, MA) e foi gentilmente contido neste
sistema somente durante o procedimento da ineção. Uma agulha de 2.5mm foi
inserida unilateralmente 1mm a direita do ponto médio, equidistante de cada olho.
Em seguida era injetado 10pmol de oligômeros de Aβ ou veículo, em um total de
62
volume de 1µL para os camundongos C57/BL6. O mesmo volume era injetado de
um corante azul no ventrículo lateral para verificar a capacidade de difusão
através da circulação do fluido cérebro espeinhal, e assim alcançando todo o
cérebro. Ao final do experimento, a injeção de marcador azul era realizada pata
verificar a acurácia de injeções corretas no ventrículo lateral. Os camundongos
que apresentavam qualquer sinal de erro de localização da injeção ou de
hemorragia cerebral (~5% dos animais) eram excuídos das análises posteriores.
3.6) Injeções de Aβ no cérebro de macacos e estudos neuropatológicos
Quatro macacos cinomolgos (Macaca fascicularis) com 9 anos de idade
(pesando 4.7-7.0kg) foram usados. Os animais estavam sob supervisão dos
veterinários da Queen´s Univesity. Os oligômeros de Aβ foram injetados de forma
crônica através de uma cânula i.c.v.. Três animais receberam 100µg de
oligômeros a cada três dias por 24 dias. A preparação de oligômeros de Aβ era
sempre fresca e prontamente caracterizada por cromatografia de exclusão por
tamanho (size-exclusion chromatography, SEC) antes das injeções. Um animal foi
somente operado e neste foi implantada uma cânula no ventrículo lateral no
mesmo modo que os outros animais, como controle experimental.
No final deste protocolo experimental, os animais foram sedados com
anestésico intramuscular (Ketamina 10mg/kg), com 0.01mg/kg de buprenorfina
para analgesia, seguida por uma injeção intravenosa de 25mg/kg de Pentobarbital.
A próxima etapa foi a perfusão dos animais com PBS seguido por 4% de
paraformoldeído em PSB, depois mais 4% de paraformoldeído em PSB contendo
63
2.5% de Glicerol; Seguindo PBS mais 5% de Glicerol, finalizando a perfusão com
PBS mais 10% de Glicerol. O cérebro dos quatro animais foram fatiados em cortes
de 40µm. Analise de imunohistoquímica foram realizadas usando cortes em free-
floating das regiões do hipocampo e córtex temporal. Essas fatias ficaram em PBS
contendo 1% Tritton incubado com 0.1M tampão citrato, pH6 aquecidas a 60ºC
por 5 minutos. O bloqueio dos cortes foi com BSA 5% em % de soro normal de
cabra (normal goat serum, NGS) e 1% de Triton x100 por 3 horas a temperatura
ambiente. Os anticorpos primários (IRS-1pSer636, JNKpThr183/Tyr185, GFAP)
foram diluídos em solução de bloqueio e os cortes foram incubados overnight a
4ºC, seguindo com a incubação dos anticorpos secundários conjugados com
Alexa-Fluor por 2 horas a temperatura ambiente. A autofluorescência do tecido foi
eliminada com uma incubação prévia com 0.06% de permanganato de potássio
por 10 minutos a temperatura ambiente. Os núcleos foram marcados com DAPI
por 5 minutos. As lâminas foram montadas com ProLong e as imagens foram
adquiridas usando o módulo apotome do microscópio Zeiss Axio Observer Z1.
3.7) Tarefa de Reconhecimento de Objetos
Os experimentos de reconhecimento de objetos foram realizados em uma
arena de campo aberto. Os objetos do teste são feitos de plástico ou vidro e
possuem diferentes formas, cores, texturas e tamanho. Durante as etapas do
teste, os objetos são fixados com uma fita adesiva no chão, assim os animais não
os movimentam. Nenhum dos objetos usados nos experimentos evocou uma
preferência inata nos animais. Durante as sessões de habituação, cada animai foi
64
substituído em um intervalo de 5 minutos, nas quais eles exploraram livremente a
arena vazia.
Ainda na etapa de habituação, o número de linhas que os animais cruzam
no chão (número de cruzamentos) e o número de vezes que os animais exploram
(elevação sobre as patas dianteiras, denotando comportamento de exploração)
foram controlados para verficar possível alteração locomotora ou exploratória em
função dos tratamentos. O treino consiste em sessões de 5 minutos, nas quais os
animais individualmente são colocados no centro da arena na presença de dois
objetos idênticos. O tempo de exploração de cada objeto é anotado pelo
pesquisador. A arena e os objetos são limpos para remover qualquer odor ou
estímulo para o próximo animal. Duas horas depois do treino, os animais foram
reinseridos na arena para a sessão de teste, neste momento, um dos objetos
usados no treino, foi substituído por um novo objeto. Novamente, o tempo de
exploração do objeto familiar e do novo objeto foi medido. Os resultados são
expressos como o percentual de tempo de exploração de cada objeto durante o
treino ou durante o teste. Foi usado o Teste T comparando a média do tempo de
exploração para cada objeto com um valor fixo de 50%. Por definição, animais que
reconhecem um objeto como famíliar (no aprendizado normal, por exemplo)
exploram o objeto novo por um tempo significativamente mais longo do que 50%
do tempo total.
65
3.8) Tratamento com os oligômeros de Aβ e agentes farmacológicos
Após o período de 18 a 21 DIV, as culturas dissociadas foram incubadas
com soluções de veículo (DMSO) ou de oligômeros de Aβ (AβOs), recém-
preparadas como descrito acima, a uma concentração final de 500 nM de Aβ por
tempos que variaram de acordo com a análise. Para analisar a fosforilação de
IRS-1 após 3h de exposição aos AβOs, as culturas foram pré-tratadas com 300
nM de Exendin-4 (Bachem, Torrance, CA), 1 µM de insulina recombinante humana
(Sigma, St Louis, MO), 10 µM de anticorpo neutralizante de TNF-α Infliximab ou 1
µg/mL de inibidor seletivo de JNK SP600125 (Tocris Bioscience, CA) por 30
minutos antes da adição dos AβOs.
3.9) Animais Transgênicos
Camundongos APP/PS1, contendo dois transgenes humanos (APP com
mutação sueca e mutante de deleção da presenilina-1, no qual o éxon 9 está
ausente) foram adquiridos do The Jackson Laboratories (Bar Harbor, ME) e
criados em biotério especializado até o final dos procedimentos de
experimentação. Animais selvagens (wild type) pareados por idade e linhagem
também foram criados e usados como controle em parte dos experimentos. Antes
das manipulações farmacológicas, os animais foram devidamente genotipados. A
descrição da genotipagem se encontra em material suplementar.
66
Os animais permaneceram em gaiolas com disponibilidade de alimento e
água ad libitum em salas com controle de temperatura (21,5 ± 1oC) e de período
circadiano (12h luz, 12h escuridão).
Estes animais transgênicos são gerados a partir da inserção randômica dos
dois transgenes em apenas um lócus da linhagem germinativa de camundongos
C57BL/6. Cada gene inserido é controlado pela região promotora da proteína
príon murina e contém uma seqüência de cDNA (JANKOWSKY e cols., 2001).
Um dos genes codifica para a proteína precursora amilóide quimérica
modificada contendo a mutação sueca (substituições K595N e M596L),
relacionada a casos genéticos da DA em humanos. O outro transgene
corresponde a uma versão mais ativa da presenilina-1, que sofreu a deleção do
éxon 9 humano, também relacionado a DA familiar (MULLAN e cols., 1992; ISHII e
cols., 1997; HILTUNEN e cols., 2000; RABE e cols., 2011). Estes construtos são
competentemente expressos nos animais.
A manipulação genética nestes camundongos provoca alterações
moleculares, fisiológicas e cognitivas que remetem ao fenótipo de doença de
Alzheimer em humanos e são intensificadas ao longo do envelhecimento murino
(SAVONENKO e cols., 2005; GIMBEL e cols., 2010; VOLIANSKIS e cols., 2010).
3.10) Administração de Exendina-4 em animais transgênicos.
Animais transgênicos APP/PS1 com idades entre 10 e 14 meses receberam
injeções intraperitoneais diárias do agonista farmacológico do receptor de GLP-1
67
(Exendina-4, 25 nmol/kg) ou veículo (solução salina). O exendina-4 foi
administrado por 3 semanas. O peso dos animais foi acompanhado durante os
tratamentos. Ao final, os animais foram sacrificados e tiveram seus encéfalos
removidos e dissecados.
3.11) Imunocitoquímica
Após 18-19 DIV, foi avaliado o nível de imunodetecção de IRS-1 fosforilado
em resíduos de serina 636 ou tirosina 465, além da imunodetecção de ligação dos
oligômeros em culturas de hipocampo expostas ou não aos oligômeros de Aβ (500
nM) durante 3 horas. As células foram fixadas pela adição de paraformaldeído 4%
a igual volume de meio de cultura por 5 minutos, seguido de incubação apenas
com paraformaldeído 4% durante 10 minutos. As células foram, então, bloqueadas
por 2 horas em solução contendo 10 % de NGS (Gibco, Grand Island, NY) em
PBS, em câmara úmida, temepratura ambiente. Após o bloqueio, as células foram
incubadas a 4 oC por 12 horas na presença do anticorpo primário monoclonal anti-
oligômeros de Aβ 1μg/mL (NU4) (LAMBERT e cols., 2007) gentilmente cedido
pelo Prof. William Klein (Northwestern University). Após a lavagem com abundante
volume de PBS, as células foram incubadas com os anticorpos policlonais IRS-2,
IRS-1 ou p-IRS-1(pSEr636, pSer312, pSer616, pSer317 ou pTyr 465) (Santa Cruz
Biotechnology, Santa Cruz, CA ) (1:200 por duas horas temperatura ambiente em
solução contendo 10 % de NGS, 0,1 % de Triton X-100 (Merck, Darmstadt, DE)
em PBS, em câmara úmida. Após a incubação com os anticorpos primários, as
células foram extensamente lavadas com PBS. Anticorpos secundários anti-IgG
68
murino conjugado a Alexa 555 (Molecular Probes, Carslbad, CA) e anti-IgG de
coelho conjugado a a Alexa 488 (Molecular Probes, Carslbad, CA) foram diluídos
em solução de bloqueio a 1:2.000 e adicionados às células. Após 2 horas de
incubação, as células foram lavadas três vezes com PBS. As lamínulas com as
células foram montadas em lâminas na presença de Prolong® e examinadas ao
microscópio de fluorescência invertido TE300 Nikon Eclipse. Foram obtidas
imagens de vinte a trinta campos, aleatoriamente escolhidos, em cada uma das 3
lamínulas para cada condição experimental.
3.12) Analises por Western blot das amostras de hipocampo dos animais
transgênicos e das culturas de neurônios hipocampais
Animais transgênicos APP/PS1 e controle de 13-14 meses de idade foram
usados nestes experimentos. Os grupos experimentais de animais transgênicos
tratados com exendina-4 (n=9) ou com o veículo (n=7) e animais selvagens
controle (n=8) foram eutanasiados. Para as análises de western blot o hipocampo
dos animais transgênicos e as culturas de células hipocampais foram
homogeneizadas em tampão RIPA contendo inibidores de protease e fosfatase.
As amostras foram resolvidas em um gel de poliacrilamida 4-20% com um
tampão Tris-glicina-SDS, com uma voltagem de corrida de 125V por 80 minutos a
temperatura ambiente. As amostras de 42µg de proteína total/poço foram
transferidas para uma membrana de nitrocelulose (Hybond ECL) usando um
tampão de transferência com 25mM Tris, 192mM glicina, 20% (v/v) de metanol e
0,02% SDS com o pH 8.3 a 350mA por 2 horas a 4ºC. As membranas foram
69
bloqueadas usando uma solução de bloqueio de 5% de leite em tampão Tris
contendo Tween-20 (0,1% de Tween-20 em 20mM Tris-HCL, pH 7.5 e 0,8% NaCl)
por 1 hora a temperatura ambiente.
Os anticorpos primários (anti–IRS-1pSer636; pSer312; pSer307; pSer616 or
anti–IRS-1 e anti–IRS-2 [1:200], anti–p-JNK [Thr183/Tyr185], anti-JNK [1:1,000],
anti–TNF-α, anti-TNFR1, e anti-GLP1R [1:200], ou anti–cyclophilin B [1:10,000])
foram diluídos na solução de bloqueio e incubados nas membranas por 2 horas a
temperatura ambiente. Seguimos com a incubação dos anticorpos secundários
conjugados com HRP anti-mouse ou anti-rabbit (1:10.000) por 1 hora. Após esta
etapa as membranas foram reveladas usando o substrato SuperSignal West
Femto Maximum Sensitivity em filme fotográfico.
Para a análise dos níveis de TNFα, culturas de hipocampo de rato foram
expostas a 500µM de oligômeros de Aβ ou o volume equivalente do veículo por 3
horas. O meio de cultura foi removido e concentrado por centrifugação Speedvac
(Savant Instruments Inc.). A concentração de proteína foi determinada no meio de
cultura através do ensaio por BCA protein assay kit (from Pierce). As amostras
foram resolvidas em gel de poliacrilamida 4%–20% seguindo os métodos descritos
acima para Western blotting usando um anticorpo anti-TNFα.
3.13) Análises dos dados
A intensidade de imunofluorescencia observada na marcação das proteínas
IRS-2, IRS-1, p–IRS-1(pSer636; pSer312; pSer616; pSer307; or pTyr465) e na
ligação dos oligômeros foi analisada de 3-6 experimentos diferentes usando
70
culturas neuronais independentes. Em cada experimento adquirimos de 20-30
imagens de três lamínulas diferentes em cada condição experimental. A análise
dos histogramas das intensidades de Fluorescencia foram realizadas usando o
programa NIH ImageJ (http://rsbweb.nih.gov/ij/) as described previously (DE
FELICE e cols., 2007). As análises estatísticas foram feitas pelo método ANOVA
seguido de um pos-teste Bonferroni post-hoc.
Para a neuropatologia do cérebro dos macacos, a densidade de marcação
do IRS-1pSer636 e p-JNK foram determinadas após usar um thresholding
apropriado usando o Image J. Para cada animal, a densidade de imunomarcação
foi medida em um grupo de 20-31 campos através do giro denteado do hipocampo
e através do córtex temporal. Os testes estatísticos foram realizados pelo método
ANOVA seguido do pós-teste Bonferroni post-hoc.
3.14) Expressão dos Plasmídeos
Os plasmídeos para expressar pβ-actin-BDNF-mRFP e pJPA5-YFP-JBD
foram doados pelo Dr. Gary Banker (Jungers Center for Neurosciences Research,
Oregon Health and Science University, Portland, Oregon, USA). O marcador
mitochondrial YFP foi doado pelo Dr. Gordon Rintoul (Department of Biological
Sciences, Simon Fraser University, Burnaby, British Columbia, Canada). Os
plasmídeos foram transfectados nos neurônios hipocampais em cultura (9-12 DIV)
usando lipofectamina 2000 (Invitrogen). Em seguida deixamos as células
expressarem os constructos por 24 horas, antes de desafiá-las com os oligômeros
de Aβ.
71
As céluas em seguida foram imageadas vivas usando um microscópio de
fluorescência de amplo campo (DMI 6000 B, Leica), como descrito previamente
(DECKER e cols., 2010). A distinção dos axônios e dendritos foram inicialmente
baseadas pela morfologia e em seguida confirmada pela marcação para MAP2,
uma proteína de citoesqueleto dendrítica (KWINTER e cols., 2009).
72
4) RESULTADOS
4.1) Agentes antidiabéticos protegem o cérebro de camundongos de uma
disfunção na sinalização por insulina causada pelos oligômeros de Aβ
associados a doença de Alzheimer.
(Título em inglês: “An anti-diabetes agent protects the mouse brain from defective
insulin signaling caused by Alzheimer’s disease–associated Aβ oligomers”)
Tendo em vista o crucial papel da sinalização por insulina cerebral para a
plasticidade sináptica, formação de memrória e aprendizado (ZHAO e cols., 2004;
VAN DER HEIDE e cols., 2005; CHIU e cols., 2008), funções estas, que
sabidamente estão afetadas na doença de Alzheimer (FERREIRA e KLEIN, 2011)
adicionado ao fato de que a sinalização por insulina no cérebro de pacientes com
Alzheimer está prejudicada (STEEN e cols., 2005; MOLONEY e cols., 2010)
formulamos a hipótese de que o ataque dos oligômeros de Aβ sobre esta
importante via de sinalização poderia contribuir para a perda de memória,
característica principal da doença de Alzheimer.
Os resultados apresentados no artigo estabelecem que a sinalização por
insulina está deficiente no cérebro de pacientes com Alzheimer, assim como em
roedores e nos modelos de primatas não –humanos para a doença de Alzheimer,
por mecanismos similares aos que são observados na resistência a insulina em
pacientes diabéticos. Verificamos uma ativação anormal da via de sinalização
TNFα/JNK nos neurônios expostos aos oligômeros de Aβ, tanto in vitro quanto in
vivo, resultando na fosforilação do IRS-1 em resíduos de serina, conhecida por
73
inibir a função do IRS-1 e por disparar resistência à insulina periférica em
pacientes diabéticos (HOTAMISLIGIL e cols., 1996; HIROSUMI e cols., 2002).
Nossos achados demonstraram que Exendin-4, um composto anti-diabético
que estimula a via de insulina através do receptor de GLP-1, preveniu a inibição
do IRS-1 em culturas hipocampais, e de forma significativa reverteu a disfunção da
sinalização por insulina em camundongos transgênicos para a doença de
Alzheimer. A reunião dos dados apresentados no artigo a seguir sugere que a
estimulação dos receptores de GLP1 seria uma possível e promissora abordagem
terapêutica para restaurar a disfunção da sinalização por insulina presente no
cérebro de pacientes com Alzheimer.
4.2) Resultados adicionais I
No intiuito de melhor compreender outros mecanismos que possivelmente
contribuiriam para a inibição da sinalização por insulina na doença de Alzheimer,
levantamos a hipótese de que outras vias inflamatórias, que se encontram
exacerbadamente ativadas em pacientes DA, poderiam mediar os efeitos tóxicos
induzidos pelos oligômeros de Aβ.
Nossos dados prévios demonstram a ação da via TNFα/JNK na inibição da
sinalização por insulina induzida pelos AβOs, uma vez que a utilização de um
anticorpo neutralizante de TNFα, Infliximab, ou de um inibidor farmacológico da
quinase de estresse JNK (SP600125) impediram completamente a fosforilação do
IRS-1 em resíduos inibitórios de serina (Figura 4 E-I), evidenciando a importante
participação desta via na inibição insulinérgica na doença de Alzheimer.
74
Outro mediador inflamatório que se encontra em níveis bastante elevados
no cérebro de pacientes DA é a IL-1β. A crônica deposição de Aβ estimula a
persistente ativação de células como as micróglias na doença de Alzheimer,
resultando em elevados níveis de IL-1β encontrados no cérebro dos pacientes DA
(PRINZ e cols., 2011). Considerando o envolvimento da via de IL-1β na
patogênese da DA, levantamos a hipótese de que possivelmente, essa importante
citocina poderia mediar os efeitos tóxicos dos oligômeros de Aβ sobre a via de
sinalização por insulina e a capacidade de aprendizado e memória.
Para avaliar a participação da sinalização por IL-1β na inibição do IRS-1
induzido pelos AβOs, utilizamos o modelo de cultura de neurônios hipocampais
tratados com um antagonista do receptor de IL-1β (IL-1βRa), previamente ao
desafio com os oligômeros de Aβ. Nosso resultado demonstrou um bloqueio total
do aumento dos níveis de IRS-1pSer induzido pelos AβOs nas céluas tratadas
previamente com o IL-1βRa, sugerindo fortemente que a inibição do IRS-1
induzida pelos oligômeros possivelmente é mediada pela sinalização por IL-1β.
75
Figura 1: Antagonista do receptor de IL-1β (IL-1βRa) previne a inibição do IRS-1 induzido pelos oligômeros de Aβ. Culturas de neurônios hipocampais expostas ao veículo, aos AβOs ou ao antagonista do receptor de IL-1β previamente ao desafio com os AβOs. Imagens representativas demonstram os níveis de IRS-1pSer636 nas diferentes condições. Os níveis de imunofluorescencia foram quantificados a partir de 30 imagens de 3 experimentos independentes. * P<0,05 comparado as culturas tratadas com veículo; ** P<0,05 comparado as culturas tratadas com AβO.
Nosso próximo passo foi investigar a participação da via de sinalização de
IL-1β no déficit cognitivo induzido pelo impacto tóxico dos oligômeros de Aβ no
cérebro, uma vez que nosso resultado prévio demostrou que esta via esta
envolvida com a inibição da via de insulina, que por sua vez é fundamental para
Veh AβO IL-1βRa +AβO
*
**
76
formação de memória e aprendizado. Para responder essa pergunta nós
realizamos uma única injeção de 10pmol de oligômeros de Aβ no ventrículo lateral
cerebral de camundongos que não expressam o receptor de IL-1β (IL-1βR KO),
um modelo experimental que foi recentemente introduzido em nosso grupo para
avaliar in vivo a disfunção e o déficit de memória da doença de Alzheimer (LEDO e
cols., 2013; FIGUEIREDO e cols., 2013). Os animais foram em seguida
submetidos ao teste comportamental de Reconhecimento de objetos. Nossos
resultados demonstraram que os oligômeros de Aβ foram incapazes de causar o
déficit de memória nos animais IL-1βR KO, ao contrário do que foi observado nos
animais selvagens expostos aos oligômeros. Como podemos notar na Figura 2, na
tarefa comportamental de Reconhecimento de Objetos (Figura 2), realizada 24h
depois da injeção de AβOs. Esse resultado indica que a via pró-inflamatória de IL-
1β tem um importante papel no déficit cognitivo induzido pelos AβOs, sugerindo
sua participação na patogênese da doença de Alzheimer.
77
Figura 2: Deficit cognitivo induzido pelos oligômeros de Aβ é bloqueado em animais nocaute para o receptor de IL-1β. Teste do reconhecimento objeto (RO) realizado 24h após a injeção i.c.v. dos AβOS (10 pmol/sítio) em camundongos do tipo selvagem (WT) e nocaute para o receptor de IL-1β (-/-).* P<0,05
4.3) Resultados Adicionais II
Durante o Doutorado, tive a oportunidade de participar de três trabalhos de
nosso grupo. O primeiro foi o projeto de um doutorando de nosso grupo, Mychael
Lourenço, intitulado “TNF-α mediates PKR-Dependent Memory Impairment and
Brain IRS-1 Inhibition Induced by Alzheimer’s β-Amyloid Oligomers in Mice and
Monkeys” o qual teve o obejtivo de investigar a indução do estresse de retículo
endoplasmático por oligômeros de Aβ (AβOs) e sua possível correlação com os
mecanismos da resistência à insulina em neurônios hipocampais. Os dados
reunidos neste artigo demonstram que os oligômeros de Aβ ativam a proteína
quinase R, dependente de dupla-fita de RNA (PKR) de um modo dependente da
via de sinalização de TNFα, resultando na fosforilação da subunidade alfa do fator
eucariótico de iniciação da tradução (eIF2α-p), na inibição do IRS-1, perda
0
25
50
75
100
WT WT-/- -/-Veh AEO
* *
Old Old Old Old NewNewNewNewEx
plo
rati
on
tim
e (
%)
78
sináptica e déficit de memória. Este conjunto de resultados indentificaram novos
mecanismos patogênicos comuns entre a Doença de Alzheimer e o Diabetes, e
reforçam que vias de sinalização pró-inflamatórias são mediadoras dos enfeitos
tóxicos dos oligômeros de Aβ sobre a função do IRS-1 assim como da perda
sinapses e de memória de uma forma dependente da ativação da PKR.
O artigo acima mencionado foi publicado no periódico Cell Metabolism em
2013, e encontra-se disponível nos anexos desta Tese (Anexo I).
O segundo trabalho que tive a oportunidade de participar foi o da então
Pós-doc de nosso laboratório, hoje Professora da Faculdade de Farmácia (UFRJ),
Dr. Júlia Clarke. O Título do artigo é: “Alzheimer-associated Aβ oligomers impact
the central nervous system to induce peripheral metabolic deregulation”. A
hipótese inicial deste artigo teve como base estudos que identificaram depósitos
de peptídeo beta amilóide no hipotálamo, uma estrutura cerebral que tem um
papel central na regulação metabólica, e ainda pode ser afetada em casos de
diabetes tipo 2 e obesidade. Entretanto, não era completamente compreendido se
a presença do Aβ no hipotálamo afetava a sua importante função.
Os principais resultados deste estudo demonstram que a injeção de
oligômeros de Aβ no ventrículo lateral de camundongos e macacos induziu a
ativação da vía pró-inflamatória da IKKβ/NF-κB e causou um transiente estresse
de retículo endoplasmático no hipotálamo. Este impacto dos oligômeros no
hipotálamo resultou na desregulação da homeostase periférica de glicose,
resistência à insulina nos músculos esqueléticos e inflamação do tecido adiposo
em camundongos. Os oligômeros falharam em disparar a ativação da via de
IKKβ/NF-κB e a intolerância a glicose periférica em camundongos que não
79
expressam o receptor de TNF-α. Juntos, esses resultados revelaram uma nova
ação patogênica dos oligômeros no cérebro demonstrando de forma impactante
que a doença de Alzheimer compartilha dos mesmos mecanismos observados nas
disfunções hipotalâmicas em síndromes metabólicas.
Esse conjunto de resultados encontra-se reunido no artigo que se encontra
atualmente submetido para o periódico EMBO Molecular Medicine, e que está
disponível nos anexos desta Tese (Anexo II).
Ainda no Doutorado tive a oportunidade de participar de uma Revisão cujo
título é: “Inflammation, defective insulin signaling and neuronal dysfunction in
Alzheimer's disease”. Nesta revisão nós discutimos os aspectos característicos da
inflamação no Sistema Nervoso Central e no Sistema Periférico que são comuns,
ou mesmo muito similares, entre a Doença de Alzheimer e as dinfuções
Metabólicas. Adicionalmente abordamos a contribuição da inflamação cerebral
para a disfunção da sinalização por insulina no cérebro e ainda para a disfunção
neuronal. Por último, nós reunimos as evidências que apontam para um
tratamento contra a inflamação cerebral como uma importante abordagem
terapêutica no tratamento da Doença de Alzheimer. Esta Revisão foi publicada
este ano, no periódico Alzheimer´s & Dementia e está disponível nos anexos desta
Tese (Anexo III).
The Journal of Clinical Investigation http://www.jci.org
βTheresa R. Bomfim,1 Leticia Forny-Germano,1,2 Luciana B. Sathler,1 Jordano Brito-Moreira,1
Jean-Christophe Houzel,2 Helena Decker,1,3 Michael A. Silverman,3 Hala Kazi,4 Helen M. Melo,1 Paula L. McClean,5 Christian Holscher,5 Steven E. Arnold,4 Konrad Talbot,4 William L. Klein,6
Douglas P. Munoz,7 Sergio T. Ferreira,1 and Fernanda G. De Felice1
1Institute of Medical Biochemistry and 2Institute of Biomedical Sciences, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil. 3Department of Biological Sciences, Simon Fraser University, Vancouver, British Columbia, Canada. 4Department of Psychiatry, University of Pennsylvania,
Philadelphia, Pennsylvania, USA. 5School of Biomedical Sciences, Ulster University, Coleraine, United Kingdom. 6Department of Neurobiology and Physiology, Northwestern University, Evanston, Illinois, USA. 7Centre for Neuroscience Studies, Queen’s University, Kingston, Ontario, Canada.
Defective brain insulin signaling has been suggested to contribute to the cognitive deficits in patients with Alzheimer’s disease (AD). Although a connection between AD and diabetes has been suggested, a major unknown is the mechanism(s) by which insulin resistance in the brain arises in individuals with AD. Here, we show that serine phosphorylation of IRS-1 (IRS-1pSer) is common to both diseases. Brain tissue from humans with AD had elevated levels of IRS-1pSer and activated JNK, analogous to what occurs in peripheral tissue in patients with diabetes. We found that amyloid-β peptide (Aβ) oligomers, synaptotoxins that accumulate in the brains of AD patients, activated the JNK/TNF-α pathway, induced IRS-1 phosphorylation at multiple serine residues, and inhibited physiological IRS-1pTyr in mature cultured hippocampal neurons. Impaired IRS-1 signaling was also present in the hippocampi of Tg mice with a brain condition that models AD. Impor-tantly, intracerebroventricular injection of Aβ oligomers triggered hippocampal IRS-1pSer and JNK activation in cynomolgus monkeys. The oligomer-induced neuronal pathologies observed in vitro, including impaired axonal transport, were prevented by exposure to exendin-4 (exenatide), an anti-diabetes agent. In Tg mice, exendin-4 decreased levels of hippocampal IRS-1pSer and activated JNK and improved behavioral measures of cognition. By establishing molecular links between the dysregulated insulin signaling in AD and diabetes, our results open avenues for the investigation of new therapeutics in AD.
Insulin resistance in peripheral tissue is a hallmark of type 2 diabe-tes (1). Accumulating evidence suggests that insulin resistance also develops in Alzheimer’s disease (AD) brains (2). Brain levels of insu-lin and insulin receptor (IR) are lower in AD, and insulin signaling impairments have been documented in both postmortem analysis and in animal models of AD (3–6). Brain insulin signaling is par-ticularly important for learning and memory (7, 8), suggesting that insulin resistance may contribute to cognitive deficits in AD.
We recently showed that soluble oligomers of the amyloid-β peptide (Aβ) instigate a striking loss of IRs from the membranes of neuronal processes (9). Aβ oligomers (AβOs) are small, diffus-ible aggregates that accumulate in AD brain and are recognized as potent synaptotoxins (10–12). Oligomers attach with specific-ity to synapses in particular neurons, acting as pathogenic ligands (13, 14). Recent studies have shown that oligomer binding induces
AD-like pathology, including neuronal tau hyperphosphorylation (15), oxidative stress (16, 17), synapse deterioration and loss (13, 18), and inhibition of synaptic plasticity (19). Interestingly, insu-lin signaling provides a physiological defense mechanism against oligomer-induced synapse loss (13). Insulin was found to down-regulate oligomer binding sites in neurons through a mechanism requiring IR tyrosine kinase activity (13). Stimulation of insulin signaling also protects neurons from oligomer-induced impair-ment of long-term potentiation (LTP) (20) and accumulation of hyperphosphorylated tau (21).
Understanding the molecular mechanisms accounting for impaired brain insulin signaling may illuminate new approaches to counteract neuronal damage in AD. As several pathological features, including impaired insulin signaling and inflammation, appear to be shared by patients with diabetes and those with AD, we hypothesized that, perhaps triggered by different factors, mech-anisms analogous to those that account for peripheral insulin resistance in type 2 diabetes could underlie impaired brain insu-lin signaling in AD. Results reported here establish that insulin signaling is disrupted in Alzheimer’s brains, as well as in rodent and non-human primate models of the disease, by mechanisms similar to those leading to insulin resistance in diabetes. Abnormal activation of the JNK/TNF-α pathway was verified in vivo and in
Authorship note: Theresa R. Bomfim and Leticia Forny-Germano contributed equally to this work.
Conflict of interest: William L. Klein is co-founder of Acumen Pharmaceuticals, which has been licensed by Northwestern University to develop ADDL technology for Alzheimer’s therapeutics and diagnostics.
Citation for this article: J Clin Invest doi:10.1172/JCI57256.
The Journal of Clinical Investigation http://www.jci.org
vitro in neurons exposed to AβOs, resulting in serine phosphoryla-tion of IRS-1, known to block downstream insulin signaling and trigger peripheral insulin resistance in diabetes (22). Significantly, exendin-4, a new antidiabetic drug that activates pathways com-mon to insulin signaling through stimulation of glucagon-like peptide 1 (GLP-1) receptors, blocked the impairment of insulin signaling in hippocampal cultures, reversed insulin pathology and improved cognition in Tg mice. Our findings suggest that stimula-tion of GLP-1 receptors (GLP1Rs) may represent a promising new approach to prevent disruption of brain insulin signaling in AD.
Because serine phosphorylation of IRS-1 is a central feature in peripheral insulin resistance (22, 23), we initially looked for IRS-1pSerine in human AD brain tissue. Results demonstrate that AD brains present abnormally high levels of IRS-1 phosphorylated at serine residues 636/639 (IRS-1pSer636/639) compared with brains from non–cognitively impaired (NCI) subjects (Figure 1, A–C, and Supplemental Table 1; supplemental material avail-able online with this article; doi:10.1172/JCI57256DS1), in line with a recent study that examined other pSer epitopes (4). In NCI controls, IRS-1pSer636/639 immunoreactivity was almost exclusively detectable in cell nuclei, appearing as puncta of vari-able sizes (Figure 1A). In some cases, extranuclear immunoreac-tivity in neuronal cell bodies was also detected, but this was rare in subjects younger than 75 years. In contrast, in AD patients a high density of neurons with IRS-1pSer636/639 labeling in cell bodies and, occasionally, in proximal dendrites was found from the earliest ages studied (i.e., 51 years). This was most conspicu-ous in the hippocampal CA1 region (Figure 1B). In 20 of 22 (91%) age- and sex-matched pairs of AD and control cases, the density of CA1 neurons with extranuclear IRS-1pSer636/639 labeling was greater in the AD case (Wilcoxon signed-ranks test; W = 239, P = 0.0001; Figure 1C and Supplemental Table 1). Control speci-ficity tests on the IRS-1pSer636/639 antibody showed that label-ing in AD brain could be fully blocked by competition with syn-thetic phosphorylated immunogen (Supplemental Figure 1), but not with the corresponding non-phosphorylated peptide. These findings are in harmony with peripheral mechanisms leading to type 2 diabetes and support the idea that AD is characterized by CNS insulin resistance.
Memory impairment in AD is now attributed, at least in part, to the synaptotoxicity of AβOs (12, 13, 19, 24), which accumulate in AD brains (14) and in animal models of AD (25). Recent studies have implicated oligomers in neuronal insulin resistance (9, 13). Thus, we next investigated whether pathological IRS-1pSer could develop from the neuronal impact of AβOs. Using highly differ-entiated hippocampal neuronal cultures, we found that AβOs induced abnormal elevation in somatodendritic IRS-1pSer636 levels (Figure 1, D–F). These results provide a salient pathogen-ic basis to account for elevated IRS-1pSer levels in AD brains. Because phosphorylation of IRS-1 at additional serine residues (other than Ser636) is also known to account for insulin resis-tance in peripheral tissue (23, 26), we searched for neuronal IRS-1 phosphorylation at other epitopes. We found that IRS-1pSer616, IRS-1pSer312, and IRS-1pSer307 levels were also increased in hippocampal neurons exposed to AβOs (Figure 1, F and M). In parallel, and consistent with the expected insulin resistance asso-ciated with serine phosphorylation of IRS-1, oligomers inhibited physiological IRS-1 phosphorylation at tyrosine residue 465 (IRS-
1pTyr465; Figure 1, G–I), an essential step in the IR-stimulated signaling pathway. Neurons targeted by AβOs exhibited increased IRS-1pSer levels, whereas non-attacked neurons showed low IRS-1pSer levels, as illustrated in Figure 1, J–L. Dysregulation of IRS-1 signaling, which we found to be prominent in AD brains (Figure 1B), is thus instigated by AβOs in central neurons.
Neuronal cultures used throughout our study were maintained in Neurobasal medium supplemented with B-27, an insulin-con-taining supplement, considered optimal conditions to preserve synapse health and function and to grow mature hippocampal cultures (27). In order to determine whether the increase in IRS-pSer described above might be related to insulin coming from B-27, we used cultures grown in insulin-free B-27. As shown in Supplemental Figure 2, in insulin-free medium AβOs triggered very similar increases in IRS-1pSer levels. Results thus establish that IRS-1pSer is specifically triggered by oligomers rather than by a possible physiological action of insulin present in B-27.
To determine whether the insulin signaling defect found in cell culture experiments also occurs in vivo, we investigated the effect of AβOs on IRS-1pSer in the brains of non-human primates. To this end, 3 adult cynomolgus monkeys (Macaca fascicularis) received intracerebroventricular (i.c.v.) injections of oligomers. A sham-operated monkey was used as a control. Remarkably, we found that the monkeys that received i.c.v. oligomer injections presented elevated levels of neuronal IRS-1pSer636 in the hippocampus compared with the control monkey (Figure 2, A–G). Interestingly, IRS-1pSer636 levels were also increased in the temporal cortex of monkeys that received injections of AβOs, indicating that the impact of oligomers on IRS-1 signaling extends to other brain regions in addition to the hippocampus (Supplemental Figure 3). These results demonstrate that AβOs instigate elevated serine phosphorylation of IRS-1 in the brains of monkeys, establishing the in vivo and in situ relevance of our findings.
We next examined IRS-1pSer levels in the brains of APPSwe,PS1ΔE9 (APP/PS1) mice, which express transgenes for human amyloid pre-cursor protein (APP) bearing the Swedish mutation and a deletion mutant form of presenilin 1. IRS-1pSer636 and IRS-1pSer312 levels, but not IRS-1pSer307 levels, were increased in hippocampi of APP/PS1 Tg mice compared with WT mice (Figure 2H).
Non-phosphopeptide antibodies were used to detect total lev-els of IRS-1 and IRS-2 in our experimental models. We noted that distinct patterns of dendritic labeling were obtained for IRS-1 and IRS-2 (Figure 3, A, B, F, and G). No differences in total IRS-1 lev-els were observed in oligomer-treated cultures or in hippocampi of APP/PS1 mice (Figure 3, A–E). In contrast, total IRS-2 levels increased in hippocampal cultures exposed to AβOs, as revealed by both immunocytochemistry and Western blot analysis (Figure 3, F–I). This impact of oligomers may be related to the fact that IRS-2 is a negative regulator of memory formation, as shown by recent studies (28, 29). However, IRS-2 levels were significantly decreased in APP/PS1 Tg mice compared with WT mice (Figure 3J). Decreased levels of IRS-2 have also been found in AD brains (4), suggesting that chronic exposure to AβOs may give rise to a compensatory mechanism aimed to decrease the negative impact of brain IRS-2 signaling on memory.
Previous studies have linked IRS-1 serine phosphorylation to JNK activation in diabetes and in obesity-related insulin resistance (22). In peripheral tissue, IRS-1 is phosphorylated at Ser636 by p-JNK (30). This prompted us to investigate the involvement of JNK in oligomer-induced IRS-1pSer in cell culture experiments. AβOs
The Journal of Clinical Investigation http://www.jci.org
failed to induce IRS-1pSer in hippocampal neurons transfected with GFP-fused dominant negative JNK (DN JNK; Figure 4, A–D), indi-cating a role for JNK in neuronal insulin resistance. As a control, mock transfection with a plasmid containing only GFP had no pro-tective effect (Figure 4C). Oligomer-induced accumulation of IRS-1pSer636 was also blocked by the pharmacological JNK inhibitor SP600125 (Figure 4, E–G and I). Moreover, oligomer-induced JNK activation was directly observed in hippocampal neuronal cultures
(Figure 4J). Consistent with the involvement of JNK indicated by our results, a recent study showed that AβOs induce tau hyperphos-phorylation and IRS-1 inactivation via JNK activation (31).
Subsequently, we sought to determine whether p-JNK levels were elevated in the brains of APP/PS1 mice. We found a 4-fold increase in p-JNK levels in hippocampi of Tg mice compared to WT ani-mals (Figure 4K), demonstrating that activation of JNK, first detected in cell culture experiments, occurs in vivo. No changes in
β
μ
βμ
μ
β
β
β
The Journal of Clinical Investigation http://www.jci.org
levels of total JNK were found in hippocampal cultures exposed to oligomers or in hippocampi of APPS/PS1 Tg mice (Supplemental Figure 4). Future studies employing mice with knockout of IRS-1, JNK1/2, or JNK3 may provide additional insight into the mecha-nistic links between insulin resistance and AD.
In peripheral insulin resistance, JNK activity is known to be stimulated by TNF-α signaling (22), and TNF-α levels are elevated in AD (32). Interestingly, we found that abnormal IRS-1pSer636 triggered by AβOs was completely blocked by infliximab, a TNF-α neutralizing antibody (Figure 4, H and I). We further detected an increase in TNF-α levels in concentrated conditioned medium from hippocampal cultures exposed to AβOs (Figure 4L). No dif-ferences were found in levels of TNF-α receptor in cultured neu-rons exposed to oligomers or in hippocampi of Tg mice (Figure 4, M and N). The results suggest that oligomer-induced elevation in proinflammatory TNF-α levels triggers aberrant activation of JNK and, ultimately, serine phosphorylation of IRS-1.
We next analyzed levels of p-JNK in AD brains and found that the density of neurons with detectable levels of activated JNK was significantly increased in AD hippocampi (Figure 5, A–D), giving strong support to our proposal that activation of the JNK pathway plays a key role in AD pathology. Finally, we examined JNK activa-tion in the brains of cynomolgus monkeys. Consistent with elevated IRS-1pSer levels, the 3 monkeys that received i.c.v. injections of AβOs presented elevated neuronal p-JNK levels in their hippocampi compared with the sham-operated monkey (Figure 5, E–I). Both cytoplasmic and nuclear p-JNK labeling were detected in NeuN-positive cells, but not in GFAP-positive cells (Figure 5, J–L), dem-onstrating neuronal specificity of JNK activation induced by oligo-mers. These results establish that abnormal activation of neuronal JNK is triggered by AβOs in the brains of non-human primates and support a key role of JNK in neuronal insulin resistance in AD.
Aberrant activation of JNK has been linked to impaired axonal transport in neurological disorders (33). Several neurodegenera-
ββ
β μ μ μβ
The Journal of Clinical Investigation http://www.jci.org
tive diseases, including AD, display axonal pathologies compris-ing defective transport and abnormal accumulation of proteins and organelles (34). Because AβOs were recently shown to impair axonal transport in hippocampal neurons (35), we further asked whether oligomer-induced JNK activation might be responsible for defects in axonal transport of dense core vesicles (DCVs) (see Supplemental Figure 5 for a scheme describing axonal trans-port measurements). Significantly, the JNK inhibitor SP600125 blocked axonal transport alterations induced by oligomers (Figure 6, Supplemental Table 2, and Supplemental Video 1), implicating JNK activation in impaired axonal transport in AD.
Double-stranded RNA-dependent protein kinase (PKR) and IκB kinase (IKK) are two stress-sensitive kinases that medi-ate serine phosphorylation of IRS-1 and are critical regulators of peripheral insulin resistance (36–39). In an additional set of experiments, we examined whether PKR and/or IKK were also activated by AβOs. A selective PKR inhibitor completely blocked oligomer-induced IRS-1pSer636, IRS-1pSer312, and IRS-1pSer307 in hippocampal cultures (Figure 7, A–L). IKK was also found to be involved in oligomer-induced IRS-1pSer, as ace-tylsalicylic acid completely prevented abnormal IRS-1pSer636 (Figure 7, M–O and Q). Abnormally activated mTOR signal-ing has also been implicated in peripheral insulin resistance (40). However, the mTOR inhibitor rapamycin had no effect on IRS-1pSer636 triggered by oligomers (Figure 7, P and Q), sug-gesting that mTOR is not involved in oligomer-induced serine phosphorylation of IRS-1. The involvement of PKR and IKK in AβO-induced IRS-1pSer provides additional evidence for a close parallelism between inflammation-associated brain insu-
lin resistance in AD and chronic inflammation-induced insulin resistance in peripheral tissues in type 2 diabetes.
Stimulation of brain insulin signaling has been suggested as a promising approach to prevent synapse deterioration and memory decline in AD (41, 42). We thus next tested whether bolstering insu-lin signaling might also protect neurons from aberrant activation of the JNK/IRS-1pSer pathway triggered by AβOs. We examined the effects of insulin and exendin-4 (exenatide), an incretin hormone analog that activates the insulin signaling pathway through GLP1R stimulation (43) and has been recently approved for treatment of diabetes. GLP1Rs are present and functional in cultured neurons as well as in rodent and human brains, and emerging evidence indicates that their stimulation regulates neuronal plasticity and cell sur-vival (44). Significantly, we found that both insulin and exendin-4 prevented the increase in IRS-1pSer636 (Figure 8, A–D) and the decrease in IRS-1pTyr465 levels (Figure 8, E–H) induced by oligo-mers. Exendin 9-39, a potent GLP1R antagonist and a competitive inhibitor of exendin-4, blocked the protective action of exendin-4, demonstrating that protection was specifically mediated by activa-tion of GLP1Rs (Figure 8D). Because neuronal cultures used in our study were maintained in Neurobasal B-27, an insulin-containing supplement, it is possible that these results reflect to some extent crosstalk between exendin signaling and signaling initiated by insu-lin. Control experiments showed that exendin-4 or insulin alone (i.e, in the absence of oligomers) had no significant effects on IRS-1pSer levels (Figure 8D). Interestingly, insulin and exendin-4 also protect-ed neurons from the above-described oligomer-induced impair-ment of axonal transport (Figure 8, I and J, Supplemental Tables 2 and 3, and Supplemental Videos 2 and 3). Because JNK dysregula-
ββ
μ β
The Journal of Clinical Investigation http://www.jci.org
βμ μ
ββ μ β μ β
μβ
β βα
β α β
The Journal of Clinical Investigation http://www.jci.org
tion appears to underlie axonal transport defects in a number of neurodegenerative disorders in addition to AD (33), this raises the possibility that prevention of aberrant JNK activation by bolstering insulin signaling might be beneficial in such disorders.
Protection by insulin against AβO-induced neuronal damage has been shown to involve downregulation of oligomer binding sites (13). Additional experiments thus aimed to determine whether exendin-4 also interferes with oligomer binding to neurons. Results showed that exendin-4 did not block oligomer binding (Supplemen-tal Figure 6). Along with the results presented above, this indicates that GLP1R activation by exendin-4 prevents oligomer-induced impairment in IRS-1 signaling even when oligomers are attached to neurons. We also determined GLP1R levels in AβO-treated neuronal cultures and in hippocampi of AD Tg mice. No changes in levels of GLP1R were found in hippocampal cultures exposed to oligomers or in hippocampi of APPS/PS1 Tg mice (Supplemental Figure 7). Because brain insulin signaling may decline with aging and in AD (45), exendin-4 may thus be more efficient than insulin in protecting neurons from the toxic impact of oligomers.
Finally, since exendin-4 readily crosses the blood-brain barrier and has been shown to facilitate hippocampal synaptic plasticity and cognition (44, 46, 47), we asked whether systemic adminis-
tration of a GLP1R agonist could enhance brain insulin signal-ing in APP/PS1 mice. Mice (13–14 months of age) were treated for 3 weeks with a daily intraperitoneal injection of exendin-4 (48). Exendin-4–treated mice exhibited significant reductions in brain levels of IRS-1pSer636, IRS-1pSer312, and p-JNK compared with vehicle-treated animals (Figure 8, K and L). Interestingly, spatial memory in the Morris water maze task was improved by chronic exendin-4 administration to Tg mice. Exendin-4–treated APP/PS1 mice learned the task faster, with significantly reduced escape latencies observed on days 3 and 4 of training, compared with saline-treated mice (Figure 8, M and N). Furthermore, exen-din-4–treated mice had improved memory retention, as indicated by a significantly longer time spent in the target quadrant during the probe trial conducted 24 hours after the last training session (Figure 8O). These data demonstrate the beneficial effect of exen-din-4 on cognition in AD Tg mice. Interestingly, we further found that treatment with exendin-4 entailed reductions in brain levels of amyloid plaque load and soluble Aβ in the cerebral cortices of AD Tg mice (Figure 8, P–R).
Reported effects of peripheral exendin-4 administration include reduced plasma glucose levels and decreased food intake and body weight, and these could mimic the anti-aging effects of
β
β
μ μ
The Journal of Clinical Investigation http://www.jci.org
caloric restriction. We note that, for the duration of the behav-ioral experiments described above, comparable and slight weight losses were observed in all groups of mice analyzed, regardless of whether they received daily intraperitoneal injections of exendin-4 or saline (Supplemental Figure 8). This may be due to the exer-cise regime to which the animals were subjected during training and trials in the Morris water maze. We also note that, in insulin-secreting cells, exendin-4 inhibits JNK activation (49), counteracts TNF-α–mediated apoptosis, and reverses inhibition of the IRS-1 pathway (50). Taken together, our results suggest that exendin-4 restored impaired brain insulin signaling, decreased plaque load and soluble Aβ levels, and improved learning and memory.
Recent studies have shown that type 2 diabetes increases the risk of AD (51), and a newly recognized form of brain insulin resistance has been connected to AD (2, 3). Here, we describe a pathogenic mechanism by which a type of “brain diabetes” is triggered by AβOs, synaptotoxins that accumulate in AD brains. Because brain insulin signaling is centrally involved in learning and memory (8), the impact of AβOs on brain insulin signaling may be a mecha-nism potentially contributing to early memory loss in AD.
Similar to mechanisms that cause peripheral insulin resistance in type 2 diabetes, our results show that AβOs induce neuronal insulin resistance by activating TNF-α and the stress kinases JNK, IKK, and PKR, leading to serine phosphorylation of IRS-1 (Figure 9A). Anal-ysis of AD brains confirmed abnormal phosphorylation of IRS-1 at Ser636/639, which is typically associated to peripheral insulin resistance in diabetes (1). IRS-1pSer redistribution was recently reported in AD brains (31). Because we have previously shown that AβOs internalize/redistribute neuronal IRs (9, 13), it is possible that IR loss may underlie, or facilitate, IRS-1pSer increases. This is con-sistent with our finding that insulin, previously shown to block IR downregulation induced by AβOs (13), further blocks IRS-1pSer.
In peripheral insulin resistance, IRS-pSer is a major target for phosphorylation by mTOR (40, 52, 53). In contrast, the mecha-
nism by which oligomers trigger neuronal IRS-1 inhibition does not appear to involve mTORC1 activation, as rapamycin had no protective effect against IRS-1pSer. The possible role of mTOR in AD is still controversial. mTOR activity was shown to be increased in brains of 3xTg-AD mice (54) and rapamycin improved cogni-tion in PDAPP Tg mice (55, 56). On the other hand, upregulat-ing mTOR signaling rescued LTP in another AD mouse model (Tg2576), suggesting that mTOR inhibition correlates with impaired synaptic plasticity in AD (57). Other studies have shown that mTOR signaling is downregulated in cellular and ani-mal models of AD (54, 58). Given these controversial literature reports, further studies aimed at unraveling the possible role of mTOR signaling in AD appear warranted.
We found significant increases in p-JNK levels in AD brains and in hippocampi of APP/PS1 Tg mice. Using a different strain of Tg mice fed a high-fat diet, a recent study reported abnormally elevated brain levels of activated JNK (31). Remarkably, elevated IRS-1pSer636 and p-JNK levels were triggered by injection of AβOs in the brains of monkeys. Considering the dearth of animal model systems that truly recapitulate the main features of AD (59), a monkey model of AD may provide insight into central aspects of pathology that could be present exclusively in primates.
Inflammation is an important mediator of insulin resistance in obesity and diabetes (23, 26, 60, 61). Supporting the notion that AβO-induced neuronal insulin resistance derives from an inflammatory response mediated by TNF-α, the TNF-α–blocking antibody infliximab protected neurons against oligomers. Used to treat inflammatory diseases (62), infliximab and etanercept, a TNF-α–blocking recombinant protein, have been proposed as novel therapeutic agents to combat insulin resistance in type 2 diabetes (63) and memory decline in AD (64). By defending neu-rons from oligomer-induced dysregulation of insulin signaling, infliximab treatment may constitute a novel approach to prevent memory impairment in AD.
We did not observe significant changes in levels of IRS-1pSer307 in hippocampi from AD Tg mice, while in cultured neurons AβOs
β μ
β
The Journal of Clinical Investigation http://www.jci.org
increased IRS-1pSer307. A recent study demonstrated that IRS-1pSer307 in mice is a positive regulatory site that sustains periph-eral insulin signaling and moderates the severity of insulin resis-tance (65), in contrast to results obtained in previous cell-based experiments (26, 66, 67). Based on our results, it is likely that, following oligomer attack of synapses, the stress-sensitive kinases PKR, IKK, and JNK respond and coordinately lead to IRS-1pSer at multiple residues. Therefore, even if Ser307 is not phosphorylated, the final outcome may be that multiple serine-phosphorylated res-idues may act as critical regulators of neuronal insulin resistance, similar to what occurs in peripheral tissue (36).
Total IRS-2 levels were increased in hippocampal cultures exposed to AβOs. This might be related to the fact that, as previ-ously observed, IRS-2 is a negative regulator of memory forma-tion that acts by impairing dendritic spine formation (28) and that deletion of IRS-2 reduces amyloid deposition, cognitive deficits and premature mortality in Tg2576 mice (29). Beneficial effects of IRS-2 deletion in AD pathology parallel the effects on lifespan,
with less IRS-2 signaling extending life span in mice (43). We found that IRS-2 levels were significantly decreased in APP/PS1 Tg mice compared with WT mice. Decreased levels of IRS-2 were also found in AD brains (4), suggesting a compensatory phenomenon to decrease the negative impact of brain IRS-2 signaling on memo-ry in AD (68). So far, however, it is unclear whether this is an active neuroprotective response or a secondary response to the neuro-degenerative process. Therefore, there is an apparent dichotomy between the neuroprotective effects of insulin signaling in CNS and its deleterious actions on lifespan and memory. It is possible that IRS-1 acts as a positive regulator of memory, as suggested by our current results, while IRS-2 acts as a negative modulator of memory formation.
AβOs increasingly appear to be the proximal toxins that cause synapse failure in AD (12, 13, 24, 25). Oligomers constitute key target for therapeutics, as drugs and antibodies designed to target them have provided positive results in AD clinical trials (69, 70). However, issues related to efficacy and safety of such approaches
ββ μ β
β μ β μ
β
The Journal of Clinical Investigation http://www.jci.org
ββ
β μβ
ββ β μ β
β
μ β
The Journal of Clinical Investigation http://www.jci.org
have still not been fully addressed. Stimulation of neuronal insulin signaling has been proposed as a promising approach to prevent or halt memory decline in AD (41, 42). In vitro, insulin prevents AβO-induced loss of surface IRs, neuronal oxidative stress, and synapse deterioration (13). The mechanism of insulin protection involves IR signaling–dependent downregulation of oligomer binding to neurons. Thus, the protective action of insulin in rescu-ing the impairment of IRS-1 reported here probably derives from its ability to block oligomer binding to neurons. However, since IRs are removed from the neuronal membrane in AD brains (4) and in cultured neurons exposed to oligomers (9), use of insulin itself might not be the most effective way to combat AD. Instead, alternative approaches to bypass the IR and enhance insulin-relat-ed signaling pathways might provide a safe and effective strate-gy to prevent or treat AD. Here, we show that exendin-4, a novel antidiabetic drug that stimulates the insulin signaling pathway through activation of GLP1Rs, protected neurons against oligo-mer-induced dysregulation of IRS-1 phosphorylation (Figure 9B).
Exendin-4 further decreased hippocampal IRS-1pSer and p-JNK levels, decreased amyloid pathology, and improved cognition in AD Tg mice. Enhancing brain insulin signaling through the use of exendin-4 or other GLP1R agonists may thus be a key alternative to block brain insulin resistance and memory impairment in AD.
ReagentsSynthetic Aβ1–42 peptide was from American Peptide Co. Scrambled Aβ1–42 was from Anaspec. Bovine and human insulin, 1,1,1,3,3,3,-hexafluoro-2-propanol (HFIP), DMSO, poly-L-lysine, rapamycin, and acetylsalicylic acid were from Sigma-Aldrich. Culture media/reagents, Alexa Fluor–labeled secondary antibodies, and ProLong anti-fade reagent were from Invitrogen. Electrophoresis buffers were from Bio-Rad. SuperSignal chemilumines-cence reagents and the BCA protein assay kit were from Pierce. Antibodies against total IRS-1 and IRS-2, IRS-1pTyr465, IRS-1pSer636, glucagon-like peptide–1 receptor (GLP1R), TNFR1, TNF-α, and the PKR inhibitor were from Santa Cruz Biotechnology Inc. IRS-1pSer307, IRS-1pSer312, and IRS-1pSer616 antibodies were from Invitrogen. IRS-1pSer636/639 anti-body for histology, the phosphorylated immunogen supplied as a custom order for specificity tests, glial fibrillary acidic protein (GFAP) antibody, p-JNK (Thr183/Tyr185) monoclonal antibody, and JNK polyclonal anti-body were from Cell Signaling Technology. Unphosphorylated IRS-1 peptide (aa 631–646) was from Abcam (no. 41777). Exendin-4 and exendin 9-39 were from Bachem. SP600125 was from Tocris Bioscience.
Neuropathology in human brain tissueNCI controls and patients with AD were autopsied with caregiver consent by the Center for Neurodegenerative Disease Research at the University of Pennsylvania. Clinical diagnosis of AD met NINCDS-ADRDA criteria and was confirmed by postmortem examination of the cerebral cortex and hip-pocampus for senile plaque and neurofibrillary tangle densities. A matched pairs design was used to match each of 22 AD cases with 22 NCI cases of the same sex, similar age (within 5 years), and similar postmortem interval (with-in 7 hours). Demographic and autopsy data on the subjects studied are given in Supplemental Table 1. Neither NCI controls nor AD patients had histories or symptoms of psychiatric conditions or non-AD neurological disorders.
At autopsy, each brain was cut into coronal slabs, from which an interme-diate rostrocaudal segment of the hippocampal region (i.e., hippocampus, dentate gyrus, subiculum, and parahippocampal gyrus) was dissected and fixed in Bouin’s fluid, 10% neutral buffered formalin, or 70% ethanol in saline for 24–48 hours. In each matched pair, the tissue sampled from the NCI and AD cases derived from the same hemisphere and was preserved in the same fixative. After being embedded in paraffin, 6-μm coronal sec-tions were cut, mounted on slides, and reacted immunohistochemically
β α
β
The Journal of Clinical Investigation http://www.jci.org
for IRS-1pSer636/639 with Cell Signaling Technology antibody 2388 at a dilution of 1:100 using an avidin-biotin-peroxidase method (71). Sections from all the case pairs were reacted together with the same solutions and exposure times to enable quantitative immunohistochemistry. A second set of sections from all pairs was run to test reliability of the results. After coverslipping and drying of the sections, the borders of hippocampal field CA1 were traced in ink on the slides under a dissecting scope aided by well-established criteria and atlas-style drawings (72). A series of ×100 photomi-crographs covering all of CA1 in each section were then taken on a micro-scope with a motorized stage, and a composite montage was created using Image-Pro Plus software (Media Cybernetics Inc.). Photomicrographs of all NCI and AD sections were taken under the same lighting conditions. Image-Pro Plus was used to determine the area covered by CA1 in each section and the number of neurons with extranuclear IRS-1 pSer636/639 in that area by identifying immunoreactive objects that were larger in area than cell nuclei seen with hematoxylin staining and still within the size and shape parameters of neurons identified by NeuN immunoreactivity. The density of neurons with extranuclear IRS-1 pSer636/639 was then cal-culated. Five AD cases were tested for specificity of the IRS-1pSer636/639 antibody used in immunohistochemistry analyses (see Results).
AβOs and scrambled Aβ1–42
Oligomers were prepared from synthetic Aβ1–42 peptide (American Peptide) as previously described (16, 19). Scrambled Aβ peptide (Anaspec) treated in exactly the same manner was used in control experiments.
Mature hippocampal culturesPrimary rat hippocampal neuronal cultures were prepared according to established procedures (15, 16) and were used after 18–21 days in vitro (DIV). Cultures were prepared and maintained in Neurobasal medium supplemented with B-27, an insulin-containing supplement (Invitrogen). Some experiments (see Supplemental Figure 2) were performed using insu-lin-free B-27 (Invitrogen). Cultures were treated at 37°C for 3 hours with 500 nM AβOs or an equivalent volume of vehicle (2% DMSO in PBS). When present, insulin (1 μM), exendin-4 (300 nM), SP600125 (10 μM), infliximab (1 μg/ml), rapamycin (0.1 μM), and PKR inhibitor (1 μM) were added to cultures 30 minutes before AβOs. Acetylsalicylic acid (5 mM) was added to cultures 120 minutes before AβOs. Exendin 9-39 (1 μM) was added 15 minutes before exendin-4.
ImmunocytochemistryCells were fixed and blocked as described previously (13, 15), incubated with AβO-selective NU4 mouse monoclonal antibody (16) and IRS-2, IRS-1, or p–IRS-1 (pSer636; pSer312; pSer616; pSer307; or pTyr465) rabbit polyclonal antibodies followed by Alexa Fluor–conjugated secondary anti-bodies. Coverslips were imaged on a Zeiss Axio Observer Z1 microscope.
Injections of AβOs into monkey brains and neuropathology studiesFour cynomolgus monkeys (Macaca fascicularis) aged 9 years (weight, 4.7–7.0 kg) were used. Animals were under the close supervision of a labo-ratory animal technician and the Queen’s University veterinarian. AβOs were infused chronically through an i.c.v. canula. Three animals were administered 100 μg AβOs, every 3 days for 24 days. Oligomers were freshly prepared and characterized by size-exclusion chromatography (SEC) before each injection. One sham-operated animal, used as a control, had the cannula implanted into the lateral ventricle in the same manner as the experimental animals. At the end of the experimental protocol, animals were sedated with intramuscular 10 mg/kg ketamine with 0.01 mg/kg buprenorphine for analgesia, followed by intravenous 25 mg/kg sodium pentobarbital, perfused with PBS followed by 4% paraformaldehyde in
PBS; 4% paraformaldehyde in PBS containing 2.5% glycerol; PBS plus 5% glycerol; and PBS plus 10% glycerol. Serial 40-μm-thick brain sections were obtained. Immunohistochemistry was performed using free-floating sec-tions from hippocampus and temporal cortex in PBS containing 1% Triton incubated with 0.1 M citrate buffer, pH 6, at 60°C for 5 minutes. Sections were blocked with 5% BSA, 5% normal goat serum (NGS), and 1% Triton X-100 for 3 hours at room temperature. Primary antibodies (IRS-1pSer636, JNKpThr183/Tyr185, GFAP) were diluted in blocking solution, and sec-tions were incubated overnight at 4°C, followed by incubation with Alexa Fluor–conjugated secondary antibodies for 2 hours at room temperature. Tissue autofluorescence was quenched by previous incubation with 0.06% potassium permanganate for 10 minutes at room temperature. Nuclei were stained with DAPI for 5 minutes. Slides were mounted with ProLong and imaged on a Zeiss Axio Observer Z1 microscope using structured illumina-tion (ApoTome module) to decrease out-of-focus light.
AD Tg mouse model and treatment with exendin-4APP/PS1 mice on a C57BL/6 background were obtained from The Jackson Laboratory. Mice not expressing the transgene were used as WT controls. Male animals were used in all studies. Animals were caged individually and maintained on a 12-hour light/12-hour dark cycle (lights on at 08:00, off at 20:00), in a temperature-controlled room (21.5 ± 1°C). Food and water were available ad libitum. Animals received daily intraperitoneal injections of exendin (25 nmol/kg, dissolved in saline) or vehicle (saline) during 3 weeks.
Western blot analysis of Tg mouse hippocampi and hippocampal neuronal culturesThirteen- to 14-month-old APP/PS1 Tg mice and WT control animals were used. Exendin-treated (n = 9) or vehicle-treated Tg (n = 7) and WT animals (n = 8) were euthanized. For Western immunoblot analysis, hippocampi of Tg mice and mature hippocampal cell cultures were homogenized in RIPA buffer containing protease and phosphatase inhibitor cocktails and resolved on a 4%–20% polyacrylamide gel with Tris/glycine/SDS buffer run at 125 V for 80 minutes at room temperature. The gel (42 μg total protein/lane) was electroblotted onto Hybond ECL nitrocellulose using 25 mM Tris, 192 mM glycine, 20% (v/v) methanol, 0.02% SDS, pH 8.3, at 350 mA for 2 hours at 4°C. Membranes were blocked with 5% nonfat milk in Tris-buffered saline containing Tween-20 (TBS-T) (0.1% Tween-20 in 20 mM Tris-HCl, pH 7.5, 0.8% NaCl) for 1 hour at room temperature. Pri-mary antibodies (anti–IRS-1pSer636; pSer312; pSer307; pSer616 or anti–IRS-1 and anti–IRS-2 polyclonal antibodies [1:200], anti–p-JNK [Thr183/Tyr185] monoclonal antibody, anti-JNK polyclonal antibody [1:1,000], anti–TNF-α, anti-TNFR1, and anti-GLP1R polyclonal antibodies [1:200], or anti–cyclophilin B polyclonal antibody [1:10,000]) were diluted in 5% milk/TBS and incubated with the membranes for 120 minutes at room temperature. After incubation with HRP-conjugated anti-mouse or anti-rabbit IgGs (1:10,000 in TBS-T) for 60 minutes, membranes were washed, developed with SuperSignal West Femto Maximum Sensitivity substrate, and imaged on photographic film.
For TNF-α analysis, cultures were exposed to 500 nM AβOs or an equiva-lent volume of vehicle for 3 hours. The medium was then removed and con-centrated by Speedvac (Savant Instruments Inc.) centrifugation. Protein concentrations were determined in the medium using the enhanced BCA protein assay kit (from Pierce). Samples containing equal protein amounts were resolved in a 4%–20% polyacrylamide gel, followed by Western blot-ting using anti–TNF-α antibody.
Data analysisIRS-2, IRS-1, p–IRS-1(pSer636; pSer312; pSer616; pSer307; or pTyr465), and AβO binding immunofluorescence intensities were each analyzed in
The Journal of Clinical Investigation http://www.jci.org
3–6 experiments (see figure legends) using independent neuronal cultures. In each experiment, 20–30 images were acquired from 3 coverslips in each experimental condition. Histogram analysis of fluorescence intensities at each pixel across the images was performed using NIH ImageJ (http://rsbweb.nih.gov/ij/) as described previously (16). Cell bodies were digitally removed from the images so that only immunostaining on dendritic pro-cesses was quantified. Statistical significance was assessed by ANOVA fol-lowed by Bonferroni post-hoc test.
For neuropathology in monkey brains, IRS-1pSer636 and p-JNK immu-nolabeling densities were determined after proper thresholding using NIH ImageJ by counting the particles with diameters of 500 or fewer pixels and determining the total area (in pixels) occupied by particles in each field. For each animal, immunolabeling densities were measured in a set of 20–31 microscopic fields throughout the dentate gyrus or temporal cortex (see Results). Statistical significance was assessed by ANOVA followed by Bon-ferroni post-hoc test.
Plasmids and expression of transgenespβ-actin-BDNF-mRFP and pJPA5-YFP-JBD were from Gary Banker (Jungers Center for Neurosciences Research, Oregon Health and Science University, Portland, Oregon, USA). Mitochondrially targeted YFP was from Gordon Rintoul (Department of Biological Sciences, Simon Fraser University, Burnaby, British Columbia, Canada). Constructs were trans-fected into neurons at 9–12 DIV using Lipofectamine 2000 (Invitrogen). Cells were allowed to express constructs for 24 hours prior to exposure to AβOs and then imaged.
Live imagingCells were live imaged using a wide-field fluorescence microscope (DMI 6000 B, Leica), as described previously (35). Axons and dendrites were ini-tially distinguished based on morphology and confirmed retrospectively by antibody staining against MAP-2, a dendritic cytoskeletal protein (73).
Videos and quantitative analysesVideos were processed using MetaMorph (Universal Imaging) as described previously (35). Quantitative kymograph analysis was per-formed using MetaMorph.
Behavioral testsAnimals were handled daily for 2 weeks prior to commencement of the study. Mice were 9 months of age when treatment began. They received intraperitoneal exendin-4 (25 nmol/kg BW) or saline (0.9% w/v) injections twice daily for 3 weeks before behavioral tasks were conducted (n = 12 for each group). All experiments were licensed by the UK Home Office in accordance with the Animal (scientific procedures) Act of 1986.
Morris water maze task. The maze was made of white opaque plastic with a diameter of 120 cm and 40-cm-high walls and was filled with water at 25°C to avoid hypothermia. A small escape platform (10 × 6.5 × 21.5 cm) was placed at a fixed position in the center of one quadrant, 25 cm from the perimeter, and was hidden 1 cm beneath the water surface. The room contained a number of fixed visual cues on the walls.
Acquisition phase. The acquisition trial phase consisted of 4 training days and 4 trials per day with a 15-minute inter-trial interval. Four points equally spaced along the circumference of the pool (north, south, east, west) served as the starting position, which was randomized across the 4 trials each day. If an animal did not reach the platform within 90 seconds, it was guided to the platform, where it had to remain for 30 seconds, before being returned to its home cage. Mice were kept dry, between trials, in a plastic holding cage filled with paper towels. The path length and escape latencies were recorded (n = 12 per group).
Probe trial. One day after completion of the acquisition task (day 5), a probe trial was performed in order to assess spatial memory (after a 24-hour delay). The platform was removed from the maze, and animals were allowed to swim freely for 60 seconds. Spatial acuity was expressed as the amount of time spent in the exact area where the escape platform was located.
Histology in Tg miceMice were perfused transcardially with PBS buffer followed by ice-cold 4% paraformaldehyde in PBS. Brains were removed and fixed in 4% paraformaldehyde for at least 24 hours before being transferred to 30% sucrose solution overnight. Brains were then snap-frozen using Envirofreeze, and 40-μm-thick coronal sections were cut at coordinates bregma –2 to –3 using a Leica cryostat. Sections were chosen according to stereological rules (74), with the first section taken at random, fol-lowed by every fifth section afterward. Seven to 13 sections were ana-lyzed per brain. Staining was carried out for Aβ plaques. All sections were incubated in 3% H2O2 to quench endogenous peroxidase activity. After the sections were blocked in 5% normal serum to avoid nonspecific antibody binding, they were incubated with rabbit polyclonal anti-Aβ peptide (1:250, Invitrogen 71-5800). After overnight incubation at 4°C, the sections were incubated in respective secondary antibodies. For visu-alization, Vectastain Elite and SG substrate (Vector Laboratories) were used. All staining was visualized by Axio Scope 1 (Zeiss) and analyzed using a multi-threshold plug-in with ImageJ, using stereological rules as described in ref. 75.
ELISA for total soluble Aβ levelsSoluble Aβ levels were measured using an ELISA kit (Invitrogen), used according to the manufacturer’s instructions. Briefly, right hemispheres of control and exendin-4–treated APP/PS1 mouse brains were homog-enized in Tris-buffered saline (25 mM Tris-HCl, pH 7.4, 150 mM NaCl) supplemented with protease inhibitor cocktail (Sigma-Aldrich, 250 μl per 5 ml buffer). Brain homogenates were centrifuged at 100,000 g and 4°C for 1 hour. The supernatant was then diluted 1:10 before the ELISA was carried out. Protein was quantified using the Bradford protein assay. Final soluble Aβ values were determined following normalization to total protein levels (n = 6 per group).
StatisticsStatistical analyses were performed (GraphPad Prism) using 2-tailed Stu-dent’s t test when 2 conditions were compared and 1-way ANOVA followed by Bonferroni post-hoc test for multiple comparisons. Results are repre-sented as mean ± SEM (unless stated otherwise), and the total number of independent experiments, as well as P values, are specified in each figure legend. P values less than 0.05 were considered significant.
Study approvalAll experiments involving rats and Tg mice, unless otherwise specified, were performed in certified facilities under protocols approved by the Institutional Animal Care and Use Committee of the Federal University of Rio de Janeiro (protocols IBQM 022 and IBQM 019). All animal care and experimental procedures involving non-human primates were in accordance with the Canadian Council on Animal Care policies on the use of laboratory animals and approved by the Queen’s University Animal Care Committee (Animal Care Protocol Original Munoz-2011-039-Or). For the human postmortem studies, informed consent was obtained for collection and use of clinical and postmortem data from all subjects of the present study or from their next-of-kin in accordance with the University of Pennsylvania’s Institutional Review Board and its Alzheimer Disease Center (Clinical Core Protocol 068200).
The Journal of Clinical Investigation http://www.jci.org
This work was supported by the Human Frontier Science Program (HFSP) and the John Simon Guggenheim Memorial Foundation (FGF). F.G. De Felice and S.T. Ferreira are also funded by Conselho Nacional de Desenvolvimento Cientifico e Tecnológico (CNPq), Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ), and Instituto Nacional de Neurociência Translacio-nal (INNT). T.R. Bomfim, L. Forny-Germano, L.B. Sathler, H.M. Melo, and J. Brito-Moreira are supported by predoctoral fellow-ships from Conselho Nacional de Desenvolvimento Cientifico e Tecnológico and Coordenação de Aperfeicoamento de Pessoal de Ensino Superior. Experiments on monkeys were funded by a grant (MOP-77734) from the Canadian Institutes of Health Research (to D.P. Munoz) and by HFSP (to F.G. De Felice). D.P. Munoz was also supported by the Canada Research Chair Program. W.L. Klein is funded by grants from the American Health Assistance Foun-dation, Alzheimer’s Association, and NIH–National Institute on
Aging grants R01-AG18877 and R01-AG22547. K. Talbot and S.E. Arnold were supported by a Temple Foundation Discovery award and by the Alzheimer’s Association. M.A. Silverman is funded by the National Science and Engineering Research Council (no. 327100-06), the Canadian Foundation for Innovation (12793), and the Canadian Institutes of Health Research (no. 90396). We thank G. Banker (Oregon Health State University) for the gift of DN JNK and L. Veloso (University of Campinas, Campinas, Brazil) for the gift of infliximab.
Received for publication January 26, 2011, and accepted in revised form January 5, 2012.
Address correspondence to: Fernanda G. De Felice, Institute of Med-ical Biochemistry, CCS, Room H2-019, Federal University of Rio de Janeiro, Rio de Janeiro, RJ 21944-590, Brazil. Phone: 5521.2562.6790; Fax: 5521.2270.8647; E-mail: [email protected].
1. White MF. IRS proteins and the common path to diabetes. Am J Physiol Endocrinol Metab. 2002; 283(3):E413–E422.
2. Craft S. Insulin resistance and Alzheimer’s disease pathogenesis: potential mechanisms and impli-cations for treatment. Curr Alzheimer Res. 2007; 4(2):147–152.
3. de la Monte SM. Insulin resistance and Alzheimer’s disease. BMB Rep. 2009;42(8):475–481.
4. Moloney AM, Griffin RJ, Timmons S, O’Connor R, Ravid R, O’Neill C. Defects in IGF-1 receptor, insulin receptor and IRS-1/2 in Alzheimer’s disease indicate possible resistance to IGF-1 and insulin signalling. Neurobiol Aging. 2010;31(2):224–243.
5. Steen E, et al. Impaired insulin and insulin-like growth factor expression and signaling mecha-nisms in Alzheimer’s disease — is this type 3 diabe-tes? J Alzheimers Dis. 2005;7(1):63–80.
6. Lester-Coll N, Rivera EJ, Soscia SJ, Doiron K, Wands JR, de la Monte SM. Intracerebral streptozotocin model of type 3 diabetes: relevance to sporadic Alzheimer’s disease. J Alzheimers Dis. 2006;9(1):13–33.
7. Chiu SL, Chen CM, Cline HT. Insulin receptor sig-naling regulates synapse number, dendritic plas-ticity, and circuit function in vivo. Neuron. 2008; 58(5):708–719.
8. Dou JT, Chen M, Dufour F, Alkon DL, Zhao WQ. Insulin receptor signaling in long-term memory consolidation following spatial learning. Learn Mem. 2005;12(6):646–655.
9. Zhao WQ, et al. Amyloid beta oligomers induce impairment of neuronal insulin receptors. FASEB J. 2008;22(1):246–260.
10. Haass C, Selkoe DJ. Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer’s amyloid beta-peptide. Nat Rev Mol Cell Biol. 2007; 8(2):101–112.
11. Ferreira ST, Vieira MN, De Felice FG. Soluble protein oligomers as emerging toxins in Alzheimer’s and other amyloid diseases. IUBMB Life. 2007;59(4–5):332–345.
12. Ferreira ST, Klein WL. The Abeta oligomer hypothesis for synapse failure and memory loss in Alzheimer’s disease. Neurobiol Learn Mem. 2011; 96(4):529–543.
13. De Felice FG, et al. Protection of synapses against Alzheimer’s-linked toxins: insulin signaling pre-vents the pathogenic binding of Abeta oligomers. Proc Natl Acad Sci U S A. 2009;106(6):1971–1976.
14. Gong Y, et al. Alzheimer’s disease-affected brain: presence of oligomeric A beta ligands (ADDLs) sug-gests a molecular basis for reversible memory loss. Proc Natl Acad Sci U S A. 2003;100(18):10417–10422.
15. De Felice FG, et al. Alzheimer’s disease-type neuronal tau hyperphosphorylation induced by A beta oligo-mers. Neurobiol Aging. 2008;29(9):1334–1347.
16. De Felice FG, et al. Abeta oligomers induce neuronal oxidative stress through an N-methyl-D-aspartate receptor-dependent mechanism that is blocked by the Alzheimer drug memantine. J Biol Chem. 2007;282(15):11590–11601.
17. Decker H, et al. N-methyl-D-aspartate receptors are required for synaptic targeting of Alzheimer’s toxic amyloid-beta peptide oligomers. J Neurochem. 2010;115(6):1520–1529.
18. Lacor PN, et al. Abeta oligomer-induced aberra-tions in synapse composition, shape, and density provide a molecular basis for loss of connectivity in Alzheimer’s disease. J Neurosci. 2007;27(4):796–807.
19. Lambert MP, et al. Diffusible, nonfibrillar ligands derived from Abeta1-42 are potent central ner-vous system neurotoxins. Proc Natl Acad Sci U S A. 1998;95(11):6448–6453.
20. Townsend M, Mehta T, Selkoe DJ. Soluble Abeta inhibits specific signal transduction cascades com-mon to the insulin receptor pathway. J Biol Chem. 2007;282(46):33305–33312.
21. Escribano L, et al. Rosiglitazone rescues memory impairment in Alzheimer’s transgenic mice: mecha-nisms involving a reduced amyloid and tau patholo-gy. Neuropsychopharmacology. 2010;35(7):1593–1604.
22. Hirosumi J, et al. A central role for JNK in obesity and insulin resistance. Nature. 2002;420(6913):333–336.
23. Hotamisligil GS, Peraldi P, Budavari A, Ellis R, White MF, Spiegelman BM. IRS-1-mediated inhi-bition of insulin receptor tyrosine kinase activity in TNF-alpha- and obesity-induced insulin resistance. Science. 1996;271(5249):665–668.
24. Shankar GM, et al. Amyloid-beta protein dimers isolated directly from Alzheimer’s brains impair synaptic plasticity and memory. Nat Med. 2008; 14(8):837–842.
25. Lesne S, et al. A specific amyloid-beta protein assem-bly in the brain impairs memory. Nature. 2006; 440(7082):352–357.
26. Rui L, et al. Insulin/IGF-1 and TNF-alpha stimulate phosphorylation of IRS-1 at inhibitory Ser307 via distinct pathways. J Clin Invest. 2001;107(2):181–189.
27. Brewer GJ, Boehler MD, Jones TT, Wheeler BC. NbActiv4 medium improvement to Neurobasal/B27 increases neuron synapse densities and net-work spike rates on multielectrode arrays. J Neurosci Methods. 2008;170(2):181–187.
28. Irvine EE, et al. Insulin receptor substrate 2 is a negative regulator of memory formation. Learn Mem. 2011;18(6):375–383.
29. Killick R, et al. Deletion of Irs2 reduces amyloid deposition and rescues behavioural deficits in APP transgenic mice. Biochem Biophys Res Commun. 2009; 386(1):257–262.
30. Bouzakri K, et al. Reduced activation of phosphati-
dylinositol-3 kinase and increased serine 636 phos-phorylation of insulin receptor substrate-1 in prima-ry culture of skeletal muscle cells from patients with type 2 diabetes. Diabetes. 2003;52(6):1319–1325.
31. Ma QL, et al. Beta-amyloid oligomers induce phosphorylation of tau and inactivation of insu-lin receptor substrate via c-Jun N-terminal kinase signaling: suppression by omega-3 fatty acids and curcumin. J Neurosci. 2009;29(28):9078–9089.
32. Cacquevel M, Lebeurrier N, Cheenne S, Vivien D. Cytokines in neuroinflammation and Alzheimer’s disease. Curr Drug Targets. 2004;5(6):529–534.
33. Morfini GA, et al. Pathogenic huntingtin inhibits fast axonal transport by activating JNK3 and phosphory-lating kinesin. Nat Neurosci. 2009;12(7):864–871.
34. Morfini GA, et al. Axonal transport defects in neurodegenerative diseases. J Neurosci. 2009; 29(41):12776–12786.
35. Decker H, Lo KY, Unger SM, Ferreira ST, Silverman MA. Amyloid-beta peptide oligomers disrupt axonal transport through an NMDA receptor-dependent mechanism that is mediated by glycogen synthase kinase 3beta in primary cultured hippocampal neurons. J Neurosci. 2010;30(27):9166–9171.
36. Nakamura T, et al. Double-stranded RNA-dependent protein kinase links pathogen sensing with stress and metabolic homeostasis. Cell. 2010;140(3):338–348.
37. Yuan M, et al. Reversal of obesity- and diet-induced insulin resistance with salicylates or targeted disrup-tion of Ikkbeta. Science. 2001;293(5535):1673–1677.
38. Cai D, et al. Local and systemic insulin resistance resulting from hepatic activation of IKK-beta and NF-kappaB. Nat Med. 2005;11(2):183–190.
39. Hundal RS, et al. Mechanism by which high-dose aspirin improves glucose metabolism in type 2 dia-betes. J Clin Invest. 2002;109(10):1321–1326.
40. Ozes ON, et al. A phosphatidylinositol 3-kinase/Akt/mTOR pathway mediates and PTEN antago-nizes tumor necrosis factor inhibition of insulin signaling through insulin receptor substrate-1. Proc Natl Acad Sci U S A. 2001;98(8):4640–4645.
41. Dhamoon MS, Noble JM, Craft S. Intranasal insu-lin improves cognition and modulates beta-amy-loid in early AD. Neurology. 2009;72(3):292–293.
42. Benedict C, Hallschmid M, Schultes B, Born J, Kern W. Intranasal insulin to improve memory function in humans. Neuroendocrinology. 2007;86(2):136–142.
43. Taguchi A, White MF. Insulin-like signaling, nutri-ent homeostasis, and life span. Annu Rev Physiol. 2008;70:191–212.
44. During MJ, et al. Glucagon-like peptide-1 receptor is involved in learning and neuroprotection. Nat Med. 2003;9(9):1173–1179.
45. Cole GM, Frautschy SA. The role of insulin and neu-rotrophic factor signaling in brain aging and Alzheim-
The Journal of Clinical Investigation http://www.jci.org
er’s disease. Exp Gerontol. 2007;42(1–2):10–21. 46. Mattson MP, Perry T, Greig NH. Learning from the
gut. Nat Med. 2003;9(9):1113–1115. 47. McClean PL, Gault VA, Harriott P, Holscher C.
Glucagon–like peptide–1 analogues enhance syn-aptic plasticity in the brain: a link between diabe-tes and Alzheimer’s disease. Eur J Pharmacol. 2010; 630(1–3):158–162.
48. Toledo EM, Inestrosa NC. Activation of Wnt sig-naling by lithium and rosiglitazone reduced spa-tial memory impairment and neurodegeneration in brains of an APPswe/PSEN1DeltaE9 mouse model of Alzheimer’s disease. Mol Psychiatry. 2010;15(3):272–285.
49. Ferdaoussi M, et al. Exendin-4 protects beta-cells from interleukin-1 beta-induced apoptosis by interfering with the c-Jun NH2-terminal kinase pathway. Diabetes. 2008;57(5):1205–1215.
50. Natalicchio A, et al. Exendin-4 prevents c-Jun N-ter-minal protein kinase activation by tumor necrosis factor-alpha (TNFalpha) and inhibits TNFalpha-induced apoptosis in insulin-secreting cells. Endo-crinology. 2010;151(5):2019–2029.
51. Janson J, Laedtke T, Parisi JE, O’Brien P, Petersen RC, Butler PC. Increased risk of type 2 diabetes in Alzheimer disease. Diabetes. 2004;53(2):474–481.
52. Carlson CJ, White MF, Rondinone CM. Mamma-lian target of rapamycin regulates IRS-1 serine 307 phosphorylation. Biochem Biophys Res Commun. 2004;316(2):533–539.
53. Fisher TL, White MF. Signaling pathways: the benefits of good communication. Curr Biol. 2004; 14(23):R1005–R1007.
54. Lafay-Chebassier C, et al. mTOR/p70S6k signalling alteration by Abeta exposure as well as in APP-PS1 transgenic models and in patients with Alzheimer’s disease. J Neurochem. 2005;94(1):215–225.
55. Caccamo A, Majumder S, Richardson A, Strong R, Oddo S. Molecular interplay between mammalian
target of rapamycin (mTOR), amyloid-beta, and Tau: effects on cognitive impairments. J Biol Chem. 2010;285(17):13107–13120.
56. Spilman P, et al. Inhibition of mTOR by rapamycin abolishes cognitive deficits and reduces amyloid-beta levels in a mouse model of Alzheimer’s disease. PLoS One. 2010;5(4):e9979.
57. Ma T, et al. Dysregulation of the mTOR pathway mediates impairment of synaptic plasticity in a mouse model of Alzheimer’s disease. PLoS One. 2010; 5(9):e12845.
58. Morel M, Couturier J, Lafay-Chebassier C, Paccalin M, Page G. PKR, the double stranded RNA-depen-dent protein kinase as a critical target in Alzheimer’s disease. J Cell Mol Med. 2009;13(8A):1476–1488.
59. Selkoe DJ. Resolving controversies on the path to Alzheimer’s therapeutics. Nat Med. 2011; 17(9):1060–1065.
60. Hotamisligil GS, Murray DL, Choy LN, Spiegelman BM. Tumor necrosis factor alpha inhibits signaling from the insulin receptor. Proc Natl Acad Sci U S A. 1994;91(11):4854–4858.
61. Uysal KT, Wiesbrock SM, Marino MW, Hotamis-ligil GS. Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature. 1997;389(6651):610–614.
62. Wiedmann MW, Mossner J, Baerwald C, Pierer M. TNF alpha inhibition as treatment modality for certain rheumatologic and gastrointestinal diseas-es. Endocr Metab Immune Disord Drug Targets. 2009; 9(3):295–314.
63. Araujo EP, et al. Infliximab restores glucose homeo-stasis in an animal model of diet-induced obesity and diabetes. Endocrinology. 2007;148(12):5991–5997.
64. Tobinick E. Perispinal etanercept: a new therapeu-tic paradigm in neurology. Expert Rev Neurother. 2010;10(6):985–1002.
65. Copps KD, Hancer NJ, Opare-Ado L, Qiu W, Walsh C, White MF. Irs1 serine 307 promotes insulin sen-
sitivity in mice. Cell Metab. 2010;11(1):84–92. 66. Aguirre V, Uchida T, Yenush L, Davis R, White MF.
The c-Jun NH(2)-terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser(307). J Biol Chem. 2000;275(12):9047–9054.
67. Aguirre V, Werner ED, Giraud J, Lee YH, Shoelson SE, White MF. Phosphorylation of Ser307 in insu-lin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. J Biol Chem. 2002;277(2):1531–1537.
68. Freude S, et al. Neuronal IGF-1 resistance reduces Abeta accumulation and protects against premature death in a model of Alzheimer’s disease. FASEB J. 2009;23(10):3315–3324.
69. Klyubin I, et al. Amyloid beta protein immunother-apy neutralizes Abeta oligomers that disrupt synap-tic plasticity in vivo. Nat Med. 2005;11(5):556–561.
70. Relkin NR, et al. 18-Month study of intravenous immunoglobulin for treatment of mild Alzheimer disease. Neurobiol Aging. 2009;30(11):1728–1736.
71. Talbot K, et al. Dysbindin-1 is reduced in intrin-sic, glutamatergic terminals of the hippocampal formation in schizophrenia. J Clin Invest. 2004; 113(9):1353–1363.
72. Amaral DG, Insausti R, Campbell MJ. Distribution of somatostatin immunoreactivity in the human dentate gyrus. J Neurosci. 1988;8(9):3306–3316.
73. Kwinter DM, Lo K, Mafi P, Silverman MA. Dynactin regulates bidirectional transport of dense-core vesicles in the axon and dendrites of cultured hippocampal neurons. NeuroScience. 2009;162(4):1001–1010.
74. Bondolfi L, et al. Amyloid-associated neuron loss and gliogenesis in the neocortex of amyloid precursor pro-tein transgenic mice. J Neurosci. 2002;22(2):515–522.
75. Gengler S, McClean PL, McCurtin R, Gault VA, Hölscher C. Val(8)GLP–1 rescues synaptic plasticity and reduces dense core plaques in APP/PS1 mice. Neurobiol Aging. 2012;33(2):265–276.
Supplemental Figure 1 . Immunohistochemical specificity of Cell Signaling antibody CS2388 to IRS-1pS636/639 demonstrated in the hippocampus of AD cases. The antibody reveals the phosphospecific antigen in the cytoplasm of neurons (A). Immunoreactivity was blocked by preadsorption of the antibody with a 5X molar excess of the phosphorylated immunogen (B). No appreciable inhibition of immunoreactivity was seen, however, after preadsorption of the antibody with a 5X molar excess of non-phosphorylated IRS-1 amino acid sequence 631-646 (Abcam ab41777) (C). Identical results were obtained on five AD cases.
A IRS-1pSer636 B *300
200
100
AβO
veh
636
307
312
616
C
IRS
-1pS
er
(% o
f veh
icle
)
0
Supplemental Figure 2 . Aβ oligomers (AβOs) induce the increase in IRS-1pSer levels in mature hippocampal neurons grown in insulin-free medium. IRS-1pSer636 immunolabeling in hippocampal neurons exposed to vehicle (A) or 500 nM AβOs (B) for 3 h (Scale bars = 20μm). C, integrated IRS-1pSer immunofluorescence levels determined from 2 experi-ments using independent cultures (30 images analyzed/experimental condition/experiment, each experiment carried out in triplicate). * statistically significant differences (p<0.05, ANOVA followed by Bonferroni post-hoc test) relative to vehicle-treated cultures.
*
*
M1 M2 M3S
IRS-
1pSe
r636
(103 p
ixel
/fiel
d)
Supplemental Figure 3 . Elevated IRS-1pSer636 levels in the temporal corti-ces of cynomolgus monkeys that received intracerebroventricular injections of
AβOs. IRS-1pSer636 immunoreactivities in the same segments of the tempo-ral cortex from a control (sham-operated) monkey (A) and 3 different mon-
keys that received AβOs injections (B-D). E, IRS-1pSer636 immunolabeling density (pixels -ral cortices of sham (S) or oligomer-injected monkeys (M1-M3). DAPI staining is in blue. * statistically significant (p<0.001 ANOVA followed by Bonferroni
post-hoc test) differences relative to the sham-operated monkey.
Supplemental Figure 4 . Total c-Jun N terminal kinase (JNK) levels in hippo-campal cell cultures exposed to AβOs and in the hippocampi of transgenic mice. Immunoblotting for JNK levels in hippo-campal neurons exposed to vehicle or 500 nM AβOs A) and in h ip p o c a mp a l h o mo g e n a t e s f r o m APPSwe,PS1deltaE9 transgenic mice (Tg; n=7) or wild-type mice (WT; n=5) (B). Graphs show quantification of JNK levels in cultures (A) or in transgenic mice (B) normalized by cyclophilin B as a loading control.
Supplemental Figure 5 : Schematic representation of axonal transport experiments: (A) Pri-mary hippocampal neurons (prepared as described, 35) were transfected (at days in vitro) to express BDNF-mRFP, a dense-core vesicle (DCV) cargo, or mitochondrially-targeted YFP. Cells were allowed to express constructs for 24 h before imaging or immunocytochem-istry. Axons and dendrites were initially distinguished based on morphology and confirmed retrospectively by antibody staining against MAP-2, a dendritic cytoskeletal protein. (B) Axons were live imaged using a wide-field fluorescent microscope (DMI 6000 B, Leica) as previously described (35). (C) Bidirectional axonal transport of BDNF-DCVs or mitochondria. Anterograde and retrograde transport are indicated by green and red arrows, respectively. Pannels A and B adapted from 73.
A B
C
Supplemental Figure 6 . Exendin-4 does not interfere with AβO binding to neurons. Hippocampal neurons were exposed for 3 h to vehicle (A), 500 nM AβOs (B nM AβOs (C) or 300 nM exendin-4 + 500 nM AβOs (D) and AβO binding was detected using oligomer-specific NU4 E) Integrated oligomer immunofluorescence determined from 5 experiments using indepen-dent cultures (25 images analyzed per experimental condition per experiment). * and #, statistically significant differences relative to vehi-cle-treated neurons (p < 0.01) or AβO-treated neurons (p < 0.001), respectively.
E
#
*
AβO
imm
unor
eact
. (%
of v
ehic
le)
GL
P1
-R/
cycl
o B
(%
of W
T)
\\\ WT Tg
GLP1R 56
cyclo B 19
BWT Tg KDa
GL
P1
-R/
cycl
o B
(%
of
veh
icle
)
Veh AβO
cyclo B 19
GLP1R 56
Vehicle A βOs KDa
A
Supplemental Figure 7 . Glucagon-like peptide 1 receptor (GLP1R) levels in hippocampal cell cultures exposed to AβOs and in the hippocampi of transgenic mice. Immunoblotting for GLP1R levels in hippocampal neurons exposed to vehicle or 500 nM AβOs A) and in hippocampal h o mo g e n a t e s f r o m A P P S we , P S 1 d e l t a E 9 transgenic mice (Tg; n=7) or wild-type mice (WT; n=5) (B). Graphs show densitomteric quantification of GLP1R levels in cultures (A) or in transgenic mice (B) normalized by cyclophilin B as a loading control.
WT PBS WT Ex-4 Tg PBSU Tg Ex-4
Before treatment
After treatment
Bod
y w
eigh
t (g)
Supplemental Figure 8 . Lack of effect of 3-week intraperitoneal administration of exendin-4 on body weight of APPSwe,PS1deltaE9 mice. Transgenic mice (n=7) or wild-type mice (n=5) received intra-peritoneal exendin-4 (25 nmol/kg bw) or saline (0.9% w/v) injections once-daily for 3 weeks, for the duration of the behavioral experiments.
Supplemental Videos Legends Supplemental Video 1. Role of JNK in disruption of dense-core vesicle (DCV) transport
induced by Aβ oligomers. Hippocampal cultures expressing the DCV cargo BDNF-mRFP were
used. Video shows live imaging of DCV transport in representative axons from hippocampal
neurons exposed to vehicle, 500 nM oligomers or 10μM SP600125 + 500 nM oligomers for 18
hours. Quantification of DCV transport parameters is shown in Supplemental Table 2.
Supplemental Video 2. Exendin-4 and insulin prevent Aβ oligomer-induced disruption of
dense-core vesicle (DCV) transport. Hippocampal cultures expressing the DCV cargo BDNF-
mRFP were used. Video shows live imaging of DCV transport in representative axons from
cultures exposed to 300 nM exendin-4 + 500 nM oligomers or 1 μM insulin + 500 nM oligomers
for 18 hours. Quantification of DCV transport parameters is shown in Supplemental Table 2.
Supplemental Video 3. Exendin-4 blocks Aβ-oligomer-induced disruption of mitochondria
transport. Hippocampal cultures expressing mitochondrially-targeted YFP were used. Video
shows time-lapse imaging of mitochondria transport in representative axons from cultures
exposed to 300 nM exendin-4 + 500 nM oligomers for 18 hours. Quantification of mitochondria
transport parameters is shown in Supplemental Table 3.
1
Supplemental Table 1: Demographic and Autopsy Data on Human Cases
Variable NCI AD Number of Cases 22 22 Age (y, mean ± SD)* 71.45 ± 13.44 72.77 ± 11.13 Males/Females 10/12 10/12 PMI (h, mean ± SD)*
12.43 ± 5.18 10.43 ± 4.24
AD = Alzheimer’s Disease Cases, NCI = Non-Cognitively Impaired Cases *No significant difference between NCI and AD groups
2
Supplemental Table 2: Quantitative analysis of DCV transport
DCVs Traffic values % All events Anterograde Retrograde All events
Flux (min-1)
Vehicle 18h 10.28 ± 1.49 6.60 ± 1.18 3.67 ± 0.55 # 100.00 ±
14.09 AβOs 18h 2.55 ± 0.49 1.40 ± 0.29 ** 1.15 ± 0.23 ** 24.78 ± 4.75 **
AβOs scrambled 8.05 ± 0.55 4.42 ± 0.41 ++ 3.63 ± 0.44 ++ 78.29 ± 5.35 ++
Insulin + AβOs 10.35 ± 1.39 6.13 ± 0.85 ++ 4.26 ± 0.81 ++ 100.64 ±
13.55 ++
Exendin + AβOs 8.68 ± 1.29 4.35 ± 0.59 ++ 4.34 ± 0.85 ++ 84.43 ± 12.63 ++
JNK inhibitor + AβOs 7.23 ± 1.23 3.40 ± 0.80 */+ 3.83 ± 0.54 ++ 70.35 ± 12.01 ++
Velocity (µm/s) Vehicle 18h 1.66 ± 0.11 1.66 ± 0.10 1.63 ± 0.12 100.00 ± 6.68AβOs 18h 1.32 ± 0.07 1.32 ± 0.08 * 1.34 ± 0.07 79.94 ± 4.15 *
AβOs scrambled 1.68 ± 0.09 1.74 ± 0.07 + 1.59 ± 0.14 101.51 ± 5.72 +
Insulin + AβOs 1.75 ± 0.09 1.82 ± 0.09 ++ 1.63 ± 0.09 + 105.44 ± 5.19 +Exendin + AβOs 1.39 ± 0.10 1.37 ± 0.10 1.40 ± 0.11 83.81 ± 6.19
JNK inhibitor + AβOs 1.96 ± 0.08 1.94 ± 0.09 1.95 ± 0.08 * 118.61 ± 4.73 *
Run length (µm) Vehicle 18h 8.45 ± 0.69 9.53 ± 0.83 6.78 ± 0.51 100.00 ± 8.19AβOs 18h 5.20 ± 0.33 5.30 ± 0.42 ** 4.90 ± 0.39 * 61.56 ± 3.85 **
AβOs scrambled 6.03 ± 0.45 6.52 ± 0.56 * 5.39 ± 0.46 71.32 ± 5.31 *
Insulin + AβOs 7.72 ± 0.61 8.53 ± 0.76 ++ 6.70 ± 0.56 + 91.37 ± 7.23 ++Exendin + AβOs 7.71 ± 0.76 8.02 ± 0.73 + 7.26 ± 0.94 + 91.19 ± 8.98 +
JNK inhibitor + AβOs 5.13 ± 0.31 5.00 ± 0.42 ** 5.06 ± 0.30 * 60.74 ± 3.71 ** Vehicle n=21 kymographs (21 cells, 3669 vesicles) / AβOs n=25 kymographs (25 cells, 1332 vesicles) AβOscr. n=10 kymographs (10 cells, 1917 vesicles) / Insulin + AβOs n=14 kymographs (14 cells, 3273 vesicles)
Exendin + AβOs n=15 kymographs (15 cells, 2280 vesicles) / JNK inhibitor + AβOs n=15 kymographs (15 cells, 2336 vesicles)* p<0.05 when compared with vehicle (from each column) ** p<0.0001 when compared with vehicle (from each column) + p<0.05 when compared with AβOs (from eachcolumn) ++ p<0.0001 when compared with AβOs (from each column) # p<0.0001 when compared vehicle anterograde with vehicle retrograde
3
4
Supplemental Table 3: Quantitative analysis of mitochondria transport
Mitochondria
Traffic values % All events Anterograde Retrograde All events
Flux (min-1) Vehicle 18h 0.24 ± 0.05 0.10 ± 0.03 0.14 ± 0.03 100.00 ± 21.70 AβOs 18h 0.06 ± 0.03 0.02 ± 0.01 * 0.04 ± 0.02 * 26.56 ± 11.84 *
Insulin + AβOs 0.24 ± 0.03 0.12 ± 0.02 + 0.12 ± 0.03 100.83 ± 14.51 ++
Exendin + AβOs 0.22 ± 0.03 0.11 ± 0.03 + 0.11 ± 0.02
+ 93.79 ± 13.94 +
Velocity (µm/s) Vehicle 18h 0.42 ± 0.04 0.30 ± 0.04 0.46 ± 0.07 100.00 ± 8.73 AβOs 18h 0.27 ± 0.07 0.10 ± 0.05 * 0.35 ± 0.10 63.32 ± 18.02
Insulin + AβOs 0.46 ± 0.05 0.39 ±0.07 + 0.46 ± 0.07 108.89 ± 12.91 Exendin + AβOs 0.42 ± 0.04 0.34 ± 0.04 + 0.47 ± 0.07 100.32 ± 9.31
Run length (µm)
Vehicle 18h 8.26 ± 1.07 5.36 ± 0.89 8.89 ± 1.50 100.00 ± 12.93
AβOs 18h 3.27 ± 0.98 1.89 ± 0.94
** 2.80 ± 0.95 * 39.60 ± 11.87 *
Insulin + AβOs 6.88 ± 0.79 6.49 ± 1.12
++ 5.83 ± 0.98
+ 83.31 ± 9.51 +
Exendin + AβOs 9.06 ± 1.06 9.35 ± 2.11 + 8.99 ± 1.90
+ 109.70 ± 12.86 +
Vehicle n=15 kymographs (15 cells, 229 vesicles) / AβOs n=15 kymographs (15 cells, 56 vesicles) Insulin + AβOs n=13 kymographs (13 cells, 275 vesicles) / Exendin + AβOs n=14 kymographs (14 cells, 257 vesicles) *p<0.05, when compared with vehicle (from each column)
**p<0.0001, when compared with vehicle (from each column)
+ p<0.05 when compared with AβOs (from each column) ++ p<0.0001 when compared with AβOs (from each column)
80
5) DISCUSSÃO
O entendimento das bases moleculares da disfunção neuronal e na perda
de memória na doença de Alzheimer se tornou um grande desafio da
neurosciencia e de saúde pública. E embora a espectativa do número de casos
estimados para as próximas décadas seja assustadora, a idéia de um tratamento
efetivo capaz de desacelerar a progressão da doença ainda está longe de ser
concreta (SELKOE, 2011; SELKOE, 2012). Apenas um pequeno número dos
casos de Alzheimer são atribuidos a fatores genéticos (VAN ES e VAN DEN
BERG, 2009), por outro lado, os mecanismos da patogênese e a etiologia da
forma esporádica da doença de Alzheimer, que compreende a grande maioria dos
casos, não foram totalmente elucidados. Desta forma, a identificação de
componestes moleculares que contribuem para esta doença neurológica complexa
se tornou o foco de intensos esforços nas pesquisas científicas nos últimos anos.
Uma das questões misteriosas da DA é porque especificamente a memória
é afetada nesta doença, e isto tem sido alvo de intensa investigação. É crescente
o número de evidências que mostram que a deterioração morfológica e funcional
de sinapses, centrais para a formação de memória, é induzida pelos oligômeros
do peptídeo β amilóide (Aβ). Sabe-se que estes oligômeros de Aβ, conhecidos
como AβOs, são bastante tóxicos aos neurônios e interferem em diversas vias de
sinalização fisiológicas, desencadeando mecanismos que culminam em disfunção
neuronal (KRAFFT e KLEIN, 2010). Dentre estes, são de destaque o estresse
oxidativo (DE FELICE e cols., 2007; SARAIVA e cols., 2010), que promove
alterações celulares globais, e a desregulação no tráfego e inserção de receptores
81
sinápticos (LACOR e cols., 2007; DE FELICE e cols., 2009; JURGENSEN e cols.,
2011), que certamente prejudica os mecanismos de plasticidade e resposta
sinápticas no cérebro. Somado a estes efeitos deletérios, surge o evidente
prejuízo à sinalização insulinérgica induzida por essas toxinas no cérebro (ZHAO e
cols., 2008; DE FELICE e cols., 2009; MA e cols., 2009).
Estudos clínicos e epdemioógicos demonstram que pacientes de diabetes
tipo II apresentam um risco de desenlvover a doença de Alzheimer (DE LA
MONTE e WANDS, 2008; MURTHY e cols., 2008). No presente trabalho, nós
descrevemos um mecanismo patogênico pelo qual um tipo de diabetes cerebral é
induzida pelos oligômeros de Aβ, sinaptoxinas que acumulam no cérebro de
pacientes com Alzheimer. Sabendo que a sinalização por insulina é central para o
aprendizado e memória (DOU e cols., 2005), podemos propor que o impacto dos
AβO sobre a sinalização insulinérgica cerebral poderia contribuir potencialmente
para a perda de memória, principal sintoma da doença de Alzeimer.
Inicialmente, o trabalho focalizou os efeitos locais dos oligômeros, isto é,
alterações observadas nos prolongamentos neuronais, já descritos como
principais regiões de contato sináptico (KAECH e BANKER, 2006) e também sítios
preferenciais de ligação dos AβOs (LACOR e cols., 2004).
De forma interessante, nossos achados indicam que mecanismos bastante
similares aos que causam resistência à insulina periférica no diabetes tipo 2 foram
observados em nossos modelos para a doença de Alzheimer. Os resultados
demonstram que os AβOs induzem resistência à insulina nos neurônios
hipocampais através da sinalização de TNF-α ativando quinases de estresse
celular como JNK, Ikk e PKR, levando a fosforilação do IRS-1 em resíduos de
82
serina. De fato, análises histopatológicas do cérebro de pacientes com Alzheimer
confirmaram a presença da marcação aumentada para o IRS-1 fosforilado em
resíduos de serina636/639, o qual é tipicamente associado com a resistência à
insulina periférica (HOTAMISLIGIL e cols., 1996; WHITE, 2002) em comparação
com indivíduos não demenciados. Recentemente foi demonstrada a redistribuição
do IRS-1pSer no cérebro de pacientes da DA (MA e cols., 2009). Esta questão foi
descrita previamente por nosso grupo, onde demonstramos que os AβOs
promovem a internalização dos receptores de insulina (RI) (ZHAO e cols., 2008;
DE FELICE e cols., 2009), de forma que é possível que a remoção do RI pode
contribuir, ou mesmo, facilitar o aumento dos níveis de IRSpSer. O que se dispões
de acordo com o nosso achado que revela a insulina, que previamente bloqueou a
internalização dos RI induzida pelos AβO (DE FELICE e cols., 2009), ainda
previne a fosforilação do IRS-1 em resíduos de serina.
Nos casos de resistência à insulina periférica, a fosforilação do IRS-1 em
resíduos de serina tem como uma de suas principais quinases a mTOR (OZES e
cols., 2001; CARLSON e cols., 2004). No entanto, em nosso modelo de culturas
maduras primárias de hipocampo de embrião de rato expostas aos oligômeros de
Aβ, a inibição do IRS-1 parece não envolver a ativação de mTORC1, uma vez que
o uso prévio da rapamicina não protegeu contra o aumento dos níveis de IRS-
1pSer. Embora o papel da mTOR na patogênese da DA seja bastante
controverso, a analise de sua atividade se revelou aumentada no cérebro de
camundongos triplo transgênico para a DA (LAFAY-CHEBASSIER e cols., 2005).
Por outro lado, a inibição de sua atividade pela rapamicina promoveu melhora
cognitiva em outro modelo transgênico da doença de Alhzeimer (CACCAMO e
83
cols., 2010; SPILMAN e cols., 2010). Outro estudo demonstrou que a
desregulação de sua atividade está correlacionada com a disfunção da
paslticidade sináptica, uma vez que a superexpressão de mTOR foi capaz de
recuperar a LTP no modelo transgênico para Alzheimer Tg2576 (MA e cols.,
2010). Portanto, diante dos controversos achados, é plausível pensar que estudos
adicionais seria necessários para desvendar o possível papel da sinalização da
mTOR na DA.
De acordo com a hipótese inicial, nós encontramos elevados níveis de
pJNK, em sua forma ativa, no cérebro de pacientes com Alzheimer, assim como
no hipocampo de animais transgênicos (APP/PS1) para a DA. Esta ativação da
JNK também foi identificada em um modelo de triplo transgênico para DA,
alimentados com uma dieta hipercalórica (MA e cols., 2009). Supreendentemente,
a injeção de AβOs no cérebro de macacos, revelou elevados níveis de IRS-
1pSer636 e pJNK, indicando que a inibição da via de sinalização por insulina
cerebral induzida pelos AβO, através da ativação de JNK, ocorre in vivo e
possivelmente é uma característica patológica da doença de Alzheimer.
Sabe-se, que a inflamação é central na indução de resistência à insulina na
obesidade e no diabetes tipo 2 (HOTAMISLIGIL, 2006; HOTAMISLIGIL e ERBAY,
2008). Nossos dados confirmam a idéia proposta, de que a resistência à insulina
neuronal induzida pelos oligômeros de Aβ é mediada por uma resposta
inflamatória através da via de TNF-α, uma vez que o anticorpo capaz de neutraliza
o TNF-α solúvel, protegeu os neurônios contra a inibição do IRS-1 induzida pelos
oligômeros. Também usado no tratamento de doenças inflamatórias (WIEDMANN
e cols., 2009), o infliximab e seu similar, etanercept, foram recentemente
84
sugeridos como novos agentes terapêuticos no tratamento da resistência à
insulina no diabetes tipo 2 (ARAUJO e cols., 2007). Outro estudo sugere sua
eficácia na melhora do declínio cognitivo em pacientes com Alzheimer (TOBINICK,
2009). Esse achado é reforçado por nossos dados, uma vez que o infliximab
protegeu os neurônios da desregulação insulinérgica induzida pelos oligômeros, e
desse modo se torna um potente candidato para o desenvolvimento de novas
abordagens terapêuticas contra a perda de memória na DA.
Diferentes do que esperávamos, nós não observamos mudanças nos níveis
de IRS-1p307 no hipocampo de animais transgênicos para DA, por outro lado, nas
culturas de hipocampo expostas aos oligômeros de Aβ apresentaram um aumento
siginificativo dos níveis do IRS-1 fosforilado nesta serina 307. Um estudo recente
demonstrou que em camundongos, este sítio de fosforilação o qual favorece
regulação positiva da sinalização por insulina (COPPS e cols., 2010), contraiando
resultados prévios obtidos em culturas de células (AGUIRRE e cols., 2000; RUI e
cols., 2001; AGUIRRE e cols., 2002). Com base em nossos resultados, seria
coerente afirmar que após a ligação dos oligômeros nas sinapses, a fosforialção
do IRS-1 em múltiplos resíduos de serina poderia acontecer através da ativação
das quinases de estresse celular, PKR, Ikk e JNK. Além disso, mesmo que a
serina 307 não seja fosforilada, o resultado final com a fosforilação do IRS-1 em
outros diferentes resíduos já seria suficientemente crítico para regular a
resistência à insulina neuronal, da mesma forma como ocorre nos tecidos
periféricos (WHITE, 2002).
Os níveis de IRS-2 estavam aumentados nas culturas hipocampis espoxtas
aos oligômeros de Aβ. Este fenômenopode estar relacionado ao fato de que em
85
estudos prévios, o IRS-2 foi considerado um regulador negativo na formação de
memória (IRVINE e cols., 2011). Outro estudo demonstrou que a deleção de IRS-2
reduz a deposição de Aβ e o déficit cognitivo em camundongos transgênicos para
a DA (KILLICK e cols., 2009). Em nossas análises do hipocampo de camundongos
transgênicos (APP/PS1) para DA, observamos que os níveis de IRS-2 estavam
reduzidos significativamente. Resultado semelhante foi encontrado em cérebros
de pacientes com Alzheimer (MOLONEY e cols., 2010), o que sugere um
fenômeno compensatório para reduzir o impacto negativo do IRS-2 sobre a
memória na DA (FREUDE e cols., 2009). Portanto, é possível que o IRS-1 tenha
um papel de regular positivamente a memória, como sugerido pelos nossos
resultados e por estudos prévios, enquanto o IRS-2 contribua como um regulador
negativo da formação da memória.
Diante do crescente número de evidências, os oligômeros de Aβ vem sendo
considerados como os principais responsáveis pela disfunção sináptica (LESNE e
cols., 2006; SHANKAR e cols., 2008; DE FELICE e cols., 2009; FERREIRA e
KLEIN, 2011). Desta forma, os AβO constituem um alvo central para o
desenvolvimento de fármacos que forneçam resultados positivos nos teste clínicos
da DA (KLYUBIN e cols., 2005; RELKIN e cols., 2009). Recentemente a
estimulação da sinalização por insulina tem sido sugerida como uma abordagem
promissora para prevenir ou impedir o declínio cognitivo dos pacientes com DA
(DHAMOON e cols., 2009). Neste sentido, a ação protetora da insulina em
recuperar a inibição do IRS-1, como demonstrado por nossos resultados,
provavelmente deriva da sua habilidade de bloquear a ligação dos oligômeros aos
neurônios (DE FELICE e cols., 2009).
86
Entretanto, uma vez que os receptores de insulina são removidos das
membrandas neuronais no cérebro de pacientes com DA (MOLONEY e cols.,
2010) e ainda nas culturas expostas aos oligômeros de Aβ (ZHAO e cols., 2008),
sugerindo que o uso da insulin somente pode não ser a forma de combate mais
efetiva.
Neste sentido, abordagens alternativas que estimulem a via de sinalização
por insulina por um caminho diferente do receptor de insulina podem representar
uma estratégia segura para tratar a DA. Nossos resultados demonstram que a
exendina-4, um composto antidiabético que estimula a sinalização por insulina
através da ativação do receptor de GLP-1, foi capaz de proteger os neurônios
contra a inibição do IRS-1 induzida pelos AβO. Adicionalmente, aexendina-4
reduziu a ativação da JNK e consequentemente, a inibição do IRS-1 em animais
transgênicos para a DA. Sugreindo essa via de sinalização através do receptor de
GLP1 como uma importante alternativa para bloquear a resistência à insulina e a
perda de memória na DA.
Buscando entender melhor o papel dos componentes inflamatórios na
patogênese da DA, investigamos outra importante via pró-inflamatória, a
sinalização por IL-1β. Recentes estudos fornecem fortes evidencias sugerindo um
papel central da inflamação crônica na patogênese de doenças metabólicas,
assim como na DA. Elevados níveis de mediadores inflamatórios circulantes,
como TNF-α e IL-1β são marcadores importantes da inflamação crônica no
diabetes tipo 2 (HOTAMISLIGIL, 2010; DONATH e SHOELSON, 2011). Nossos
dasos adicionais demonstraram um importante papel da sinzalição de IL-1β na
toxicidade induzida pelos oligômeros de Aβ em neurônios hipocampais. A inibição
87
do IRS-1 pelos oligômeros foi prevenida na presença de um antagonista do
receptor de IL-1β, sugerindo sua participação neste fenômeno. Da mesma forma,
o déficit de memória induzido pela injeção i.c.v. de oligômeros não ocorreu nos
animais IIL-1β KO, o que nos indica um importante papel desta citocina em mediar
esse quadro característico da doença de Alzheimer.
Sabe-se que a IL-1β é uma potente citocina pró-inflamatória do sistema
nervoso central e que se apresenta cronicamente superexpressa em pacientes
com Alzheimer, estimulando um ciclo inflamatório que contrinui para o quadro
patoglógico na DA. De forma interessante, a sinalização por IL-1β na patogênese
de diabetes tipo 2 apresenta mecanismos de ação distintos muito similares aos
observados na doença de Alzheimer. O primeiro deles é a ativação a JNK, o
segundo é a eficiente evoacação da expressão de outras citocinas pró-
inflamatórias favorecendo a amplificação do sinal inflamatório (AREND e cols.,
2008). Por último, IL-1β é capaz de induzir estesse celular, tal como estresse de
retículo e estresse oxidativo, os quais estão relacionados com a patogênese do
diabetes tipo 2 e também da DA (CARDOZO e cols., 2005; VERMA e DATTA,
2010). Os resultados adicionais obtidos por nosso grupo, em conjunto com essas
informações, destacam a sinalização de IL-1β, como um importante alvo
terapêutico para tratamento da DA.
Os resultados apresentados, portanto, descrevem um mecanismo
patogênico comum entre a doença de Alzheimer e o diabetes tipo 2, além de
apontar alvos moleculares para o desenvolvimento de estratégias antidiabéticas
na terapia desta demência. Esta possibilidade se torna especialmente interessante
por se tratarem de medicamentos já em uso na prática clínica, com risco e
88
farmacologia conhecidos, o que reduz as etapas para sua possível implementação
na terapia da doença de Alzheimer.
89
6) CONCLUSÕES
Os resultados apresentados nesta tese permitem concluir que:
9 Os oligômeros de Aβ induzem a inibição do IRS-1 in vitro e in vivo.
9 Os elevados níveis de IRS-1pSer é um indicativo da presença de disfunção
da sinalização por insulina no cérebro de um modelo transgênico para a
doença de Alzheimer, no cérebro de um novo modelo de primatas não-
humanos para Alzheimer e ainda no cérebro de pacientes acometidos pela
doença.
9 A indução da fosforilação inibitória do IRS-1 em neurônios parece ocorrer
através de vias de pró-inflamatórias, incluindo a sinalização por TNF-α e
JNK, bem como a via de IL-1β. Estes mecanimos são similares aos
envolvidos na patogênese do diabetes.
9 A estimulação da sinzalização por GLP-1, estratégia já utilizada como
terapia anti-diabetes, bloqueia a inibição do IRS-1 induzida pelos
oligômeros de Aβ in vitro e in vivo.
90
7) REFERÊNCIAS
ABBAS T., FAIVRE E. e HOLSCHER C. (2009) Impairment of synaptic plasticity and memory formation in GLP-1 receptor KO mice: Interaction between type 2 diabetes and Alzheimer's disease. Behav.Brain Res. 205:1, 265-271.
AGUIRRE V., UCHIDA T., YENUSH L., DAVIS R. e WHITE M. F. (2000) The c-Jun NH(2)-terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser(307). J.Biol.Chem. 275:12, 9047-9054.
AGUIRRE V., WERNER E. D., GIRAUD J., LEE Y. H., SHOELSON S. E. e WHITE M. F. (2002) Phosphorylation of Ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. J.Biol.Chem. 277:2, 1531-1537.
AGUZZI A., BARRES B. A. e BENNETT M. L. (2013) Microglia: scapegoat, saboteur, or something else? Science 339:6116, 156-161.
ALZHEIMER A., STELZMANN R. A., SCHNITZLEIN H. N. e MURTAGH F. R. (1995) An English translation of Alzheimer's 1907 paper, "Uber eine eigenartige Erkankung der Hirnrinde". Clin.Anat. 8:6, 429-431.
ARAUJO E. P., DE SOUZA C. T., UENO M., CINTRA D. E., BERTOLO M. B., CARVALHEIRA J. B., SAAD M. J. e VELLOSO L. A. (2007) Infliximab restores glucose homeostasis in an animal model of diet-induced obesity and diabetes. Endocrinology 148:12, 5991-5997.
AREND W. P., PALMER G. e GABAY C. (2008) IL-1, IL-18, and IL-33 families of cytokines. Immunol.Rev. 223, 20-38.
ARKAN M. C., HEVENER A. L., GRETEN F. R., MAEDA S., LI Z. W., LONG J. M., WYNSHAW-BORIS A., POLI G., OLEFSKY J. e KARIN M. (2005) IKK-beta links inflammation to obesity-induced insulin resistance. Nat.Med. 11:2, 191-198.
BALLARD C., GAUTHIER S., CORBETT A., BRAYNE C., AARSLAND D. e JONES E. (2011) Alzheimer's disease. Lancet 377:9770, 1019-1031.
91
BANTING F. G., BEST C. H., COLLIP J. B., CAMPBELL W. R. e FLETCHER A. A. (1922) Pancreatic Extracts in the Treatment of Diabetes Mellitus. Can.Med.Assoc.J. 12:3, 141-146.
BARRERA J. G., SANDOVAL D. A., D'ALESSIO D. A. e SEELEY R. J. (2011) GLP-1 and energy balance: an integrated model of short-term and long-term control. Nat.Rev.Endocrinol 7:9, 507-516.
BAUMANN C. A., RIBON V., KANZAKI M., THURMOND D. C., MORA S., SHIGEMATSU S., BICKEL P. E., PESSIN J. E. e SALTIEL A. R. (2000) CAP defines a second signalling pathway required for insulin-stimulated glucose transport. Nature 407:6801, 202-207.
BENNETT M. R. (2000) The concept of long term potentiation of transmission at synapses. Prog.Neurobiol. 60:2, 109-137.
BERTRAM L., LILL C. M. e TANZI R. E. (2010) The genetics of Alzheimer disease: back to the future. Neuron 68:2, 270-281.
BERTRAM L. e TANZI R. E. (2005) The genetic epidemiology of neurodegenerative disease. J.Clin.Invest 115:6, 1449-1457.
BIESSELS G. J., VAN DER HEIDE L. P., KAMAL A., BLEYS R. L. e GISPEN W. H. (2002) Ageing and diabetes: implications for brain function. Eur.J.Pharmacol. 441:1-2, 1-14.
BROOKMEYER R., JOHNSON E., ZIEGLER-GRAHAM K. e ARRIGHI H. M. (2007) Forecasting the global burden of Alzheimer's disease. Alzheimers.Dement. 3:3, 186-191.
BROWN K. L., COSSEAU C., GARDY J. L. e HANCOCK R. E. (2007) Complexities of targeting innate immunity to treat infection. Trends Immunol. 28:6, 260-266.
BRUNING J. C., GAUTAM D., BURKS D. J., GILLETTE J., SCHUBERT M., ORBAN P. C., KLEIN R., KRONE W., MULLER-WIELAND D. e KAHN C. R. (2000) Role of brain insulin receptor in control of body weight and reproduction. Science 289:5487, 2122-2125.
92
BURDICK D., SOREGHAN B., KWON M., KOSMOSKI J., KNAUER M., HENSCHEN A., YATES J., COTMAN C. e GLABE C. (1992) Assembly and aggregation properties of synthetic Alzheimer's A4/beta amyloid peptide analogs. J.Biol.Chem. 267:1, 546-554.
CACCAMO A., MAJUMDER S., RICHARDSON A., STRONG R. e ODDO S. (2010) Molecular interplay between mammalian target of rapamycin (mTOR), amyloid-beta, and Tau: effects on cognitive impairments. J.Biol.Chem. 285:17, 13107-13120.
CALAY E. S. e HOTAMISLIGIL G. S. (2013) Turning off the inflammatory, but not the metabolic, flames. Nat.Med. 19:3, 265-267.
CALON F., LIM G. P., YANG F., MORIHARA T., TETER B., UBEDA O., ROSTAING P., TRILLER A., SALEM N., Jr., ASHE K. H., FRAUTSCHY S. A. e COLE G. M. (2004) Docosahexaenoic acid protects from dendritic pathology in an Alzheimer's disease mouse model. Neuron 43:5, 633-645.
CARDOZO A. K., ORTIS F., STORLING J., FENG Y. M., RASSCHAERT J., TONNESEN M., VAN E. F., MANDRUP-POULSEN T., HERCHUELZ A. e EIZIRIK D. L. (2005) Cytokines downregulate the sarcoendoplasmic reticulum pump Ca2+ ATPase 2b and deplete endoplasmic reticulum Ca2+, leading to induction of endoplasmic reticulum stress in pancreatic beta-cells. Diabetes 54:2, 452-461.
CARLSON C. J., WHITE M. F. e RONDINONE C. M. (2004) Mammalian target of rapamycin regulates IRS-1 serine 307 phosphorylation. Biochem.Biophys.Res.Commun. 316:2, 533-539.
CARVALHEIRA J. B. C., ZECCHIN H. G. e SAAD M. J. (2002) Vias de Sinalização de Insulina. Arq Bras Endocrinol Metab 46, 419-425.
CASH A. D., ALIEV G., SIEDLAK S. L., NUNOMURA A., FUJIOKA H., ZHU X., RAINA A. K., VINTERS H. V., TABATON M., JOHNSON A. B., PAULA-BARBOSA M., AVILA J., JONES P. K., CASTELLANI R. J., SMITH M. A. e PERRY G. (2003) Microtubule reduction in Alzheimer's disease and aging is independent of tau filament formation. Am.J.Pathol. 162:5, 1623-1627.
CAVALLI V., KUJALA P., KLUMPERMAN J. e GOLDSTEIN L. S. (2005) Sunday Driver links axonal transport to damage signaling. J.Cell Biol. 168:5, 775-787.
CHARTIER-HARLIN M. C., CRAWFORD F., HOULDEN H., WARREN A., HUGHES D., FIDANI L., GOATE A., ROSSOR M., ROQUES P., HARDY J. e . (1991) Early-onset
93
Alzheimer's disease caused by mutations at codon 717 of the beta-amyloid precursor protein gene. Nature 353:6347, 844-846.
CHIU S. L., CHEN C. M. e CLINE H. T. (2008) Insulin receptor signaling regulates synapse number, dendritic plasticity, and circuit function in vivo. Neuron 58:5, 708-719.
COPPS K. D., HANCER N. J., OPARE-ADO L., QIU W., WALSH C. e WHITE M. F. (2010) Irs1 serine 307 promotes insulin sensitivity in mice. Cell Metab 11:1, 84-92.
CRAFT S., PESKIND E., SCHWARTZ M. W., SCHELLENBERG G. D., RASKIND M. e PORTE D., Jr. (1998) Cerebrospinal fluid and plasma insulin levels in Alzheimer's disease: relationship to severity of dementia and apolipoprotein E genotype. Neurology 50:1, 164-168.
CRAFT S. e WATSON G. S. (2004) Insulin and neurodegenerative disease: shared and specific mechanisms. Lancet Neurol. 3:3, 169-178.
CRAS P., KAWAI M., LOWERY D., GONZALEZ-DEWHITT P., GREENBERG B. e PERRY G. (1991) Senile plaque neurites in Alzheimer disease accumulate amyloid precursor protein. Proc.Natl.Acad.Sci.U.S.A 88:17, 7552-7556.
CZIRR E. e WYSS-CORAY T. (2012) The immunology of neurodegeneration. J.Clin.Invest 122:4, 1156-1163.
DAI J., BUIJS R. M., KAMPHORST W. e SWAAB D. F. (2002) Impaired axonal transport of cortical neurons in Alzheimer's disease is associated with neuropathological changes. Brain Res. 948:1-2, 138-144.
DAVIGLUS M. L., PLASSMAN B. L., PIRZADA A., BELL C. C., BOWEN P. E., BURKE J. R., CONNOLLY E. S., Jr., DUNBAR-JACOB J. M., GRANIERI E. C., MCGARRY K., PATEL D., TREVISAN M. e WILLIAMS J. W., Jr. (2011) Risk factors and preventive interventions for Alzheimer disease: state of the science. Arch.Neurol. 68:9, 1185-1190.
DE FELICE F. G. (2013) Alzheimer's disease and insulin resistance: translating basic science into clinical applications. J.Clin.Invest 123:2, 531-539.
DE FELICE F. G., VELASCO P. T., LAMBERT M. P., VIOLA K., FERNANDEZ S. J., FERREIRA S. T. e KLEIN W. L. (2007) Abeta oligomers induce neuronal oxidative stress
94
through an N-methyl-D-aspartate receptor-dependent mechanism that is blocked by the Alzheimer drug memantine. J.Biol.Chem. 282:15, 11590-11601.
DE FELICE F. G., VIEIRA M. N., BOMFIM T. R., DECKER H., VELASCO P. T., LAMBERT M. P., VIOLA K. L., ZHAO W. Q., FERREIRA S. T. e KLEIN W. L. (2009) Protection of synapses against Alzheimer's-linked toxins: insulin signaling prevents the pathogenic binding of Abeta oligomers. Proc.Natl.Acad.Sci.U.S.A 106:6, 1971-1976.
DE FELICE F. G., WU D., LAMBERT M. P., FERNANDEZ S. J., VELASCO P. T., LACOR P. N., BIGIO E. H., JERECIC J., ACTON P. J., SHUGHRUE P. J., CHEN-DODSON E., KINNEY G. G. e KLEIN W. L. (2008) Alzheimer's disease-type neuronal tau hyperphosphorylation induced by A beta oligomers. Neurobiol.Aging 29:9, 1334-1347.
DE LA MONTE S. M. e WANDS J. R. (2008) Alzheimer's disease is type 3 diabetes-evidence reviewed. J.Diabetes Sci.Technol. 2:6, 1101-1113.
DE S. B., VASSAR R. e GOLDE T. (2010) The secretases: enzymes with therapeutic potential in Alzheimer disease. Nat.Rev.Neurol. 6:2, 99-107.
DECKER H., LO K. Y., UNGER S. M., FERREIRA S. T. e SILVERMAN M. A. (2010) Amyloid-beta peptide oligomers disrupt axonal transport through an NMDA receptor-dependent mechanism that is mediated by glycogen synthase kinase 3beta in primary cultured hippocampal neurons. J.Neurosci. 30:27, 9166-9171.
DERKACH V. A., OH M. C., GUIRE E. S. e SODERLING T. R. (2007) Regulatory mechanisms of AMPA receptors in synaptic plasticity. Nat.Rev.Neurosci. 8:2, 101-113.
DESAI A. e MITCHISON T. J. (1997) Microtubule polymerization dynamics. Annu.Rev.Cell Dev.Biol. 13, 83-117.
DHAMOON M. S., NOBLE J. M. e CRAFT S. (2009) Intranasal insulin improves cognition and modulates beta-amyloid in early AD. Neurology 72:3, 292-293.
DI C. M., PICONE P., CARROTTA R., GIACOMAZZA D. e SAN BIAGIO P. L. (2010) Insulin promotes survival of amyloid-beta oligomers neuroblastoma damaged cells via caspase 9 inhibition and Hsp70 upregulation. J.Biomed.Biotechnol. 2010, 147835.
DONATH M. Y. e SHOELSON S. E. (2011) Type 2 diabetes as an inflammatory disease. Nat.Rev.Immunol. 11:2, 98-107.
95
DONNELLY D. (2012) The structure and function of the glucagon-like peptide-1 receptor and its ligands. Br.J.Pharmacol. 166:1, 27-41.
DOU J. T., CHEN M., DUFOUR F., ALKON D. L. e ZHAO W. Q. (2005) Insulin receptor signaling in long-term memory consolidation following spatial learning. Learn.Mem. 12:6, 646-655.
DURING M. J., CAO L., ZUZGA D. S., FRANCIS J. S., FITZSIMONS H. L., JIAO X., BLAND R. J., KLUGMANN M., BANKS W. A., DRUCKER D. J. e HAILE C. N. (2003) Glucagon-like peptide-1 receptor is involved in learning and neuroprotection. Nat.Med. 9:9, 1173-1179.
FERNANDEZ A. M. e TORRES-ALEMAN I. (2012) The many faces of insulin-like peptide signalling in the brain. Nat.Rev.Neurosci. 13:4, 225-239.
FERREIRA S. T. e KLEIN W. L. (2011) The Abeta oligomer hypothesis for synapse failure and memory loss in Alzheimer's disease. Neurobiol.Learn.Mem. 96:4, 529-543.
FERREIRA S. T., VIEIRA M. N. e DE FELICE F. G. (2007) Soluble protein oligomers as emerging toxins in Alzheimer's and other amyloid diseases. IUBMB.Life 59:4-5, 332-345.
FERRI C. P., PRINCE M., BRAYNE C., BRODATY H., FRATIGLIONI L., GANGULI M., HALL K., HASEGAWA K., HENDRIE H., HUANG Y., JORM A., MATHERS C., MENEZES P. R., RIMMER E. e SCAZUFCA M. (2005) Global prevalence of dementia: a Delphi consensus study. Lancet 366:9503, 2112-2117.
FIGUEIREDO C. P., CLARKE J. R., LEDO J. H., RIBEIRO F. C., COSTA C. V., MELO H. M., MOTA-SALES A. P., SARAIVA L. M., KLEIN W. L., SEBOLLELA A., DE FELICE F. G. e FERREIRA S. T. (2013) Memantine rescues transient cognitive impairment caused by high molecular weight AE oligomers but not the persistent impairment induced by low molecular weight oligomers. Journal of Neuroscience .
FREUDE S., HETTICH M. M., SCHUMANN C., STOHR O., KOCH L., KOHLER C., UDELHOVEN M., LEESER U., MULLER M., KUBOTA N., KADOWAKI T., KRONE W., SCHRODER H., BRUNING J. C. e SCHUBERT M. (2009) Neuronal IGF-1 resistance reduces Abeta accumulation and protects against premature death in a model of Alzheimer's disease. FASEB J. 23:10, 3315-3324.
FRIEDMAN D. S. e VALE R. D. (1999) Single-molecule analysis of kinesin motility reveals regulation by the cargo-binding tail domain. Nat.Cell Biol. 1:5, 293-297.
96
FU S., WATKINS S. M. e HOTAMISLIGIL G. S. (2012) The role of endoplasmic reticulum in hepatic lipid homeostasis and stress signaling. Cell Metab 15:5, 623-634.
GARBER A. J. (2011) Long-acting glucagon-like peptide 1 receptor agonists: a review of their efficacy and tolerability. Diabetes Care 34 Suppl 2, S279-S284.
GAULT V. A. e HOLSCHER C. (2008) GLP-1 agonists facilitate hippocampal LTP and reverse the impairment of LTP induced by beta-amyloid. Eur.J.Pharmacol. 587:1-3, 112-117.
GEULA C., WU C. K., SAROFF D., LORENZO A., YUAN M. e YANKNER B. A. (1998) Aging renders the brain vulnerable to amyloid beta-protein neurotoxicity. Nat.Med. 4:7, 827-831.
GIMBEL D. A., NYGAARD H. B., COFFEY E. E., GUNTHER E. C., LAUREN J., GIMBEL Z. A. e STRITTMATTER S. M. (2010) Memory impairment in transgenic Alzheimer mice requires cellular prion protein. J.Neurosci. 30:18, 6367-6374.
GLENNER G. G. e WONG C. W. (1984) Alzheimer's disease: initial report of the purification and characterization of a novel cerebrovascular amyloid protein. Biochem.Biophys.Res.Commun. 120:3, 885-890.
GOATE A., CHARTIER-HARLIN M. C., MULLAN M., BROWN J., CRAWFORD F., FIDANI L., GIUFFRA L., HAYNES A., IRVING N., JAMES L. e . (1991) Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature 349:6311, 704-706.
GONG Y., CHANG L., VIOLA K. L., LACOR P. N., LAMBERT M. P., FINCH C. E., KRAFFT G. A. e KLEIN W. L. (2003) Alzheimer's disease-affected brain: presence of oligomeric A beta ligands (ADDLs) suggests a molecular basis for reversible memory loss. Proc.Natl.Acad.Sci.U.S.A 100:18, 10417-10422.
GOTO Y., NIIDOME T., AKAIKE A., KIHARA T. e SUGIMOTO H. (2006) Amyloid beta-peptide preconditioning reduces glutamate-induced neurotoxicity by promoting endocytosis of NMDA receptor. Biochem.Biophys.Res.Commun. 351:1, 259-265.
GRAFSTEIN B. e FORMAN D. S. (1980) Intracellular transport in neurons. Physiol Rev. 60:4, 1167-1283.
97
GRALLE M. e FERREIRA S. T. (2007) Structure and functions of the human amyloid precursor protein: the whole is more than the sum of its parts. Prog.Neurobiol. 82:1, 11-32.
GRAMMAS P. e OVASE R. (2001) Inflammatory factors are elevated in brain microvessels in Alzheimer's disease. Neurobiol.Aging 22:6, 837-842.
GREENE J. D., HODGES J. R. e BADDELEY A. D. (1995) Autobiographical memory and executive function in early dementia of Alzheimer type. Neuropsychologia 33:12, 1647-1670.
GU Y., SANJO N., CHEN F., HASEGAWA H., PETIT A., RUAN X., LI W., SHIER C., KAWARAI T., SCHMITT-ULMS G., WESTAWAY D., ST GEORGE-HYSLOP P. e FRASER P. E. (2004) The presenilin proteins are components of multiple membrane-bound complexes that have different biological activities. J.Biol.Chem. 279:30, 31329-31336.
HAJ-ALI V., MOHADDES G. e BABRI S. H. (2009) Intracerebroventricular insulin improves spatial learning and memory in male Wistar rats. Behav.Neurosci. 123:6, 1309-1314.
HAMILTON A. e HOLSCHER C. (2009) Receptors for the incretin glucagon-like peptide-1 are expressed on neurons in the central nervous system. Neuroreport 20:13, 1161-1166.
HAMILTON A., PATTERSON S., PORTER D., GAULT V. A. e HOLSCHER C. (2011) Novel GLP-1 mimetics developed to treat type 2 diabetes promote progenitor cell proliferation in the brain. J.Neurosci.Res. 89:4, 481-489.
HARDY J. e SELKOE D. J. (2002) The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science 297:5580, 353-356.
HARDY J. A. e HIGGINS G. A. (1992) Alzheimer's disease: the amyloid cascade hypothesis. Science 256:5054, 184-185.
HAVRANKOVA J., ROTH J. e BROWNSTEIN M. J. (1983) Insulin receptors in brain. Adv.Metab Disord. 10, 259-268.
HAVRANKOVA J., SCHMECHEL D., ROTH J. e BROWNSTEIN M. (1978) Identification of insulin in rat brain. Proc.Natl.Acad.Sci.U.S.A 75:11, 5737-5741.
98
HILTUNEN M., HELISALMI S., MANNERMAA A., ALAFUZOFF I., KOIVISTO A. M., LEHTOVIRTA M., PIRSKANEN M., SULKAVA R., VERKKONIEMI A. e SOININEN H. (2000) Identification of a novel 4.6-kb genomic deletion in presenilin-1 gene which results in exclusion of exon 9 in a Finnish early onset Alzheimer's disease family: an Alu core sequence-stimulated recombination? Eur.J.Hum.Genet. 8:4, 259-266.
HIROKAWA N. (1982) Cross-linker system between neurofilaments, microtubules, and membranous organelles in frog axons revealed by the quick-freeze, deep-etching method. J.Cell Biol. 94:1, 129-142.
HIROKAWA N. (1998) Kinesin and dynein superfamily proteins and the mechanism of organelle transport. Science 279:5350, 519-526.
HIROKAWA N. e TAKEMURA R. (2005) Molecular motors and mechanisms of directional transport in neurons. Nat.Rev.Neurosci. 6:3, 201-214.
HIROSUMI J., TUNCMAN G., CHANG L., GORGUN C. Z., UYSAL K. T., MAEDA K., KARIN M. e HOTAMISLIGIL G. S. (2002) A central role for JNK in obesity and insulin resistance. Nature 420:6913, 333-336.
HIRUMA H., KATAKURA T., TAKAHASHI S., ICHIKAWA T. e KAWAKAMI T. (2003) Glutamate and amyloid beta-protein rapidly inhibit fast axonal transport in cultured rat hippocampal neurons by different mechanisms. J.Neurosci. 23:26, 8967-8977.
HOLSCHER C. e LI L. (2010) New roles for insulin-like hormones in neuronal signalling and protection: new hopes for novel treatments of Alzheimer's disease? Neurobiol.Aging 31:9, 1495-1502.
HORNG T. e HOTAMISLIGIL G. S. (2011) Linking the inflammasome to obesity-related disease. Nat.Med. 17:2, 164-165.
HOTAMISLIGIL G. S. (2006) Inflammation and metabolic disorders. Nature 444:7121, 860-867.
HOTAMISLIGIL G. S. (2010) Endoplasmic reticulum stress and the inflammatory basis of metabolic disease. Cell 140:6, 900-917.
99
HOTAMISLIGIL G. S., ARNER P., CARO J. F., ATKINSON R. L. e SPIEGELMAN B. M. (1995) Increased adipose tissue expression of tumor necrosis factor-alpha in human obesity and insulin resistance. J.Clin.Invest 95:5, 2409-2415.
HOTAMISLIGIL G. S. e ERBAY E. (2008) Nutrient sensing and inflammation in metabolic diseases. Nat.Rev.Immunol. 8:12, 923-934.
HOTAMISLIGIL G. S., PERALDI P., BUDAVARI A., ELLIS R., WHITE M. F. e SPIEGELMAN B. M. (1996) IRS-1-mediated inhibition of insulin receptor tyrosine kinase activity in TNF-alpha- and obesity-induced insulin resistance. Science 271:5249, 665-668.
HOTAMISLIGIL G. S., SHARGILL N. S. e SPIEGELMAN B. M. (1993) Adipose expression of tumor necrosis factor-alpha: direct role in obesity-linked insulin resistance. Science 259:5091, 87-91.
HOYER S. e NITSCH R. (1989) Cerebral excess release of neurotransmitter amino acids subsequent to reduced cerebral glucose metabolism in early-onset dementia of Alzheimer type. J.Neural Transm. 75:3, 227-232.
HSIEH H., BOEHM J., SATO C., IWATSUBO T., TOMITA T., SISODIA S. e MALINOW R. (2006) AMPAR removal underlies Abeta-induced synaptic depression and dendritic spine loss. Neuron 52:5, 831-843.
IRVINE E. E., DRINKWATER L., RADWANSKA K., AL-QASSAB H., SMITH M. A., O'BRIEN M., KIELAR C., CHOUDHURY A. I., KRAUSS S., COOPER J. D., WITHERS D. J. e GIESE K. P. (2011) Insulin receptor substrate 2 is a negative regulator of memory formation. Learn.Mem. 18:6, 375-383.
ISHII K., II K., HASEGAWA T., SHOJI S., DOI A. e MORI H. (1997) Increased A beta 42(43)-plaque deposition in early-onset familial Alzheimer's disease brains with the deletion of exon 9 and the missense point mutation (H163R) in the PS-1 gene. Neurosci.Lett. 228:1, 17-20.
JACOBSEN J. S., WU C. C., REDWINE J. M., COMERY T. A., ARIAS R., BOWLBY M., MARTONE R., MORRISON J. H., PANGALOS M. N., REINHART P. H. e BLOOM F. E. (2006) Early-onset behavioral and synaptic deficits in a mouse model of Alzheimer's disease. Proc.Natl.Acad.Sci.U.S.A 103:13, 5161-5166.
100
JANKOWSKY J. L., SLUNT H. H., RATOVITSKI T., JENKINS N. A., COPELAND N. G. e BORCHELT D. R. (2001) Co-expression of multiple transgenes in mouse CNS: a comparison of strategies. Biomol.Eng 17:6, 157-165.
JARRETT J. T., BERGER E. P. e LANSBURY P. T., Jr. (1993) The carboxy terminus of the beta amyloid protein is critical for the seeding of amyloid formation: implications for the pathogenesis of Alzheimer's disease. Biochemistry 32:18, 4693-4697.
JIN J. J., KIM H. D., MAXWELL J. A., LI L. e FUKUCHI K. (2008) Toll-like receptor 4-dependent upregulation of cytokines in a transgenic mouse model of Alzheimer's disease. J.Neuroinflammation. 5, 23.
JOB C. e EBERWINE J. (2001) Localization and translation of mRNA in dendrites and axons. Nat.Rev.Neurosci. 2:12, 889-898.
JURGENSEN S., ANTONIO L. L., MUSSI G. E., BRITO-MOREIRA J., BOMFIM T. R., DE FELICE F. G., GARRIDO-SANABRIA E. R., CAVALHEIRO E. A. e FERREIRA S. T. (2011) Activation of D1/D5 Dopamine Receptors Protects Neurons from Synapse Dysfunction Induced by Amyloid-{beta} Oligomers. J.Biol.Chem. 286:5, 3270-3276.
KAECH S. e BANKER G. (2006) Culturing hippocampal neurons. Nat.Protoc. 1:5, 2406-2415.
KALARIA R. N., MAESTRE G. E., ARIZAGA R., FRIEDLAND R. P., GALASKO D., HALL K., LUCHSINGER J. A., OGUNNIYI A., PERRY E. K., POTOCNIK F., PRINCE M., STEWART R., WIMO A., ZHANG Z. X. e ANTUONO P. (2008) Alzheimer's disease and vascular dementia in developing countries: prevalence, management, and risk factors. Lancet Neurol. 7:9, 812-826.
KAMAL A., STOKIN G. B., YANG Z., XIA C. H. e GOLDSTEIN L. S. (2000) Axonal transport of amyloid precursor protein is mediated by direct binding to the kinesin light chain subunit of kinesin-I. Neuron 28:2, 449-459.
KAWARABAYASHI T., SHOJI M., YAMAGUCHI H., TANAKA M., HARIGAYA Y., ISHIGURO K. e HIRAI S. (1993) Amyloid beta protein precursor accumulates in swollen neurites throughout rat brain with aging. Neurosci.Lett. 153:1, 73-76.
KAZAFEOS K. (2011) Incretin effect: GLP-1, GIP, DPP4. Diabetes Res.Clin.Pract. 93 Suppl 1, S32-S36.
101
KILLICK R., SCALES G., LEROY K., CAUSEVIC M., HOOPER C., IRVINE E. E., CHOUDHURY A. I., DRINKWATER L., KERR F., AL-QASSAB H., STEPHENSON J., YILMAZ Z., GIESE K. P., BRION J. P., WITHERS D. J. e LOVESTONE S. (2009) Deletion of Irs2 reduces amyloid deposition and rescues behavioural deficits in APP transgenic mice. Biochem.Biophys.Res.Commun. 386:1, 257-262.
KIM J. Y., LIM D. M., PARK H. S., MOON C. I., CHOI K. J., LEE S. K., BAIK H. W., PARK K. Y. e KIM B. J. (2012) Exendin-4 protects against sulfonylurea-induced beta-cell apoptosis. J.Pharmacol.Sci. 118:1, 65-74.
KLEIN W. L. (2006) Synaptic targeting by A beta oligomers (ADDLS) as a basis for memory loss in early Alzheimer's disease. Alzheimers.Dement. 2:1, 43-55.
KLYUBIN I., WALSH D. M., LEMERE C. A., CULLEN W. K., SHANKAR G. M., BETTS V., SPOONER E. T., JIANG L., ANWYL R., SELKOE D. J. e ROWAN M. J. (2005) Amyloid beta protein immunotherapy neutralizes Abeta oligomers that disrupt synaptic plasticity in vivo. Nat.Med. 11:5, 556-561.
KOVACS P. e HAJNAL A. (2009) In vivo electrophysiological effects of insulin in the rat brain. Neuropeptides 43:4, 283-293.
KRAFFT G. A. e KLEIN W. L. (2010) ADDLs and the signaling web that leads to Alzheimer's disease. Neuropharmacology 59:4-5, 230-242.
KWINTER D. M., LO K., MAFI P. e SILVERMAN M. A. (2009) Dynactin regulates bidirectional transport of dense-core vesicles in the axon and dendrites of cultured hippocampal neurons. Neuroscience 162:4, 1001-1010.
LACOR P. N., BUNIEL M. C., CHANG L., FERNANDEZ S. J., GONG Y., VIOLA K. L., LAMBERT M. P., VELASCO P. T., BIGIO E. H., FINCH C. E., KRAFFT G. A. e KLEIN W. L. (2004) Synaptic targeting by Alzheimer's-related amyloid beta oligomers. J.Neurosci. 24:45, 10191-10200.
LACOR P. N., BUNIEL M. C., FURLOW P. W., CLEMENTE A. S., VELASCO P. T., WOOD M., VIOLA K. L. e KLEIN W. L. (2007) Abeta oligomer-induced aberrations in synapse composition, shape, and density provide a molecular basis for loss of connectivity in Alzheimer's disease. J.Neurosci. 27:4, 796-807.
LAFAY-CHEBASSIER C., PACCALIN M., PAGE G., BARC-PAIN S., PERAULT-POCHAT M. C., GIL R., PRADIER L. e HUGON J. (2005) mTOR/p70S6k signalling
102
alteration by Abeta exposure as well as in APP-PS1 transgenic models and in patients with Alzheimer's disease. J.Neurochem. 94:1, 215-225.
LAMBERT M. P., BARLOW A. K., CHROMY B. A., EDWARDS C., FREED R., LIOSATOS M., MORGAN T. E., ROZOVSKY I., TROMMER B., VIOLA K. L., WALS P., ZHANG C., FINCH C. E., KRAFFT G. A. e KLEIN W. L. (1998) Diffusible, nonfibrillar ligands derived from Abeta1-42 are potent central nervous system neurotoxins. Proc.Natl.Acad.Sci.U.S.A 95:11, 6448-6453.
LAMBERT M. P., VELASCO P. T., CHANG L., VIOLA K. L., FERNANDEZ S., LACOR P. N., KHUON D., GONG Y., BIGIO E. H., SHAW P., DE FELICE F. G., KRAFFT G. A. e KLEIN W. L. (2007) Monoclonal antibodies that target pathological assemblies of Abeta. J.Neurochem. 100:1, 23-35.
LAMONTE B. H., WALLACE K. E., HOLLOWAY B. A., SHELLY S. S., ASCANO J., TOKITO M., VAN W. T., HOWLAND D. S. e HOLZBAUR E. L. (2002) Disruption of dynein/dynactin inhibits axonal transport in motor neurons causing late-onset progressive degeneration. Neuron 34:5, 715-727.
LANZ T. A., CARTER D. B. e MERCHANT K. M. (2003) Dendritic spine loss in the hippocampus of young PDAPP and Tg2576 mice and its prevention by the ApoE2 genotype. Neurobiol.Dis. 13:3, 246-253.
LAU C. G. e ZUKIN R. S. (2007) NMDA receptor trafficking in synaptic plasticity and neuropsychiatric disorders. Nat.Rev.Neurosci. 8:6, 413-426.
LEDO J. H., AZEVEDO E. P., CLARKE J. R., RIBEIRO F. C., FIGUEIREDO C. P., FOGUEL D., DE FELICE F. G. e FERREIRA S. T. (2013) Amyloid-beta oligomers link depressive-like behavior and cognitive deficits in mice. Mol.Psychiatry 18:10, 1053-1054.
LEE H. K., KUMAR P., FU Q., ROSEN K. M. e QUERFURTH H. W. (2009) The insulin/Akt signaling pathway is targeted by intracellular beta-amyloid. Mol.Biol.Cell 20:5, 1533-1544.
LESNE S., KOH M. T., KOTILINEK L., KAYED R., GLABE C. G., YANG A., GALLAGHER M. e ASHE K. H. (2006) A specific amyloid-beta protein assembly in the brain impairs memory. Nature 440:7082, 352-357.
LEVY E., CARMAN M. D., FERNANDEZ-MADRID I. J., POWER M. D., LIEBERBURG I., VAN DUINEN S. G., BOTS G. T., LUYENDIJK W. e FRANGIONE
103
B. (1990) Mutation of the Alzheimer's disease amyloid gene in hereditary cerebral hemorrhage, Dutch type. Science 248:4959, 1124-1126.
LI Y., PERRY T., KINDY M. S., HARVEY B. K., TWEEDIE D., HOLLOWAY H. W., POWERS K., SHEN H., EGAN J. M., SAMBAMURTI K., BROSSI A., LAHIRI D. K., MATTSON M. P., HOFFER B. J., WANG Y. e GREIG N. H. (2009) GLP-1 receptor stimulation preserves primary cortical and dopaminergic neurons in cellular and rodent models of stroke and Parkinsonism. Proc.Natl.Acad.Sci.U.S.A 106:4, 1285-1290.
LIZCANO J. M. e ALESSI D. R. (2002) The insulin signalling pathway. Curr.Biol. 12:7, R236-R238.
LUE L. F., WALKER D. G. e ROGERS J. (2001) Modeling microglial activation in Alzheimer's disease with human postmortem microglial cultures. Neurobiol.Aging 22:6, 945-956.
MA Q. L., YANG F., ROSARIO E. R., UBEDA O. J., BEECH W., GANT D. J., CHEN P. P., HUDSPETH B., CHEN C., ZHAO Y., VINTERS H. V., FRAUTSCHY S. A. e COLE G. M. (2009) Beta-amyloid oligomers induce phosphorylation of tau and inactivation of insulin receptor substrate via c-Jun N-terminal kinase signaling: suppression by omega-3 fatty acids and curcumin. J.Neurosci. 29:28, 9078-9089.
MA T., HOEFFER C. A., CAPETILLO-ZARATE E., YU F., WONG H., LIN M. T., TAMPELLINI D., KLANN E., BLITZER R. D. e GOURAS G. K. (2010) Dysregulation of the mTOR pathway mediates impairment of synaptic plasticity in a mouse model of Alzheimer's disease. PLoS.One. 5:9.
MADADI G., DALVI P. S. e BELSHAM D. D. (2008) Regulation of brain insulin mRNA by glucose and glucagon-like peptide 1. Biochem.Biophys.Res.Commun. 376:4, 694-699.
MASTERS C. L., MULTHAUP G., SIMMS G., POTTGIESSER J., MARTINS R. N. e BEYREUTHER K. (1985) Neuronal origin of a cerebral amyloid: neurofibrillary tangles of Alzheimer's disease contain the same protein as the amyloid of plaque cores and blood vessels. EMBO J. 4:11, 2757-2763.
MATTSON M. P. (2012) Energy intake and exercise as determinants of brain health and vulnerability to injury and disease. Cell Metab 16:6, 706-722.
MATTSON M. P., PERRY T. e GREIG N. H. (2003) Learning from the gut. Nat.Med. 9:9, 1113-1115.
104
MCGEER P. L., ROGERS J. e MCGEER E. G. (2006) Inflammation, anti-inflammatory agents and Alzheimer disease: the last 12 years. J.Alzheimers.Dis. 9:3 Suppl, 271-276.
MCNAY E. C., ONG C. T., MCCRIMMON R. J., CRESSWELL J., BOGAN J. S. e SHERWIN R. S. (2010) Hippocampal memory processes are modulated by insulin and high-fat-induced insulin resistance. Neurobiol.Learn.Mem. 93:4, 546-553.
MCNAY E. C. e RECKNAGEL A. K. (2011) Brain insulin signaling: a key component of cognitive processes and a potential basis for cognitive impairment in type 2 diabetes. Neurobiol.Learn.Mem. 96:3, 432-442.
MINERS J. S., BARUA N., KEHOE P. G., GILL S. e LOVE S. (2011) Abeta-degrading enzymes: potential for treatment of Alzheimer disease. J.Neuropathol.Exp.Neurol. 70:11, 944-959.
MOCHIZUKI A., PETERSON J. W., MUFSON E. J. e TRAPP B. D. (1996) Amyloid load and neural elements in Alzheimer's disease and nondemented individuals with high amyloid plaque density. Exp.Neurol. 142:1, 89-102.
MOLONEY A. M., GRIFFIN R. J., TIMMONS S., O'CONNOR R., RAVID R. e O'NEILL C. (2010) Defects in IGF-1 receptor, insulin receptor and IRS-1/2 in Alzheimer's disease indicate possible resistance to IGF-1 and insulin signalling. Neurobiol.Aging 31:2, 224-243.
MOOLMAN D. L., VITOLO O. V., VONSATTEL J. P. e SHELANSKI M. L. (2004) Dendrite and dendritic spine alterations in Alzheimer models. J.Neurocytol. 33:3, 377-387.
MORAN T. H. e DAILEY M. J. (2009) Minireview: Gut peptides: targets for antiobesity drug development? Endocrinology 150:6, 2526-2530.
MOSTOSLAVSKY R. (2008) DNA repair, insulin signaling and sirtuins: at the crossroads between cancer and aging. Front Biosci. 13, 6966-6990.
MUCKE L., MASLIAH E., YU G. Q., MALLORY M., ROCKENSTEIN E. M., TATSUNO G., HU K., KHOLODENKO D., JOHNSON-WOOD K. e MCCONLOGUE L. (2000) High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J.Neurosci. 20:11, 4050-4058.
105
MULLAN M., CRAWFORD F., AXELMAN K., HOULDEN H., LILIUS L., WINBLAD B. e LANNFELT L. (1992) A pathogenic mutation for probable Alzheimer's disease in the APP gene at the N-terminus of beta-amyloid. Nat.Genet. 1:5, 345-347.
MURTHY S. B., JAWAID A. e SCHULZ P. E. (2008) Diabetes mellitus and dementia: advocating an annual cognitive screening in patients with diabetes mellitus. J.Am.Geriatr.Soc. 56:10, 1976-1977.
NAKAMURA T., FURUHASHI M., LI P., CAO H., TUNCMAN G., SONENBERG N., GORGUN C. Z. e HOTAMISLIGIL G. S. (2010) Double-stranded RNA-dependent protein kinase links pathogen sensing with stress and metabolic homeostasis. Cell 140:3, 338-348.
NIEWIADOMSKA G. e BAKSALERSKA-PAZERA M. (2003) Age-dependent changes in axonal transport and cellular distribution of Tau 1 in the rat basal forebrain neurons. Neuroreport 14:13, 1701-1706.
NOWRANGI M. A., RAO V. e LYKETSOS C. G. (2011) Epidemiology, assessment, and treatment of dementia. Psychiatr.Clin.North Am. 34:2, 275-94, vii.
OTT A., STOLK R. P., HOFMAN A., VAN H. F., GROBBEE D. E. e BRETELER M. M. (1996) Association of diabetes mellitus and dementia: the Rotterdam Study. Diabetologia 39:11, 1392-1397.
OTT V., BENEDICT C., SCHULTES B., BORN J. e HALLSCHMID M. (2012) Intranasal administration of insulin to the brain impacts cognitive function and peripheral metabolism. Diabetes Obes.Metab 14:3, 214-221.
OZES O. N., AKCA H., MAYO L. D., GUSTIN J. A., MAEHAMA T., DIXON J. E. e DONNER D. B. (2001) A phosphatidylinositol 3-kinase/Akt/mTOR pathway mediates and PTEN antagonizes tumor necrosis factor inhibition of insulin signaling through insulin receptor substrate-1. Proc.Natl.Acad.Sci.U.S.A 98:8, 4640-4645.
PARK K. M. e BOWERS W. J. (2010) Tumor necrosis factor-alpha mediated signaling in neuronal homeostasis and dysfunction. Cell Signal. 22:7, 977-983.
PATTI M. E. e KAHN C. R. (1998) The insulin receptor--a critical link in glucose homeostasis and insulin action. J.Basic Clin.Physiol Pharmacol. 9:2-4, 89-109.
PAWSON T. (1995) Protein modules and signalling networks. Nature 373:6515, 573-580.
106
PAWSON T. e SCOTT J. D. (1997) Signaling through scaffold, anchoring, and adaptor proteins. Science 278:5346, 2075-2080.
PERRY V. H., NICOLL J. A. e HOLMES C. (2010) Microglia in neurodegenerative disease. Nat.Rev.Neurol. 6:4, 193-201.
PETERSEN R. C., ROBERTS R. O., KNOPMAN D. S., BOEVE B. F., GEDA Y. E., IVNIK R. J., SMITH G. E. e JACK C. R., Jr. (2009) Mild cognitive impairment: ten years later. Arch.Neurol. 66:12, 1447-1455.
PIKE C. J., CUMMINGS B. J. e COTMAN C. W. (1992) beta-Amyloid induces neuritic dystrophy in vitro: similarities with Alzheimer pathology. Neuroreport 3:9, 769-772.
PIROLA L., JOHNSTON A. M. e VAN O. E. (2004) Modulation of insulin action. Diabetologia 47:2, 170-184.
PLUM L., SCHUBERT M. e BRUNING J. C. (2005) The role of insulin receptor signaling in the brain. Trends Endocrinol.Metab 16:2, 59-65.
PRINZ M., PRILLER J., SISODIA S. S. e RANSOHOFF R. M. (2011) Heterogeneity of CNS myeloid cells and their roles in neurodegeneration. Nat.Neurosci. 14:10, 1227-1235.
RABE S., REICHWALD J., AMMATURO D., DE S. B., SAFTIG P., NEUMANN U. e STAUFENBIEL M. (2011) The Swedish APP mutation alters the effect of genetically reduced BACE1 expression on the APP processing. J.Neurochem. 119:1, 231-239.
RELKIN N. R., SZABO P., ADAMIAK B., BURGUT T., MONTHE C., LENT R. W., YOUNKIN S., YOUNKIN L., SCHIFF R. e WEKSLER M. E. (2009) 18-Month study of intravenous immunoglobulin for treatment of mild Alzheimer disease. Neurobiol.Aging 30:11, 1728-1736.
RICHARDSON J. C., KENDAL C. E., ANDERSON R., PRIEST F., GOWER E., SODEN P., GRAY R., TOPPS S., HOWLETT D. R., LAVENDER D., CLARKE N. J., BARNES J. C., HAWORTH R., STEWART M. G. e RUPNIAK H. T. (2003) Ultrastructural and behavioural changes precede amyloid deposition in a transgenic model of Alzheimer's disease. Neuroscience 122:1, 213-228.
ROBERSON E. D. e MUCKE L. (2006) 100 years and counting: prospects for defeating Alzheimer's disease. Science 314:5800, 781-784.
107
ROSELLI F., TIRARD M., LU J., HUTZLER P., LAMBERTI P., LIVREA P., MORABITO M. e ALMEIDA O. F. (2005) Soluble beta-amyloid1-40 induces NMDA-dependent degradation of postsynaptic density-95 at glutamatergic synapses. J.Neurosci. 25:48, 11061-11070.
RUAN L., KANG Z., PEI G. e LE Y. (2009) Amyloid deposition and inflammation in APPswe/PS1dE9 mouse model of Alzheimer's disease. Curr.Alzheimer Res. 6:6, 531-540.
RUI L., AGUIRRE V., KIM J. K., SHULMAN G. I., LEE A., CORBOULD A., DUNAIF A. e WHITE M. F. (2001) Insulin/IGF-1 and TNF-alpha stimulate phosphorylation of IRS-1 at inhibitory Ser307 via distinct pathways. J.Clin.Invest 107:2, 181-189.
RYAN G. J. e HARDY Y. (2011) Liraglutide: once-daily GLP-1 agonist for the treatment of type 2 diabetes. J.Clin.Pharm.Ther. 36:3, 260-274.
RYU B. R., KO H. W., JOU I., NOH J. S. e GWAG B. J. (1999) Phosphatidylinositol 3-kinase-mediated regulation of neuronal apoptosis and necrosis by insulin and IGF-I. J.Neurobiol. 39:4, 536-546.
SALTIEL A. R. e KAHN C. R. (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414:6865, 799-806.
SARAIVA L. M., SEIXAS DA SILVA G. S., GALINA A., DA-SILVA W. S., KLEIN W. L., FERREIRA S. T. e DE FELICE F. G. (2010) Amyloid-beta triggers the release of neuronal hexokinase 1 from mitochondria. PLoS.One. 5:12, e15230.
SAVAGE D. B. e SEMPLE R. K. (2010) Recent insights into fatty liver, metabolic dyslipidaemia and their links to insulin resistance. Curr.Opin.Lipidol. 21:4, 329-336.
SAVONENKO A., XU G. M., MELNIKOVA T., MORTON J. L., GONZALES V., WONG M. P., PRICE D. L., TANG F., MARKOWSKA A. L. e BORCHELT D. R. (2005) Episodic-like memory deficits in the APPswe/PS1dE9 mouse model of Alzheimer's disease: relationships to beta-amyloid deposition and neurotransmitter abnormalities. Neurobiol.Dis. 18:3, 602-617.
SCHEFF S. W. e PRICE D. A. (2003) Synaptic pathology in Alzheimer's disease: a review of ultrastructural studies. Neurobiol.Aging 24:8, 1029-1046.
108
SCHEIBEL M. E., LINDSAY R. D., TOMIYASU U. e SCHEIBEL A. B. (1975) Progressive dendritic changes in aging human cortex. Exp.Neurol. 47:3, 392-403.
SCHRIJVERS E. M., WITTEMAN J. C., SIJBRANDS E. J., HOFMAN A., KOUDSTAAL P. J. e BRETELER M. M. (2010) Insulin metabolism and the risk of Alzheimer disease: the Rotterdam Study. Neurology 75:22, 1982-1987.
SCHROER T. A. (2004) Dynactin. Annu.Rev.Cell Dev.Biol. 20, 759-779.
SELKOE D. J. (2000) The genetics and molecular pathology of Alzheimer's disease: roles of amyloid and the presenilins. Neurol.Clin. 18:4, 903-922.
SELKOE D. J. (2004) Alzheimer disease: mechanistic understanding predicts novel therapies. Ann.Intern.Med. 140:8, 627-638.
SELKOE D. J. (2011) Resolving controversies on the path to Alzheimer's therapeutics. Nat.Med. 17:9, 1060-1065.
SELKOE D. J. (2012) Preventing Alzheimer's disease. Science 337:6101, 1488-1492.
SESHADRI S., BEISER A., KELLY-HAYES M., KASE C. S., AU R., KANNEL W. B. e WOLF P. A. (2006) The lifetime risk of stroke: estimates from the Framingham Study. Stroke 37:2, 345-350.
SHANKAR G. M., LI S., MEHTA T. H., GARCIA-MUNOZ A., SHEPARDSON N. E., SMITH I., BRETT F. M., FARRELL M. A., ROWAN M. J., LEMERE C. A., REGAN C. M., WALSH D. M., SABATINI B. L. e SELKOE D. J. (2008) Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat.Med. 14:8, 837-842.
SHIM K. S. e LUBEC G. (2002) Drebrin, a dendritic spine protein, is manifold decreased in brains of patients with Alzheimer's disease and Down syndrome. Neurosci.Lett. 324:3, 209-212.
SLOANE J. A., PIETROPAOLO M. F., ROSENE D. L., MOSS M. B., PETERS A., KEMPER T. e ABRAHAM C. R. (1997) Lack of correlation between plaque burden and cognition in the aged monkey. Acta Neuropathol. 94:5, 471-478.
109
SNYDER S. W., LADROR U. S., WADE W. S., WANG G. T., BARRETT L. W., MATAYOSHI E. D., HUFFAKER H. J., KRAFFT G. A. e HOLZMAN T. F. (1994) Amyloid-beta aggregation: selective inhibition of aggregation in mixtures of amyloid with different chain lengths. Biophys.J. 67:3, 1216-1228.
SOUSA-NUNES R., YEE L. L. e GOULD A. P. (2011) Fat cells reactivate quiescent neuroblasts via TOR and glial insulin relays in Drosophila. Nature 471:7339, 508-512.
SPILMAN P., PODLUTSKAYA N., HART M. J., DEBNATH J., GOROSTIZA O., BREDESEN D., RICHARDSON A., STRONG R. e GALVAN V. (2010) Inhibition of mTOR by rapamycin abolishes cognitive deficits and reduces amyloid-beta levels in a mouse model of Alzheimer's disease. PLoS.One. 5:4, e9979.
SPIRES T. L., MEYER-LUEHMANN M., STERN E. A., MCLEAN P. J., SKOCH J., NGUYEN P. T., BACSKAI B. J. e HYMAN B. T. (2005) Dendritic spine abnormalities in amyloid precursor protein transgenic mice demonstrated by gene transfer and intravital multiphoton microscopy. J.Neurosci. 25:31, 7278-7287.
STAMER K., VOGEL R., THIES E., MANDELKOW E. e MANDELKOW E. M. (2002) Tau blocks traffic of organelles, neurofilaments, and APP vesicles in neurons and enhances oxidative stress. J.Cell Biol. 156:6, 1051-1063.
STEEN E., TERRY B. M., RIVERA E. J., CANNON J. L., NEELY T. R., TAVARES R., XU X. J., WANDS J. R. e DE LA MONTE S. M. (2005) Impaired insulin and insulin-like growth factor expression and signaling mechanisms in Alzheimer's disease--is this type 3 diabetes? J.Alzheimers.Dis. 7:1, 63-80.
STOKIN G. B. e GOLDSTEIN L. S. (2006) Axonal transport and Alzheimer's disease. Annu.Rev.Biochem. 75, 607-627.
STOKIN G. B., LILLO C., FALZONE T. L., BRUSCH R. G., ROCKENSTEIN E., MOUNT S. L., RAMAN R., DAVIES P., MASLIAH E., WILLIAMS D. S. e GOLDSTEIN L. S. (2005) Axonopathy and transport deficits early in the pathogenesis of Alzheimer's disease. Science 307:5713, 1282-1288.
SWARDFAGER W., LANCTOT K., ROTHENBURG L., WONG A., CAPPELL J. e HERRMANN N. (2010) A meta-analysis of cytokines in Alzheimer's disease. Biol.Psychiatry 68:10, 930-941.
110
TAGUCHI A., WARTSCHOW L. M. e WHITE M. F. (2007) Brain IRS2 signaling coordinates life span and nutrient homeostasis. Science 317:5836, 369-372.
TAGUCHI A. e WHITE M. F. (2008) Insulin-like signaling, nutrient homeostasis, and life span. Annu.Rev.Physiol 70, 191-212.
TAKEDA S., SATO N., UCHIO-YAMADA K., SAWADA K., KUNIEDA T., TAKEUCHI D., KURINAMI H., SHINOHARA M., RAKUGI H. e MORISHITA R. (2010) Diabetes-accelerated memory dysfunction via cerebrovascular inflammation and Abeta deposition in an Alzheimer mouse model with diabetes. Proc.Natl.Acad.Sci.U.S.A 107:15, 7036-7041.
TALBOT K., EIDEM W. L., TINSLEY C. L., BENSON M. A., THOMPSON E. W., SMITH R. J., HAHN C. G., SIEGEL S. J., TROJANOWSKI J. Q., GUR R. E., BLAKE D. J. e ARNOLD S. E. (2004) Dysbindin-1 is reduced in intrinsic, glutamatergic terminals of the hippocampal formation in schizophrenia. J.Clin.Invest 113:9, 1353-1363.
TANAKA M., SAWADA M., YOSHIDA S., HANAOKA F. e MARUNOUCHI T. (1995) Insulin prevents apoptosis of external granular layer neurons in rat cerebellar slice cultures. Neurosci.Lett. 199:1, 37-40.
TANIGUCHI C. M., EMANUELLI B. e KAHN C. R. (2006) Critical nodes in signalling pathways: insights into insulin action. Nat.Rev.Mol.Cell Biol. 7:2, 85-96.
TANTI J. F. e JAGER J. (2009) Cellular mechanisms of insulin resistance: role of stress-regulated serine kinases and insulin receptor substrates (IRS) serine phosphorylation. Curr.Opin.Pharmacol. 9:6, 753-762.
TARKOWSKI E., ANDREASEN N., TARKOWSKI A. e BLENNOW K. (2003) Intrathecal inflammation precedes development of Alzheimer's disease. J.Neurol.Neurosurg.Psychiatry 74:9, 1200-1205.
TERRY R. D. (1996) The pathogenesis of Alzheimer disease: an alternative to the amyloid hypothesis. J.Neuropathol.Exp.Neurol. 55:10, 1023-1025.
THAL D. R., CAPETILLO-ZARATE E., DEL T. K. e BRAAK H. (2006) The development of amyloid beta protein deposits in the aged brain. Sci.Aging Knowledge.Environ. 2006:6, re1.
111
TOBINICK E. (2007) Perispinal etanercept for treatment of Alzheimer's disease. Curr.Alzheimer Res. 4:5, 550-552.
TOBINICK E. (2009) Perispinal etanercept for neuroinflammatory disorders. Drug Discov.Today 14:3-4, 168-177.
TOWNSEND M., MEHTA T. e SELKOE D. J. (2007) Soluble Abeta inhibits specific signal transduction cascades common to the insulin receptor pathway. J.Biol.Chem. 282:46, 33305-33312.
TROJANOWSKI J. Q., SMITH A. B., HURYN D. e LEE V. M. (2005) Microtubule-stabilising drugs for therapy of Alzheimer's disease and other neurodegenerative disorders with axonal transport impairments. Expert.Opin.Pharmacother. 6:5, 683-686.
TRUSHINA E., DYER R. B., BADGER J. D., URE D., EIDE L., TRAN D. D., VRIEZE B. T., LEGENDRE-GUILLEMIN V., MCPHERSON P. S., MANDAVILLI B. S., VAN H. B., ZEITLIN S., MCNIVEN M., AEBERSOLD R., HAYDEN M., PARISI J. E., SEEBERG E., DRAGATSIS I., DOYLE K., BENDER A., CHACKO C. e MCMURRAY C. T. (2004) Mutant huntingtin impairs axonal trafficking in mammalian neurons in vivo and in vitro. Mol.Cell Biol. 24:18, 8195-8209.
UCHIDA A., TASHIRO T., KOMIYA Y., YORIFUJI H., KISHIMOTO T. e HISANAGA S. (2004) Morphological and biochemical changes of neurofilaments in aged rat sciatic nerve axons. J.Neurochem. 88:3, 735-745.
UCHIDA T., MYERS M. G., Jr. e WHITE M. F. (2000) IRS-4 mediates protein kinase B signaling during insulin stimulation without promoting antiapoptosis. Mol.Cell Biol. 20:1, 126-138.
ULLRICH A., BELL J. R., CHEN E. Y., HERRERA R., PETRUZZELLI L. M., DULL T. J., GRAY A., COUSSENS L., LIAO Y. C., TSUBOKAWA M. e . (1985) Human insulin receptor and its relationship to the tyrosine kinase family of oncogenes. Nature 313:6005, 756-761.
VALLERIE S. N. e HOTAMISLIGIL G. S. (2010) The role of JNK proteins in metabolism. Sci.Transl.Med. 2:60, 60rv5.
VAN DER HEIDE L. P., KAMAL A., ARTOLA A., GISPEN W. H. e RAMAKERS G. M. (2005) Insulin modulates hippocampal activity-dependent synaptic plasticity in a N-methyl-
112
d-aspartate receptor and phosphatidyl-inositol-3-kinase-dependent manner. J.Neurochem. 94:4, 1158-1166.
VAN DER HEIDE L. P., RAMAKERS G. M. e SMIDT M. P. (2006) Insulin signaling in the central nervous system: learning to survive. Prog.Neurobiol. 79:4, 205-221.
VAN ES M. A. e VAN DEN BERG L. H. (2009) Alzheimer's disease beyond APOE. Nat.Genet. 41:10, 1047-1048.
VERMA G. e DATTA M. (2010) IL-1beta induces ER stress in a JNK dependent manner that determines cell death in human pancreatic epithelial MIA PaCa-2 cells. Apoptosis. 15:7, 864-876.
VILSBOLL T., KRARUP T., MADSBAD S. e HOLST J. J. (2003) Both GLP-1 and GIP are insulinotropic at basal and postprandial glucose levels and contribute nearly equally to the incretin effect of a meal in healthy subjects. Regul.Pept. 114:2-3, 115-121.
VOLIANSKIS A., KOSTNER R., MOLGAARD M., HASS S. e JENSEN M. S. (2010) Episodic memory deficits are not related to altered glutamatergic synaptic transmission and plasticity in the CA1 hippocampus of the APPswe/PS1deltaE9-deleted transgenic mice model of ss-amyloidosis. Neurobiol.Aging 31:7, 1173-1187.
WALSH D. M., KLYUBIN I., FADEEVA J. V., CULLEN W. K., ANWYL R., WOLFE M. S., ROWAN M. J. e SELKOE D. J. (2002) Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature 416:6880, 535-539.
WALSH D. M. e SELKOE D. J. (2004) Deciphering the molecular basis of memory failure in Alzheimer's disease. Neuron 44:1, 181-193.
WANG Q., ROWAN M. J. e ANWYL R. (2004) Beta-amyloid-mediated inhibition of NMDA receptor-dependent long-term potentiation induction involves activation of microglia and stimulation of inducible nitric oxide synthase and superoxide. J.Neurosci. 24:27, 6049-6056.
WANG X., ZHENG W., XIE J. W., WANG T., WANG S. L., TENG W. P. e WANG Z. Y. (2010) Insulin deficiency exacerbates cerebral amyloidosis and behavioral deficits in an Alzheimer transgenic mouse model. Mol.Neurodegener. 5, 46.
113
WELANDER H., FRANBERG J., GRAFF C., SUNDSTROM E., WINBLAD B. e TJERNBERG L. O. (2009) Abeta43 is more frequent than Abeta40 in amyloid plaque cores from Alzheimer disease brains. J.Neurochem. 110:2, 697-706.
WELLEN K. E. e HOTAMISLIGIL G. S. (2005) Inflammation, stress, and diabetes. J.Clin.Invest 115:5, 1111-1119.
WHITE M. F. (2002) IRS proteins and the common path to diabetes. Am.J.Physiol Endocrinol.Metab 283:3, E413-E422.
WHITE M. F. (2003) Insulin signaling in health and disease. Science 302:5651, 1710-1711.
WHITE M. F. (2006) Regulating insulin signaling and beta-cell function through IRS proteins. Can.J.Physiol Pharmacol. 84:7, 725-737.
WHITE M. F. e YENUSH L. (1998) The IRS-signaling system: a network of docking proteins that mediate insulin and cytokine action. Curr.Top.Microbiol.Immunol. 228, 179-208.
WIEDMANN M. W., MOSSNER J., BAERWALD C. e PIERER M. (2009) TNF alpha inhibition as treatment modality for certain rheumatologic and gastrointestinal diseases. Endocr.Metab Immune.Disord.Drug Targets. 9:3, 295-314.
WOODS S. C., LOTTER E. C., MCKAY L. D. e PORTE D., Jr. (1979) Chronic intracerebroventricular infusion of insulin reduces food intake and body weight of baboons. Nature 282:5738, 503-505.
XU H., BARNES G. T., YANG Q., TAN G., YANG D., CHOU C. J., SOLE J., NICHOLS A., ROSS J. S., TARTAGLIA L. A. e CHEN H. (2003) Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J.Clin.Invest 112:12, 1821-1830.
YUSTA B., BAGGIO L. L., ESTALL J. L., KOEHLER J. A., HOLLAND D. P., LI H., PIPELEERS D., LING Z. e DRUCKER D. J. (2006) GLP-1 receptor activation improves beta cell function and survival following induction of endoplasmic reticulum stress. Cell Metab 4:5, 391-406.
114
ZHANG H., MA Q., ZHANG Y. W. e XU H. (2012) Proteolytic processing of Alzheimer's beta-amyloid precursor protein. J.Neurochem. 120 Suppl 1, 9-21.
ZHAO W. Q. e ALKON D. L. (2001) Role of insulin and insulin receptor in learning and memory. Mol.Cell Endocrinol. 177:1-2, 125-134.
ZHAO W. Q., CHEN H., QUON M. J. e ALKON D. L. (2004) Insulin and the insulin receptor in experimental models of learning and memory. Eur.J.Pharmacol. 490:1-3, 71-81.
ZHAO W. Q., DE FELICE F. G., FERNANDEZ S., CHEN H., LAMBERT M. P., QUON M. J., KRAFFT G. A. e KLEIN W. L. (2008) Amyloid beta oligomers induce impairment of neuronal insulin receptors. FASEB J. 22:1, 246-260.
ZICK Y. (2005) Ser/Thr phosphorylation of IRS proteins: a molecular basis for insulin resistance. Sci.STKE. 2005:268, e4.
115
ANEXOS
Inflammation, defective insulin signaling, and neuronal dysfunction inAlzheimer’s disease
Sergio T. Ferreira*, Julia R. Clarke, Theresa R. Bomfim, Fernanda G. De FeliceInstitute of Medical Biochemistry Leopoldo de Meis, Federal University of Rio de Janeiro, Rio de Janeiro, Brazil
Abstract A link between Alzheimer’s disease (AD) and metabolic disorders has been established, withpatients with type 2 diabetes at increased risk of developing AD and vice versa. The incidence ofmetabolic disorders, including insulin resistance and type 2 diabetes is increasing at alarming ratesworldwide, primarily as a result of poor lifestyle habits. In parallel, as the world population ages,the prevalence of AD, the most common form of dementia in the elderly, also increases. In additionto their epidemiologic and clinical association, mounting recent evidence indicates shared mecha-nisms of pathogenesis between metabolic disorders and AD. We discuss the concept that peripheraland central nervous system inflammation link the pathogenesis of AD and metabolic diseases. Wealso explore the contribution of brain inflammation to defective insulin signaling and neuronaldysfunction. Last, we review recent evidence indicating that targeting neuroinflammation mayprovide novel therapeutic avenues for AD.! 2014 The Alzheimer’s Association. All rights reserved.
Keywords: Inflammation; Alzheimer’s disease; Diabetes; Obesity; Insulin signaling; Aging
1. Introduction
Inflammation is part of the body’s defense mechanismsagainst multiple threats, including infections and injury.Inflammation is complex and involves both soluble factorsand specialized cells that are mobilized to neutralize andfight threats to restore normal body physiology [1]. Similarinflammatory processes are thought to occur in thebrain and in peripheral tissues. In the brain, glial cells,especially astrocytes and microglia, undergo activationunder pro-inflammatory conditions. In a process similarto that described for peripheral immune cells, activatedmicroglia in the central nervous system (CNS) increaseproduction of inflammatory cytokines. Both in the brainand in peripheral tissues, unchecked or chronic inflamma-tion becomes deleterious, leading to progressive tissuedamage in degenerative diseases.
Inflammation plays critical roles in the pathogenesis ofAlzheimer’s disease (AD) and metabolic diseases, including
type 2 diabetes. These disorders are chronic, debilitating,and extremely costly for health programs in developed anddeveloping countries. Since the Rotterdam study waspublished, suggesting that diabetes almost doubles the riskof AD [2], a number of clinical and epidemiologic studieshave strengthened the link between these diseases [3–6].
Several studies have established further the presence ofinflammatory markers in the AD brain, including elevatedlevels of cytokines/chemokines and gliosis (notably micro-gliosis) in damaged regions [7–10]. A recent meta-analysisshowed that blood concentrations of several inflammatorymediators, including tumor necrosis factor-alpha (TNF-a),interleukin (IL) 6, and IL-1b are increased in AD patients[11].
Overproduction of pro-inflammatory cytokines, includingTNF-a, is a key feature of the pathophysiology of metabolicdisorders. TNF-a is overexpressed in adipose tissue of obeseindividuals [12], and landmark studies by Hotamisligil andcolleagues [12,13] demonstrated that elevated TNF-alevels cause peripheral insulin resistance. Interestingly,brain inflammation has recently been proposed to underliedefective neuronal insulin signaling in AD [14]. Severalpathological features, including impaired insulin signaling
The authors have no conflicts of interest to report.*Corresponding author. Tel.: 155 21 2562 6790; Fax: +55 21 2270-
8647.E-mail address: [email protected]
1552-5260/$ - see front matter ! 2014 The Alzheimer’s Association. All rights reserved.http://dx.doi.org/10.1016/j.jalz.2013.12.010
Alzheimer’s & Dementia 10 (2014) S76–S83
and inflammation, appear to be shared by patients withdiabetes and patients with AD. Therefore, it is likely thatmechanisms analogous to those that account for peripheralinsulin resistance in type 2 diabetes underlie impairedbrain insulin signaling and neuronal dysfunction in AD.In the following sections, we discuss molecular/cellularmechanisms underlying defective brain insulin signalingand neuronal dysfunction in AD, with emphasis on evidencethat AD and diabetes share common inflammatory signalingpathways.
2. Elevated TNF-a and activation of stress kinasesunderlie defective neuronal insulin signaling in AD
The molecular events and pathways leading to disruptedbrain insulin signaling in AD have only recently begun to beunraveled. Insulin and insulin-like growth factor receptorsbelong to the tyrosine kinase receptor family and signalvia insulin receptor substrate (IRS) proteins. These areclosely related, high-molecular weight proteins namedIRS-1 through IRS-4, of which IRS-1 and IRS-2 are themost important and best studied [15,16]. Physiologically,activation of insulin receptors (IRs) in peripheral tissuesstimulates tyrosine phosphorylation of IRS to initiateintracellular signaling pathways. In type 2 diabetes,elevated TNF-a levels trigger serine phosphorylation ofIRS-1 by stress kinases [13,17,18], which interferes withits ability to engage in IR signaling and blocks theintracellular actions of insulin [19–22]. Underlining itsrole in disrupted insulin signaling, blockade of TNF-a inobese mouse models results in improved insulin sensitivityand glucose homeostasis [23,24].
In the brain, TNF-a is secreted mainly by microglial cellsin response to trauma, infection, or abnormal accumulationof protein aggregates [25]. TNF-a levels are elevated inAD cerebrospinal fluid and AD brain microvessels [26,27],as well as in the brain of transgenic mouse models of AD[28,29]. Initial evidence that impaired neuronal insulinsignaling in AD is linked to pro-inflammatory signalingcame from the finding that soluble oligomers of theamyloid-b (Ab) peptide—synaptotoxins that accumulatein AD [30,31]—cause IRS-1 inhibition through TNF-aactivation [14]. In fact, IRS-1 phosphoserine triggeredby Ab oligomers in hippocampal neurons is blocked byinfliximab, a TNF-a neutralizing antibody [14].
Ab oligomers have been shown to instigate removal ofIRs from the membranes of neuronal processes [32,33]and to cause defective insulin signaling (revealed byincreased serine phosphorylation and reduced tyrosinephosphorylation of IRS-1) in postmortem AD brains andin several experimental models of AD [14,34,35]. Insulinsignaling in the CNS promotes neuronal survivaland regulates key processes underlying learning andmemory, including synapse density, dendritic plasticity,and circuit function [36–38]. Thus, the induction of pro-inflammatory pathways and ensuing defective insulin
signaling instigated by Ab oligomers are thought to belinked to neuronal dysfunction in AD.
c-Jun N-terminal kinase (JNK) is the major intracellularstress kinase linking TNF-a to inhibitory serine phosphory-lation of IRS-1 in type 2 diabetes [13,20], and activated JNK(pJNK) is also a feature of human obesity [39–41]. Aboligomer-induced activation of JNK was recently proposedto participate in AD pathology. AD brains exhibit elevatedlevels of pJNK [14,35], and increased pJNK has beendemonstrated in hippocampi of a transgenic mouse modelof AD and in cynomolgus monkeys that receivedintracerebral infusions of Ab oligomers [14].
IkBa kinase (IKK), another stress kinase activated byTNF-a in peripheral insulin resistance [42], also mediatesAb oligomer-induced neuronal IRS-1 inhibition [14]. Ithas now been established that overnutrition induces aninflammatory response in peripheral metabolic tissues.This form of metabolic inflammation, or “metaflammation,”as proposed by Calay and Hotamisligil [43], causesmetabolic defects that underlie type 2 diabetes and obesity[44,45]. In this context, IKK has been identified as a targetfor anti-inflammatory therapy in obesity-associated type 2diabetes [46]. Positive results were obtained in obese micetreated with pharmacological inhibitors of IKK [47,48],providing preclinical support to clinical trials aiming toassess the potential benefit of salsalate, an inhibitor ofIKK, to type 2 diabetes patients [49]. The recently estab-lished involvement of IKK in IRS-1 inhibition in AD pro-vides additional evidence for a close parallelism betweeninflammation-associated defective brain insulin signalingin AD and chronic inflammation-induced insulin resistancein peripheral tissues. Additional studies aiming to explorethe role of IKK in neuronal dysfunction are warranted andmay bring novel clues on mechanisms underlying AD pa-thology.
The double-stranded RNA-dependent protein kinase(PKR), originally identified as a pathogen sensor and a regu-lator of the innate immune response against viral infectionsin higher eukaryotes [50], can regulate or act in conjunctionwith major inflammatory kinases/signaling pathwaysimplicated in metabolic homeostasis, including JNKand IKK [51–53]. Interestingly, PKR is involved in Aboligomer-induced neuronal IRS-1 inhibition [14], rein-forcing the hypothesis that common mechanisms underlieperipheral insulin resistance in type 2 diabetes and impairedbrain insulin signaling in AD.
Current evidence thus indicates that pro-inflammatoryTNF-a signaling and activation of stress-sensitive kinasesplay a key role in inducing IRS-1 inhibition and neuronaldysfunction in AD (Fig. 1).
3. Possible links between peripheral and CNSinflammation
Inflammation in AD has been associated primarily withactivation of CNS-resident microglia induced by Ab
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83 S77
aggregates [55]. Increased brain levels of pro-inflammatorycytokines can lead to several pathological features of AD.Cytokines have been associated with increased tauphosphorylation and decreased synaptophysin levels,establishing their roles in cytoskeletal and synapticalteration in AD [56,57]. Targeting the increasedcirculating levels of IL-1b with a neutralizing antibody hasbeen shown to reduce the activity of several tau kinasesand levels of phosphorylated tau (p-tau), and also toreduce the load of oligomeric and fibrillar Ab in brains oftriple-transgenic AD mice (3xTg) [58]. Interestingly, treat-ment with a drug targeting the p38 mitogen-activated proteinkinase pathway [59] was shown recently to normalize levelsof pro-inflammatory cytokines and to attenuate synaptic pro-tein loss and impaired synaptic plasticity in AD mousemodels [60].
In addition, the clinical association between type 2diabetes and AD has led to the hypothesis that periphery-derived pro-inflammatory molecules could also influencepathogenesis in the Central Nervous System (CNS)(Fig. 1). Adipose tissue inflammation is one of the majortraits of diabetes and obesity [61,62], and both adipocytesand adipose-resident macrophages may participate in a
crosstalk between periphery and CNS. In obese patients, ad-ipocytes react by producing pro-inflammatory cytokines,adipokines, and chemokines, whereas resident macrophagesundergo a phenotypic change to a so-called M1, classically-activated pro-inflammatory state [63]. This leads toincreased TNF-a, IL-1b, and IL-6 production, all of whichcan cross the blood–brain barrier (BBB) [64]. Therefore,adipose-derived inflammatory mediators could be an impor-tant addition to cytokines produced by CNS-resident micro-glia in triggering brain inflammation.
Fat-derived hormones, such as adiponectin and leptin,have been associated with AD and could play a role inconnecting peripheral and central pathogenic mechanisms.Adiponectin, derived from visceral fat, helps sensitize thebody to insulin by acting on receptors that are distributedubiquitously, including the brain [65–68]. Plasmaadiponectin levels are decreased in animal models ofobesity and in obese patients [69–71]. Plasma andcerebrospinal fluid levels of adiponectin show a positivecorrelation [72] and, intriguingly, recent studies foundincreased levels of this adipokine in patients with mildcognitive impairment and with AD [72,73]. It will beinteresting to determine the precise role, if any, of
Fig. 1. Peripheral inflammatory mediators contribute to brain inflammation, neuronal insulin resistance, and neuronal dysfunction in Alzheimer’s disease.Inflamm-aging [54], metaflammation [43] (as seen in obesity-related metabolic disorders, including type 2 diabetes and insulin resistance), and peripheralinfection/inflammation (caused by pathogens or systemic inflammatory disorders) give rise to states of chronic, low-grade systemic inflammation, leadingto overproduction of pro-inflammatory cytokines, such as tumor necrosis factor-a (TNF-a), interleukin (IL) 1b, and IL-6. Elevated levels of adipokinesmay also link peripheral and central nervous system (CNS) inflammation in obesity. Peripheral inflammatory mediators cross the blood–brain barrier and,in conjunction withmediators produced by activatedmicroglia, may lead to CNS inflammation. Activation of neuronal cytokine receptors (e.g., TNF-a receptor)induces aberrant activation of stress kinases (c-Jun N-terminal kinase [JNK], IkBa kinase [IKK], and double-stranded RNA-dependent protein kinase [PKR]),which phosphorylate insulin receptor substrate 1 (IRS-1) at serine residues and inhibit insulin-induced physiological tyrosine phosphorylation of IRS-1.This interferes with the ability of IRS-1 to engage in insulin signaling and blocks the intracellular actions of insulin.
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83S78
adiponectin in impaired neuronal insulin signaling andneuronal dysfunction in AD.
Leptin was found to reduce Ab generation and tauphosphorylation in vitro [74,75], and leptin replacementtherapy induces hippocampal neurogenesis [76] and im-proves cognitive performance [74] in transgenic models ofAD. Initially described for its role in satiety and long-termbody weight maintenance, leptin has recently been proposedto regulate cognition, axonal growth, and synaptogenesis inextrahypothalamic regions [77]. Lower plasma levels ofleptin have been associated with a fourfold increased risk ofdevelopment of AD in a 12-year follow-up period comparedwith patients in whom leptin levels were greater [78].
Dyslipidemia is another important trait of metabolicdisorders. Cholesterol- and sphingolipid-enriched cellmembrane domains, called lipid rafts, appear to be preferen-tial sites for Ab generation. In these microdomains, amyloidprecursor protein is cleaved preferentially through theamyloidogenic pathway [79–81]. Particular types ofsphingolipids, namely ceramide and its metabolites, causeinflammation [82,83], and have been increasinglyassociated with type 2 diabetes [84]. Peripherally generatedceramides can cross the BBB [85] and thus could contributeto AD pathogenesis in two ways: (i) by changing themicroenvironment of lipid rafts, thereby favoring Abgeneration, and/or (ii) by inducing central inflammationand disruption in neuronal insulin signaling [84].
Preclinical and clinical observations are accumulatingthat support the notion that peripheral inflammatorymediators link peripheral and central events in metabolicdyshomeostasis and AD. Novel findings in this area couldpotentially bring about advances for patients with type 2diabetes and patients with AD, allowing for improvedprevention strategies for the former and raising hopes ofnovel therapeutic approaches for the latter. As pointed outrecently, available evidence indicates that a healthy lifestyleand long-term metabolic control are to be encouraged,especially so for diabetic and obese patients, as a preventivemeasure to reduce the risk of AD [86,87].
4. Aging and other general causes of inflammation
Aging is the single most important risk factor for AD. Theconcept of “inflamm-aging” was introduced by ClaudioFranceschi to define changes in the immune system thataccompany physiological aging, leading to chronic systemicinflammation [54,88]. Inflammatory dyshomeostasis inaging can result from loss of control over finely tunedlevels of pro- and anti-inflammatory cytokines, or as aconsequence of the incapacity to restore equilibrium afterit is perturbed by external factors. Whatever the underlyingcauses, they can lead to a chronic state of low-gradeinflammation [89]. Interestingly, it has been proposed thatinflamm-aging is a result of lifetime exposure to acute andchronic infections [90], with human longevity associatedat least in part with an increased capacity to maintain a
inflammatory response at low levels [91]. Nevertheless, apro-inflammatory profile has also been described incentenarians [90]. Increased levels of pro-inflammatorycytokines and markers, such as IL-1b, IL-6, TNF-a, andC-reactive protein [89], have been reported in “normal”aging, but it is not clear whether this is a cause or aconsequence of aging. Inflammation, or rather the defectiveability to maintain low inflammation levels as one ages, maycontribute to the onset of AD (Fig. 1).
Additional conditions in which low-grade inflammationcan be maintained throughout a period of life includerecurrent or persistent infections (Fig. 1), and it is temptingto speculate that chronically elevated peripheral inflamma-tory mediators could be associated with acceleratedneuronal dysfunction and cognitive decline, or predisposeto earlier onset of AD [86]. Significantly, type 2 diabetesinduces changes in BBB permeability [92], and postmortemanalysis of diabetic AD brains showed increased levels ofIL-6 compared with nondiabetic AD brains [93]. Moreover,the BBB of a transgenic mouse model of AD has beenreported to be more permeable to peripheral inflammatorycytokines [94]. These findings raise the possibility that ADbrains could be more susceptible to changes in peripheralinflammatory dyshomeostasis.
5. Anti-inflammatory therapies for AD?
Nonsteroidal anti-inflammatory drugs (NSAIDs) are aheterogeneous family of cyclooxygenase (COX) inhibitors.Their therapeutic outcomes vary according to theirspecificity toward the two known isoforms of the enzyme,COX-1 and COX-2 [95]. Early reports on patients treatedchronically with anti-inflammatory drugs for rheumatoidarthritis or leprosy [96,97] found that a 2-year treatmentwith NSAIDs reduced significantly the risk of AD later inlife [98], and that clinical benefit increased with longerperiods of treatment [99]. Similar results were reported forpatients using aspirin [99] or combined NSAID/steroidtherapy [100]. On the other hand, subsequent studies failedto find a correlation between NSAID use and AD risk[101,102]. Intriguingly, considerable variability was foundeven among studies that showed beneficial actions ofNSAIDs, possibly reflecting differences in dosage, periodof treatment, and patient age. Benefits were observedwhen anti-inflammatory drugs were used well beforethe onset of dementia [103] and might be limited to apolipo-protein E4-carrying patients [104].
Results from the observational studies described hereencouraged the search for molecular mechanisms that couldexplain the positive effects of NSAIDs in delaying/prevent-ing AD. Interestingly, certain NSAIDs, such as ibuprofen,indomethacin, and sulindac sulfide, were shown to decreaseAb42 production by up to 80% in cultured cells, apparentlyvia a COX-independent mechanism [105]. Mice overex-pressing amyloid precursor protein and treated withibuprofen also showed a significant reduction in cortical
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83 S79
amyloid plaque load along with reduced microglial activa-tion [106]. Neurons treated with COX-1 preferential inhibi-tors, such as ibuprofen and aspirin, were more resistant to Abtoxicity than neurons treated with COX-2-specific inhibitors[107]. In line with this finding, Kotilinek and colleagues[108] reported improved synaptic plasticity and memoryformation in AD transgenic mice treated with COX-2- butnot COX-1-selective inhibitors.
Despite the initial optimism generated by these observa-tions, randomized clinical trials provided disappointingresults that did not support disease-modifying or beneficialactions of NSAIDs in AD [109–114]. As suggestedpreviously [103], such trials might have failed in findingpositive effects of NSAIDs for one or more of the followingreasons: (i) most trials tested NSAIDs for treatment ofclinically established AD, whereas epidemiologic datasupported a positive effect of anti-inflammatory agentsbefore clinical onset of symptoms; and (ii) beneficial effectsmay be specific to anti-inflammatory drugs capable ofreducing Ab levels (the so-called selective Ab-loweringagents). Thus, general testing of several members of thelarge NSAID family may have generated conflicting results.
Renewed hopes for an effective AD treatment based onanti-inflammatory therapy came from a report that perispinaladministration of etanercept, an anti-TNF-a fusion protein,improved cognitive performance of patients with AD in a6-month pilot study [115], followed by another report onrapid cognitive improvement (within minutes) on etanerceptadministration to one patient with late-onset AD [116].Despite their possible significance, additional clinicalstudies using larger cohorts and patients at different stagesof the disease are needed to validate these initial findings.In this regard, two clinical trials are currently under way[49] to investigate the possible benefit of etanercept to treatmild/moderate AD.
Anti-TNF-a strategies for AD have received furthersupport from experimental findings using the neutralizingantibody infliximab. Intracerebroventricular infusion ofinfliximab in AD transgenic mice reduced the number ofamyloid plaques and the levels of p-tau [117]. The samegroupsubsequently reported cognitive improvement in one patientwith AD after intrathecal administration of infliximab[118]. Clinical trials are currently investigating the efficacyof infliximab in a wide range of pathologies, including majordepression, obesity-associated insulin resistance, anddiabetic complications, among many others [49]. There areno trials, however, investigating specifically the safety andefficacy of infliximab to treat patients with AD. Given theevidence indicating a role of TNF-a in the pathogenesis ofAD [119], clinical trials using infliximab appear warranted.
Neither etanercept nor infliximab cross the BBB,thus requiring invasive forms of central administration.Thalidomide, on the other hand, is a BBB-permeable drugthat has attracted increasing attention because of itsanti-inflammatory actions related to the inhibition of TNF-aproduction [120]. When given intraperitoneally, both
thalidomide and a synthetic analog (3,60-dithiothalidomide[3,60-DTT] [121]) inhibited lipopolysaccharide-inducedincreases in TNF-a messenger RNA and protein levelsin the cortex [122] and hippocampus [123] of rodents.3,60-DTT, but not thalidomide, reversed cognitive impairmentin 3xTg mice in the eight-arm radial maze [122] and in theMorris Water Maze [123]. Whether 3,60-DTT also rescuesbrain levels of synaptic proteins, p-tau, and Ab42 remainscontroversial [122,123]. Thalidomide also protected ratsfrom neuronal loss induced by intrahippocampal Ab42injection [124]. Thalidomide is now in a phase 2 clinical trialto treat mild to moderate AD, and results will establish itspotential value in preventing or halting the progression ofAD.
6. Conclusion
CNS inflammation, impaired neuronal insulin signaling,and neuronal dysfunction in AD may be a consequence ofsystemic inflammatory processes that occur throughout life[86,87]. Inflammatory mediators—notably pro-inflammatorycytokines such as TNF-a, IL-6, and IL-1b—may play a rolein the crosstalk between peripheral tissues and the brain.Inflamm-aging [54], metaflammation [43], and peripheralinfection/inflammation caused by pathogens or systemicinflammatory disorders may give rise to chronic, low-gradeinflammation. Ultimately, this could contribute to oraccelerate the onset of clinical manifestations of AD.
Acknowledgments
Work in our laboratory was supported by grants from theNational Institute for Translational Neuroscience (INNT/Brazil) (STF), the Human Frontiers Science Program(FGF), and the Brazilian funding agencies ConselhoNacional de Desenvolvimento Cient!ıfico e Tecnol!ogico(CNPq) and Fundac~ao de Amparo "a Pesquisa do Estado doRio de Janeiro (FAPERJ) (FGF, STF, and JRC). TRB issupported by a CNPq predoctoral fellowship and JRC isrecipient of a postdoctoral fellowship from Coordenacaode Aperfeicoamento de Pessoal de Ensino Superior.
References
[1] Brown KL, Cosseau C, Gardy JL, Hancock RE. Complexities oftargeting innate immunity to treat infection. Trends Immunol 2007;28:260–6.
[2] Ott A, Stolk RP, Hofman A, van HF, Grobbee DE, Breteler MM.Association of diabetes mellitus and dementia: the Rotterdam study.Diabetologia 1996;39:1392–7.
[3] Ahtiluoto S, Polvikoski T, Peltonen M, Solomon A, Tuomilehto J,Winblad B, et al. Diabetes, Alzheimer disease, and vasculardementia: a population-based neuropathologic study. Neurology2010;75:1195–202.
[4] Sims-Robinson C, Kim B, Rosko A, Feldman EL. How does diabetesaccelerate Alzheimer disease pathology? Nat Rev Neurol 2010;6:551–9.
[5] Wang KC, Woung LC, Tsai MT, Liu CC, Su YH, Li CY. Risk ofAlzheimer’s disease in relation to diabetes: a population-based cohortstudy. Neuroepidemiology 2012;38:237–44.
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83S80
[6] Crane PK,Walker R, Hubbard RA, Li G, Nathan DM, Zheng H, et al.Glucose levels and risk of dementia. N Engl J Med 2013;369:540–8.
[7] Perry VH, Nicoll JA, Holmes C. Microglia in neurodegenerativedisease. Nat Rev Neurol 2010;6:193–201.
[8] Czirr E, Wyss-Coray T. The immunology of neurodegeneration.J Clin Invest 2012;122:1156–63.
[9] Aguzzi A, Barres BA, Bennett ML. Microglia: scapegoat, saboteur,or something else? Science 2013;339:156–61.
[10] Lee CY, Landreth GE. The role of microglia in amyloid clearancefrom the AD brain. J Neural Transm 2010;117:949–60.
[11] Swardfager W, Lanctot K, Rothenburg L, Wong A, Cappell J,Herrmann N. A meta-analysis of cytokines in Alzheimer’s disease.Biol Psychiatry 2010;68:930–41.
[12] Hotamisligil GS, Arner P, Caro JF, Atkinson RL, Spiegelman BM.Increased adipose tissue expression of tumor necrosis factor-alphain human obesity and insulin resistance. J Clin Invest 1995;95:2409–15.
[13] Hotamisligil GS, Peraldi P, Budavari A, Ellis R, White MF,Spiegelman BM. IRS-1-mediated inhibition of insulin receptortyrosine kinase activity in TNF-alpha- and obesity-induced insulinresistance. Science 1996;271:665–8.
[14] Bomfim TR, Forny-Germano L, Sathler LB, Brito-Moreira J,Houzel JC, Decker H, et al. An anti-diabetes agent protects the mousebrain from defective insulin signaling caused byAlzheimer’s disease-associated Abeta oligomers. J Clin Invest 2012;122:1339–53.
[15] White MF, Yenush L. The IRS-signaling system: a network ofdocking proteins that mediate insulin and cytokine action. Curr TopMicrobiol Immunol 1998;228:179–208.
[16] White MF. IRS proteins and the common path to diabetes. AmJ Physiol Endocrinol Metab 2002;283:E413–22.
[17] Kanety H, Feinstein R, PapaMZ, Hemi R, Karasik A. Tumor necrosisfactor alpha-induced phosphorylation of insulin receptor substrate-1(IRS-1): possible mechanism for suppression of insulin-stimulatedtyrosine phosphorylation of IRS-1. J Biol Chem 1995;270:23780–4.
[18] Rui L, Aguirre V, Kim JK, Shulman GI, Lee A, Corbould A, et al.Insulin/IGF-1 and TNF-alpha stimulate phosphorylation of IRS-1at inhibitory Ser307 via distinct pathways. J Clin Invest 2001;107:181–9.
[19] Nakamura T, Furuhashi M, Li P, Cao H, Tuncman G, Sonenberg N,et al. Double-stranded RNA-dependent protein kinase links pathogensensing with stress and metabolic homeostasis. Cell 2010;140:338–48.
[20] Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K,et al. A central role for JNK in obesity and insulin resistance. Nature2002;420:333–6.
[21] Gao Z, Hwang D, Bataille F, Lefevre M, York D, Quon MJ, et al.Serine phosphorylation of insulin receptor substrate 1 by inhibitorkappa B kinase complex. J Biol Chem 2002;277:48115–21.
[22] Yang J, Park Y, Zhang H, Xu X, Laine GA, Dellsperger KC, et al.Feed-forward signaling of TNF-alpha and NF-kappaB via IKK-beta pathway contributes to insulin resistance and coronary arteriolardysfunction in type 2 diabetic mice. Am J Physiol Heart Circ Physiol2009;296:H1850–8.
[23] Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expressionof tumor necrosis factor-alpha: direct role in obesity-linked insulinresistance. Science 1993;259:87–91.
[24] Samad F, Uysal KT, Wiesbrock SM, Pandey M, Hotamisligil GS,Loskutoff DJ. Tumor necrosis factor alpha is a key component inthe obesity-linked elevation of plasminogen activator inhibitor 1.Proc Natl Acad Sci U S A 1999;96:6902–7.
[25] Park KM, Bowers WJ. Tumor necrosis factor-alpha mediatedsignaling in neuronal homeostasis and dysfunction. Cell Signal2010;22:977–83.
[26] Tobinick E. Perispinal etanercept for treatment of Alzheimer’sdisease. Curr Alzheimer Res 2007;4:550–2.
[27] Grammas P, Ovase R. Inflammatory factors are elevated in brain mi-crovessels in Alzheimer’s disease. Neurobiol Aging 2001;22:837–42.
[28] Ruan L, Kang Z, Pei G, Le Y. Amyloid deposition and inflammationin APPswe/PS1dE9 mouse model of Alzheimer’s disease. CurrAlzheimer Res 2009;6:531–40.
[29] Jin JJ, Kim HD, Maxwell JA, Li L, Fukuchi K. Toll-like receptor4-dependent upregulation of cytokines in a transgenic mouse modelof Alzheimer’s disease. J Neuroinflammation 2008;5:23.
[30] Ferreira ST, Klein WL. The Abeta oligomer hypothesis for synapsefailure and memory loss in Alzheimer’s disease. Neurobiol LearnMem 2011;96:529–43.
[31] Ferreira ST, Vieira MN, De Felice FG. Soluble protein oligomers asemerging toxins in Alzheimer’s and other amyloid diseases. IUBMBLife 2007;59:332–45.
[32] Zhao WQ, De Felice FG, Fernandez S, Chen H, Lambert MP,Quon MJ, et al. Amyloid beta oligomers induce impairment ofneuronal insulin receptors. FASEB J 2008;22:246–60.
[33] De Felice FG, Vieira MN, Bomfim TR, Decker H, Velasco PT,Lambert MP, et al. Protection of synapses against Alzheimer’s-linkedtoxins: insulin signaling prevents the pathogenic binding of Abetaoligomers. Proc Natl Acad Sci U S A 2009;106:1971–6.
[34] Craft S. Alzheimer disease: Insulin resistance and AD: extending thetranslational path. Nat Rev Neurol 2012;8:360–2.
[35] Ma QL, Yang F, Rosario ER, Ubeda OJ, Beech W, Gant DJ,, et al.Beta-amyloid oligomers induce phosphorylation of tau andinactivation of insulin receptor substrate via c-Jun N-terminalkinase signaling: suppression by omega-3 fatty acids and curcumin.J Neurosci 2009;29:9078–89.
[36] Chiu SL, Chen CM, Cline HT. Insulin receptor signaling regulatessynapse number, dendritic plasticity, and circuit function in vivo.Neuron 2008;58:708–19.
[37] Costello DA, Claret M, Al-Qassab H, Plattner F, Irvine EE,Choudhury AI, et al. Brain deletion of insulin receptor substrate2 disrupts hippocampal synaptic plasticity and metaplasticity.PLoS One 2012;7:e31124.
[38] Zhao WQ, Chen H, Quon MJ, Alkon DL. Insulin and the insulinreceptor in experimental models of learning and memory. EurJ Pharmacol 2004;490:71–81.
[39] Boden G, Duan X, Homko C, Molina EJ, Song W, Perez O, et al.Increase in endoplasmic reticulum stress-related proteins and genesin adipose tissue of obese, insulin-resistant individuals. Diabetes2008;57:2438–44.
[40] Gregor MF, Yang L, Fabbrini E, Mohammed BS, Eagon JC,Hotamisligil GS, et al. Endoplasmic reticulum stress is reducedin tissues of obese subjects after weight loss. Diabetes 2009;58:693–700.
[41] Sourris KC, Lyons JG, De Court MP, Dougherty SL, Henstridge DC,CooperME, et al. c-JunNH2-terminal kinase activity in subcutaneousadipose tissue but not nuclear factor-kappaB activity in peripheralblood mononuclear cells is an independent determinant of insulinresistance in healthy individuals. Diabetes 2009;58:1259–65.
[42] Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, et al.Local and systemic insulin resistance resulting from hepaticactivation of IKK-beta and NF-kappaB. Nat Med 2005;11:183–90.
[43] Calay ES, Hotamisligil GS. Turning off the inflammatory, but not themetabolic, flames. Nat Med 2013;19:265–7.
[44] Hotamisligil GS. Inflammation and metabolic disorders. Nature2006;444:860–7.
[45] Lehrke M, Reilly MP, Millington SC, Iqbal N, Rader DJ, Lazar MA.An inflammatory cascade leading to hyperresistinemia in humans.PLoS Med 2004;1:e45.
[46] YuanM, Konstantopoulos N, Lee J, Hansen L, Li ZW, Karin M, et al.Reversal of obesity- and diet-induced insulin resistance withsalicylates or targeted disruption of IKKbeta. Science 2001;293:1673–7.
[47] Reilly SM, Chiang SH, Decker SJ, Chang L, Uhm M, Larsen MJ,et al. An inhibitor of the protein kinases TBK1 and IKK-varepsilonimproves obesity-related metabolic dysfunctions in mice. Nat Med2013;19:313–21.
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83 S81
[48] Tobar N, Oliveira AG, Guadagnini D, Bagarolli RA, Rocha GZ,Araujo TG, et al. Diacerhein improves glucose tolerance and insulinsensitivity in mice on a high-fat diet. Endocrinology 2011;152:4080–93.
[49] US National Institute of Health. Available at: clinicaltrials.gov. Ac-cessed: November 1, 2013.
[50] Thomis DC, Samuel CE. Mechanism of interferon action: evidencefor intermolecular autophosphorylation and autoactivation of theinterferon-induced, RNA-dependent protein kinase PKR. J Virol1993;67:7695–700.
[51] Bonnet MC, Weil R, Dam E, Hovanessian AG, Meurs EF. PKRstimulates NF-kappaB irrespective of its kinase function byinteracting with the IkappaB kinase complex. Mol Cell Biol 2000;20:4532–42.
[52] Goh KC, deVeer MJ, Williams BR. The protein kinase PKR isrequired for p38 MAPK activation and the innate immune responseto bacterial endotoxin. EMBO J 2000;19:4292–7.
[53] Takada Y, Ichikawa H, Pataer A, Swisher S, Aggarwal BB. Geneticdeletion of PKR abrogates TNF-induced activation of IkappaBalphakinase, JNK, Akt and cell proliferation but potentiates p44/p42MAPK and p38 MAPK activation. Oncogene 2007;26:1201–12.
[54] Vitale G, Salvioli S, Franceschi C. Oxidative stress and the ageingendocrine system. Nat Rev Endocrinol 2013;9:228–40.
[55] Combs CK. Inflammation and microglia actions in Alzheimer’sdisease. J Neuroimmune Pharmacol 2009;4:380–8.
[56] Quintanilla RA, Orellana DI, Gonzalez-Billault C, Maccioni RB.Interleukin-6 induces Alzheimer-type phosphorylation of tauprotein by deregulating the cdk5/p35 pathway. Exp Cell Res 2004;295:245–57.
[57] Li Y, Liu L, Barger SW, Griffin WS. Interleukin-1 mediatespathological effects of microglia on tau phosphorylation and onsynaptophysin synthesis in cortical neurons through a p38-MAPKpathway. J Neurosci 2003;23:1605–11.
[58] Kitazawa M, Cheng D, Tsukamoto MR, Koike MA, Wes PD,Vasilevko V, et al. Blocking IL-1 signaling rescues cognition,attenuates tau pathology, and restores neuronal beta-catenin pathwayfunction in an Alzheimer’s disease model. J Immunol 2011;187:6539–49.
[59] Munoz L, Ralay RH, Roy SM, HuW, Craft JM, McNamara LK, et al.A novel p38 alpha MAPK inhibitor suppresses brain proinflamma-tory cytokine up-regulation and attenuates synaptic dysfunctionand behavioral deficits in an Alzheimer’s disease mouse model.J Neuroinflammation 2007;4:21.
[60] Bachstetter AD, Norris CM, Sompol P, Wilcock DM, Goulding D,Neltner JH, et al. Early stage drug treatment that normalizesproinflammatory cytokine production attenuates synaptic dys-function in a mouse model that exhibits age-dependent progressionof Alzheimer’s disease-related pathology. J Neurosci 2012;32:10201–10.
[61] Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, et al.Chronic inflammation in fat plays a crucial role in the develop-ment of obesity-related insulin resistance. J Clin Invest 2003;112:1821–30.
[62] Ouchi N, Parker JL, Lugus JJ, Walsh K. Adipokines in inflammationand metabolic disease. Nat Rev Immunol 2011;11:85–97.
[63] Lumeng CN, Bodzin JL, Saltiel AR. Obesity induces a phenotypicswitch in adipose tissue macrophage polarization. J Clin Invest2007;117:175–84.
[64] Banks WA. Blood–brain barrier transport of cytokines: a mechanismfor neuropathology. Curr Pharm Des 2005;11:973–84.
[65] Yamauchi T, Kamon J, Waki H, Terauchi Y, Kubota N, Hara K, et al.The fat-derived hormone adiponectin reverses insulin resistanceassociated with both lipoatrophy and obesity. NatMed 2001;7:941–6.
[66] Berg AH, Combs TP, Du X, Brownlee M, Scherer PE. Theadipocyte-secreted protein Acrp30 enhances hepatic insulin action.Nat Med 2001;7:947–53.
[67] Fruebis J, Tsao TS, Javorschi S, Ebbets-Reed D, Erickson MR,Yen FT, et al. Proteolytic cleavage product of 30-kDa adipocytecomplement-related protein increases fatty acid oxidation in muscleand causes weight loss in mice. Proc Natl Acad Sci U S A 2001;98:2005–10.
[68] Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, et al.Cloning of adiponectin receptors that mediate antidiabetic metaboliceffects. Nature 2003;423:762–9.
[69] Hotta K, Funahashi T, Bodkin NL, Ortmeyer HK, Arita Y,Hansen BC, et al. Circulating concentrations of the adipocyte proteinadiponectin are decreased in parallel with reduced insulin sensitivityduring the progression to type 2 diabetes in rhesus monkeys. Diabetes2001;50:1126–33.
[70] Ryo M, Nakamura T, Kihara S, Kumada M, Shibazaki S,Takahashi M, et al. Adiponectin as a biomarker of the metabolicsyndrome. Circ J 2004;68:975–81.
[71] Yatagai T, Nagasaka S, Taniguchi A, Fukushima M, Nakamura T,Kuroe A, et al. Hypoadiponectinemia is associated with visceralfat accumulation and insulin resistance in Japanese men with type2 diabetes mellitus. Metabolism 2003;52:1274–8.
[72] Une K, Takei YA, Tomita N, Asamura T, Ohrui T, Furukawa K, et al.Adiponectin in plasma and cerebrospinal fluid in MCI andAlzheimer’s disease. Eur J Neurol 2011;18:1006–9.
[73] van Himbergen TM, Beiser AS, Ai M, Seshadri S, Otokozawa S,Au R, et al. Biomarkers for insulin resistance and inflammationand the risk for all-cause dementia and Alzheimer disease:results from the Framingham Heart Study. Arch Neurol 2012;69:594–600.
[74] Greco SJ, Sarkar S, Johnston JM, Zhu X, Su B, Casadesus G, et al.Leptin reduces Alzheimer’s disease-related tau phosphorylation inneuronal cells. Biochem Biophys Res Commun 2008;376:536–41.
[75] Fewlass DC, Noboa K, Pi-Sunyer FX, Johnston JM, Yan SD,Tezapsidis N. Obesity-related leptin regulates Alzheimer’s Abeta.FASEB J 2004;18:1870–8.
[76] Perez-Gonzalez R, Antequera D, Vargas T, Spuch C, Bolos M,Carro E. Leptin induces proliferation of neuronal progenitorsand neuroprotection in a mouse model of Alzheimer’s disease.J Alzheimers Dis 2011;24:17–25.
[77] Paz-Filho G, Wong ML, Licinio J. The procognitive effects of leptinin the brain and their clinical implications. Int J Clin Pract 2010;64:1808–12.
[78] Lieb W, Beiser AS, Vasan RS, Tan ZS, Au R, Harris TB, et al.Association of plasma leptin levels with incident Alzheimer diseaseand MRI measures of brain aging. JAMA 2009;302:2565–72.
[79] Simons M, Keller P, De SB, Beyreuther K, Dotti CG, Simons K.Cholesterol depletion inhibits the generation of beta-amyloid inhippocampal neurons. Proc Natl Acad Sci U S A 1998;95:6460–4.
[80] Kalvodova L, Kahya N, Schwille P, Ehehalt R, Verkade P,Drechsel D, et al. Lipids as modulators of proteolytic activity ofBACE: involvement of cholesterol, glycosphingolipids, and anionicphospholipids in vitro. J Biol Chem 2005;280:36815–23.
[81] Osenkowski P, Ye W, Wang R, Wolfe MS, Selkoe DJ. Direct andpotent regulation of gamma-secretase by its lipid microenvironment.J Biol Chem 2008;283:22529–40.
[82] Bikman BT. A role for sphingolipids in the pathophysiology ofobesity-induced inflammation. Cell Mol Life Sci 2012;69:2135–46.
[83] Holland WL, Bikman BT, Wang LP, Yuguang G, Sargent KM,Bulchand S, et al. Lipid-induced insulin resistance mediated bythe proinflammatory receptor TLR4 requires saturated fattyacid-induced ceramide biosynthesis in mice. J Clin Invest 2011;121:1858–70.
[84] de la Monte SM. Triangulated mal-signaling in Alzheimer’s disease:roles of neurotoxic ceramides, ER stress, and insulin resistancereviewed. J Alzheimers Dis 2012;30:S231–49.
[85] Smith QR, Nagura H. Fatty acid uptake and incorporation in brain:studies with the perfusion model. J Mol Neurosci 2001;16:167–72.
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83S82
[86] De Felice FG. Alzheimer’s disease and insulin resistance: translatingbasic science into clinical applications. J Clin Invest 2013;123:531–9.
[87] Mattson MP. Energy intake and exercise as determinants of brainhealth and vulnerability to injury and disease. Cell Metab 2012;16:706–22.
[88] Salvioli S, Monti D, Lanzarini C, ConteM, Pirazzini C, Bacalini MG,et al. Immune system, cell senescence, aging and longevity:inflamm-aging reappraised. Curr Pharm Des 2013;19:1675–9.
[89] Salvioli S, Capri M, Valensin S, Tieri P, Monti D, Ottaviani E, et al.Inflamm-aging, cytokines and aging: state of the art, new hypotheseson the role of mitochondria and new perspectives from systemsbiology. Curr Pharm Des 2006;12:3161–71.
[90] Franceschi C, Bonafe M, Valensin S, Olivieri F, De LM, Ottaviani E,et al. Inflamm-aging: an evolutionary perspective on immuno-senescence. Ann N YAcad Sci 2000;908:244–54.
[91] Baggio G, Donazzan S, Monti D, Mari D, Martini S, Gabelli C, et al.Lipoprotein(a) and lipoprotein profile in healthy centenarians:a reappraisal of vascular risk factors. FASEB J 1998;12:433–7.
[92] Acharya NK, Levin EC, Clifford PM, Han M, Tourtellotte R,Chamberlain D, et al. Diabetes and hypercholesterolemia increaseblood–brain barrier permeability and brain amyloid deposition:beneficial effects of the LpPLA2 inhibitor darapladib. J AlzheimersDis 2013;35:179–98.
[93] Sonnen JA, Larson EB, Brickell K, Crane PK,Woltjer R, Montine TJ,et al. Different patterns of cerebral injury in dementia with or withoutdiabetes. Arch Neurol 2009;66:315–22.
[94] Takeda S, Sato N, Ikimura K, Nishino H, Rakugi H, Morishita R.Increased blood–brain barrier vulnerability to systemic inflammationin an Alzheimer disease mouse model. Neurobiol Aging 2013;34:2064–70.
[95] Kaufmann WE, Andreasson KI, Isakson PC, Worley PF. Cyclo-oxygenases and the central nervous system. Prostaglandins 1997;54:601–24.
[96] McGeer PL, Rogers J. Anti-inflammatory agents as a therapeuticapproach to Alzheimer’s disease. Neurology 1992;42:447–9.
[97] Wyss-Coray T, Rogers J. Inflammation in Alzheimer disease: a briefreview of the basic science and clinical literature. Cold Spring HarbPerspect Med 2012;2:a006346.
[98] in t’ Veld BA, Ruitenberg A, Hofman A, Launer LJ, van Duijn CM,Stijnen T, et al. Nonsteroidal antiinflammatory drugs and the risk ofAlzheimer’s disease. N Engl J Med 2001;345:1515–21.
[99] Zandi PP, Anthony JC, Hayden KM, Mehta K, Mayer L, Breitner JC.Reduced incidence of AD with NSAID but not H2 receptorantagonists: the Cache County study. Neurology 2002;59:880–6.
[100] McGeer PL, Schulzer M, McGeer EG. Arthritis and anti-inflammatory agents as possible protective factors for Alzheimer’sdisease: a review of 17 epidemiologic studies. Neurology 1996;47:425–32.
[101] Breitner JC, Haneuse SJ, Walker R, Dublin S, Crane PK, Gray SL,et al. Risk of dementia and AD with prior exposure to NSAIDs inan elderly community-based cohort. Neurology 2009;72:1899–905.
[102] Arvanitakis Z, Grodstein F, Bienias JL, Schneider JA, Wilson RS,Kelly JF, et al. Relation of NSAIDs to incident AD, change incognitive function, and AD pathology. Neurology 2008;70:2219–25.
[103] Szekely CA, Zandi PP. Non-steroidal anti-inflammatory drugsand Alzheimer’s disease: the epidemiological evidence. CNS NeurolDisord Drug Targets 2010;9:132–9.
[104] Szekely CA, Breitner JC, Fitzpatrick AL, Rea TD, Psaty BM,Kuller LH, et al. NSAID use and dementia risk in the CardiovascularHealth Study: role of APOE and NSAID type. Neurology 2008;70:17–24.
[105] Weggen S, Eriksen JL, Das P, Sagi SA, Wang R, Pietrzik CU, et al. Asubset of NSAIDs lower amyloidogenic Abeta42 independently ofcyclooxygenase activity. Nature 2001;414:212–6.
[106] Yan Q, Zhang J, Liu H, Babu-Khan S, Vassar R, Biere AL, et al.Anti-inflammatory drug therapy alters beta-amyloid processing and
deposition in an animal model of Alzheimer’s disease. J Neurosci2003;23:7504–9.
[107] Bate C, Veerhuis R, Eikelenboom P, Williams A. Neurones treatedwith cyclo-oxygenase-1 inhibitors are resistant to amyloid-beta1-42. Neuroreport 2003;14:2099–103.
[108] Kotilinek LA, Westerman MA, Wang Q, Panizzon K, Lim GP,Simonyi A, et al. Cyclooxygenase-2 inhibition improves amyloid-beta-mediated suppression of memory and synaptic plasticity. Brain2008;131:651–64.
[109] Scharf S, Mander A, Ugoni A, Vajda F, Christophidis N.A double-blind, placebo-controlled trial of diclofenac/misoprostolin Alzheimer’s disease. Neurology 1999;53:197–201.
[110] Aisen PS, Schmeidler J, Pasinetti GM. Randomized pilot studyof nimesulide treatment in Alzheimer’s disease. Neurology 2002;58:1050–4.
[111] Aisen PS, Schafer KA, Grundman M, Pfeiffer E, Sano M, Davis KL,et al. Effects of rofecoxib or naproxen vs placebo on Alzheimerdisease progression: a randomized controlled trial. JAMA 2003;289:2819–26.
[112] Reines SA, Block GA, Morris JC, Liu G, Nessly ML, Lines CR, et al.Rofecoxib: no effect on Alzheimer’s disease in a 1-year, randomized,blinded, controlled study. Neurology 2004;62:66–71.
[113] Pasqualetti P, Bonomini C, Dal FG, Paulon L, Sinforiani E, Marra C,et al. A randomized controlled study on effects of ibuprofen oncognitive progression of Alzheimer’s disease. Aging Clin Exp Res2009;21:102–10.
[114] Green RC, Schneider LS, Amato DA, Beelen AP, Wilcock G,Swabb EA, et al. Effect of tarenflurbil on cognitive decline andactivities of daily living in patients with mild Alzheimer disease:a randomized controlled trial. JAMA 2009;302:2557–64.
[115] Tobinick E, Gross H, Weinberger A, Cohen H. TNF-alphamodulation for treatment of Alzheimer’s disease: a 6-month pilotstudy. Med Gen Med 2006;8:25.
[116] Tobinick EL, Gross H. Rapid cognitive improvement inAlzheimer’s disease following perispinal etanercept administration.J Neuroinflammation 2008;5:2.
[117] Shi JQ, Shen W, Chen J, Wang BR, Zhong LL, Zhu YW, et al.Anti-TNF-alpha reduces amyloid plaques and tau phosphorylationand induces CD11c-positive dendritic-like cell in the APP/PS1transgenic mouse brains. Brain Res 2011;1368:239–47.
[118] Shi JQ,WangBR, JiangWW,Chen J,ZhuYW,ZhongLL, et al. Cogni-tive improvement with intrathecal administration of infliximab in awoman with Alzheimer’s disease. J Am Geriatr Soc 2011;59:1142–4.
[119] Clark I, Atwood C, Bowen R, Paz-Filho G, Vissel B. Tumornecrosis factor-induced cerebral insulin resistance in Alzheimer’sdisease links numerous treatment rationales. Pharmacol Rev 2012;64:1004–26.
[120] Tweedie D, Sambamurti K, Greig NH. TNF-alpha inhibition as atreatment strategy for neurodegenerative disorders: new drugcandidates and targets. Curr Alzheimer Res 2007;4:378–85.
[121] Zhu X, Giordano T, Yu QS, Holloway HW, Perry TA, Lahiri DK, et al.Thiothalidomides: novel isosteric analogues of thalidomide withenhancedTNF-alpha inhibitory activity. JMedChem2003;46:5222–9.
[122] Gabbita SP, Srivastava MK, Eslami P, Johnson MF, Kobritz NK,Tweedie D, et al. Early intervention with a small molecule inhibitorfor tumor necrosis factor-alpha prevents cognitive deficits in a tripletransgenic mouse model of Alzheimer’s disease. J Neuroinflamma-tion 2012;9:99.
[123] Tweedie D, Ferguson RA, Fishman K, Frankola KA, Van PH,Holloway HW, et al. Tumor necrosis factor-alpha synthesis inhibitor3,60-dithiothalidomide attenuatesmarkers of inflammation, Alzheimerpathology and behavioral deficits in animalmodels of neuroinflamma-tion and Alzheimer’s disease. J Neuroinflammation 2012;9:106.
[124] Ryu JK, McLarnon JG. Thalidomide inhibition of perturbedvasculature and glial-derived tumor necrosis factor-alpha in ananimal model of inflamed Alzheimer’s disease brain. Neurobiol Dis2008;29:254–66.
S.T. Ferreira et al. / Alzheimer’s & Dementia 10 (2014) S76–S83 S83
Cell Metabolism
Article
TNF-a Mediates PKR-Dependent Memory Impairmentand Brain IRS-1 Inhibition Induced by Alzheimer’sb-Amyloid Oligomers in Mice and MonkeysMychael V. Lourenco,1 Julia R. Clarke,1 Rudimar L. Frozza,1 Theresa R. Bomfim,1 Letıcia Forny-Germano,1
Andre F. Batista,1 Luciana B. Sathler,1 Jordano Brito-Moreira,1 Olavo B. Amaral,1 Cesar A. Silva,1 Leo Freitas-Correa,1
Sheila Espırito-Santo,3 Paula Campello-Costa,3 Jean-Christophe Houzel,2 William L. Klein,4 Christian Holscher,5
Jose B. Carvalheira,6 Aristobolo M. Silva,7,8 Lıcio A. Velloso,9 Douglas P. Munoz,10 Sergio T. Ferreira,1,*and Fernanda G. De Felice1,*1Institute of Medical Biochemistry Leopoldo de Meis2Institute of Biomedical SciencesFederal University of Rio de Janeiro, Rio de Janeiro, RJ 21941-902, Brazil3Institute of Biology, Fluminense Federal University, Niteroi, RJ 24001-970, Brazil4Department of Neurobiology, Northwestern University, Evanston, IL 60208, USA5Faculty of Health and Medicine, Biomedical and Life Sciences, Lancaster University, Lancaster LA1 4YQ, UK6Department of Internal Medicine, Faculty of Medical Sciences, UNICAMP, Campinas, SP 13084-761, Brazil7Institute of Biological Sciences, Federal University of Minas Gerais, Belo Horizonte, MG 31270-901, Brazil8Rene Rachou Research Center, Fiocruz, Minas Gerais, Belo Horizonte, MG 30190-002, Brazil9Laboratory of Cell Signalling, Obesity and Comorbidities Research Centre, University of Campinas, DCM-FCM UNICAMP, Campinas,SP 13084-761, Brazil10Centre for Neuroscience Studies, Queen’s University, Kingston, ON K7L3N6, Canada*Correspondence: [email protected] (S.T.F.), [email protected] (F.G.D.F.)http://dx.doi.org/10.1016/j.cmet.2013.11.002
SUMMARY
Alzheimer’s disease (AD) and type 2 diabetesappear to share similar pathogenic mechanisms.dsRNA-dependent protein kinase (PKR) underliesperipheral insulin resistance in metabolic disor-ders. PKR phosphorylates eukaryotic translationinitiation factor 2a (eIF2a-P), and AD brainsexhibit elevated phospho-PKR and eIF2a-P levels.Whether and how PKR and eIF2a-P participatein defective brain insulin signaling and cognitiveimpairment in AD are unknown. We report thatb-amyloid oligomers, AD-associated toxins, acti-vate PKR in a tumor necrosis factor a (TNF-a)-dependent manner, resulting in eIF2a-P, neuronalinsulin receptor substrate (IRS-1) inhibition, syn-apse loss, and memory impairment. Brain phos-pho-PKR and eIF2a-P were elevated in AD animalmodels, including monkeys given intracerebro-ventricular oligomer infusions. Oligomers failedto trigger eIF2a-P and cognitive impairment inPKR!/! and TNFR1!/! mice. Bolstering insulinsignaling rescued phospho-PKR and eIF2a-P.Results reveal pathogenic mechanisms shared byAD and diabetes and establish that proinflamma-tory signaling mediates oligomer-induced IRS-1 in-hibition and PKR-dependent synapse and memoryloss.
INTRODUCTION
Recent evidence suggests that Alzheimer’s disease (AD) is anovel, brain-specific form of diabetes (de la Monte and Wands,2008; De Felice, 2013). AD brains exhibit defective insulinsignaling with altered levels and cellular distribution of insulin re-ceptors (Moloney et al., 2010). Insulin signaling is central toneuronal survival, regulation of synapse number, and dendriticplasticity (van der Heide et al., 2005; Chiu et al., 2008; McNayand Recknagel, 2011), raising the possibility that deficient insulinsignaling may be linked to neuronal dysfunction in AD.b-amyloid oligomers (AbOs), toxins that accumulate in AD
brains and instigate synapse damage (Ferreira and Klein,2011), remove insulin receptors from the neuronal surface(Zhao et al., 2008; De Felice et al., 2009) and activate c-JunN-terminal kinase (JNK) to trigger insulin receptor substrate(IRS-1) inhibition (Bomfim et al., 2012). These findings providedinitial clues on how impaired neuronal insulin signaling de-velops in AD (De Felice, 2013). Landmark studies from the dia-betes field have established that activation of proinflammatorytumor necrosis factor alpha and JNK signaling (TNF-a/JNKsignaling) is a key mechanism leading to peripheral insulinresistance (Hotamisligil et al., 1994, 1996; Gregor and Hotami-sligil, 2011). Therefore, it is likely that a molecular parallel existsbetween defective brain insulin signaling in AD and peripheralinsulin resistance in diabetes (Bomfim et al., 2012; De Felice,2013).The double-stranded RNA-dependent protein kinase (PKR) is
a critical player in the integration of an inflammatory responsethat leads to peripheral insulin resistance in metabolic disorders,
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 831
including diabetes (Ozcan et al., 2004; Hotamisligil, 2010; Naka-mura et al., 2010). Elevated levels of phosphorylated PKR and ofits key target, eukaryotic translation initiation factor 2a (eIF2a),have been reported in AD brains and in animal models of AD(Hoozemans et al., 2009; Yoon et al., 2012). eIF2a phosphoryla-tion is critical for memory regulation (Costa-Mattioli et al., 2007)and has been recently shown to mediate prion-related neurode-generation in the hippocampus (Moreno et al., 2012), a memorycenter that is affected early in AD.
Given the pathophysiological roles of TNF-a and PKR inperipheral insulin resistance (Nakamura et al., 2010; Gregorand Hotamisligil, 2011), we investigated here whether similarproinflammatory mechanisms might underlie neuronal dysfunc-tion in AD. We hypothesized that the TNF-a pathway mightcause phosphorylation of PKR and eIF2a-P, IRS-1 inhibition,and impact synapses and memory in AD. We show that phos-pho-PKR and eIF2a-P are elevated in the brains of a transgenicmouse model of AD, of mice and cynomolgus monkeys givenintracerebroventricular (i.c.v.) infusions of AbOs, and in culturedhippocampal neurons exposed to oligomers. AbOs failed totrigger eIF2a-P and cognitive impairment in both PKR!/! andTNFR1!/! mice, as well as in mice treated with infliximab, aTNF-a neutralizing antibody. Salubrinal and thapsigargin, agentsthat increase eIF2a-P levels and endoplasmic reticulum (ER)stress, respectively, inducedmemory impairment inmice. Insulintreatment prevented oligomer-induced phosphorylation of PKRand eIF2a-P in hippocampal cultures. Glucagon-like peptide 1(GLP-1) receptor agonists blocked eIF2a-P in hippocampal cul-tures and in the brains of transgenic mice and oligomer-injectedmonkeys. Collectively, results provide the grounds for targetingTNF-a/PKR/eIF2a-P signaling as a potential disease-modifyingtherapy for AD.
RESULTS
Ab Oligomers Instigate Neuronal eIF2a-P and Other ERStress Markers In Vitro and In VivoWe first explored whether AbOs abnormally activate theunfolded protein response (UPR), which has been described tointersect with inflammatory and stress signaling pathways thatlead to peripheral insulin resistance in chronic metabolic dis-eases (Ozcan et al., 2004, 2006; Hotamisligil, 2010). To thisend, we searched for ER stress markers in cell cultures and indifferent animal models of AD. Usingmature cultured hippocam-pal neurons, we found increased IRE1a-pSer724 in dendritesand cell bodies after exposure of neurons to AbOs for 3 hr (Fig-ures 1A and 1B and S1A available online). Consistent withincreased endonuclease activity of IRE1a upon phosphorylation,levels of spliced X box binding protein 1 (XBP1), a downstreameffector of IRE1a recently proposed as a connection betweenUPR and insulin signaling (Park et al., 2010; Winnay et al.,2010), were increased in oligomer-exposed neurons (Fig-ure S1B). Further, AbOs increased dendritic and cell body levelsof eIF2a-pSer51 (eIF2a-P) in hippocampal neurons (Figures 1C,1D, and S1C).
We also detected increased neuronal levels of 78 kDaglucose-regulated protein (GRP78) (also known as bindingimmunoglobulin protein, Bip), an ER chaperone that is part ofthe stress response program and is upregulated in AD brains
(Hoozemans et al., 2005), in oligomer-exposed neurons (Fig-ure S1D). Prolonged ER stress is known to trigger apoptosismediated by C/EBP homologous protein (CHOP; also knownas growth arrest- and DNA damage-inducible gene 153,GADD153) (Lai et al., 2007). In line with the results describedabove, CHOP mRNA levels were increased in neurons exposedto AbOs for 24 hr (Figure S1E).Next, we looked for eIF2a-P in the brains of APPSwe,PS1DE9
(APP/PS1) mice. These mice harbor transgenes for human amy-loid precursor protein (APP) bearing the Swedish mutationand a deletion mutant form of presenilin 1 (PS1) and presentincreased Ab production and cognitive deficits (Jankowskyet al., 2001). APP/PS1 mice displayed increased hippocampallevels of eIF2a-P compared to wild-type animals (Figure 1E).
AbO-Induced PKR Activation Leads to eIF2aPhosphorylationFour kinases (PKR-like endoplasmic reticulum kinase [PERK],double-stranded RNA-dependent protein kinase [PKR], generalcontrol nonrepressed kinase 2 [GCN2], and heme-regulated in-hibitor [HRI]) have been reported to phosphorylate eIF2a understress conditions (Gkogkas et al., 2010). PERK and PKR arethe main eIF2a kinases in response to ER stress and inflamma-tion, respectively (Raven and Koromilas, 2008). We thereforeexamined the roles of both kinases in oligomer-induced eIF2a-Pin neurons. In hippocampal neuronal cultures, the distributionof activated PERK (PERK-pThr981) was mainly restricted tocell bodies, and its levels were not altered by exposure toAbOs for 3 hr (Figures S2A and S2B). In contrast, PKR was acti-vated by exposure to AbOs in neuronal cultures (Figures 1F and1G). AbOs are known to selectively target a subset of neurons inhippocampal cultures (Lacor et al., 2007). Importantly, elevatedphospho-PKR levels were found independent of whether or notneurons exhibited oligomers bound to their dendrites (Figure 1H).This indicates that PKR phosphorylation is not triggered bydirect binding of oligomers to individual neurons, but rather isinstigated by soluble factors released to the medium uponexposure of cultures to AbOs.To establish the in vivo relevance of these findings, we
analyzed levels of active PKR and PERK in the brains of APP/PS1 transgenic mice. Increased phosphorylation of PKR, butnot of PERK, was detected in hippocampi of APP/PS1 micecompared to wild-type controls (Figures 1I and S2C). Consistentwith the role of PKR in AbO-dependent eIF2a-P, pharmacolog-ical inhibition of PKR completely blocked oligomer-inducedeIF2a-P aswell as IRE1a-pSer724 (Figures 1J and 1K) in culturedhippocampal neurons. We further extended our investigationto the brains of monkeys that received i.c.v. infusions of AbOs.In monkeys, AbOs promoted eIF2a-P (Figures 1L, 1M, S1F,and S1G) and PKR activation in the hippocampus and entorhinalcortex (Figures 1N, 1O, S1H, and S1I).
TNF-a Receptor Activation Lies Upstream of PKRDysregulationIn metabolic disorders, ER stress has been linked to insulin resis-tance and proinflammatory TNF-a signaling (Ozcan et al., 2006;Steinberg et al., 2006). To determine whether TNF-a activationwas involved in AbO-induced phospho-PKR and eIF2a-P in hip-pocampal neurons, we first treated cultures with infliximab, a
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
832 Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc.
Figure 1. b-Amyloid Oligomers Trigger Neuronal IRE1a-pSer724, eIF2a-P, and Phospho-PKR In Vitro and In Vivo(A and B) Shown is IRE1a-pSer724 immunolabeling (A) and levels (B) in cultured hippocampal neurons exposed to vehicle or 500 nM AbOs for 3 hr (scale bars =
10 mm). Boxes under each panel show optical zoom images of selected dendrite segments (white dashed rectangles).
(C and D) Shown is eIF2a-P immunolabeling (C) and levels (D), determined from 4–6 experiments using independent cultures (30 images analyzed per experi-
mental condition per experiment).
(E) Immunoblot analysis of eIF2a-P in hippocampal homogenates from 13- to 16-month-old WT (n = 5) or APP/PS1 (n = 7) mice.
(F) Immunolabeling for PKR-pThr451 in cultured hippocampal neurons exposed to vehicle or 500 nM AbOs for 3 hr (scale bar = 10 mm).
(G) PKR-pThr451 immunofluorescence levels, determined from four experiments using independent cultures (30 images analyzed per experimental condition per
experiment).
(H) Immunolabeling of DAPI (blue), AbOs (red), and phospho-PKR (green) in cultured hippocampal neurons. White arrow indicates a neuron with elevated
phospho-PKR level in the absence of oligomer binding.
(I) Immunoblot analysis of PKR-pThr451 (normalized by total PKR) in hippocampal homogenates of 13- to 16-month-old WT (n = 5) and APP/PS1 (n = 7) mice.
*p < 0.05, **p < 0.01, Student’s t test.
(J) eIF2a-P immunolabeling in hippocampal neurons exposed to vehicle, 500 nM AbOs, or 1 mM PKR inhibitor + 500 nM AbOs for 3 hr (scale bar = 10 mm).
(K) eIF2a-P and IRE1a-pSer724 immunofluorescence levels, determined from three experiments using independent cultures. *p < 0.05, ANOVA followed by
Bonferroni post hoc test.
(L and M) Shown is eIF2a-P immunolabeling (L) and integrated optical densities (M) in hippocampus (CA1 and CA3 regions) and entorhinal cortex of cynomolgus
monkeys that received i.c.v. injections of AbOs (n = 4) (right panels) compared to sham-operated control monkeys (n = 3) (left panels) (scale bars = 200 mm).
(N and O) Shown is phosphor-PKR labeling (N) and integrated optical densities (O) (see Experimental Procedures) in hippocampus (CA1 and CA3 regions) and
entorhinal cortex of sham-operated (Sham) (n = 3) or AbO-injected monkeys (AbOs) (n = 4). *p < 0.05, ANOVA followed by Bonferroni post hoc test. Graphs show
means ± SEM. See also Figure S1.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 833
TNF-a neutralizing monoclonal antibody. Infliximab suppressedboth PKR activation and eIF2a-P triggered by oligomers (Figures2A–2E). SP600125, a specific JNK inhibitor, also blocked eI-F2a-P in neuronal cultures (Figures 2D and 2E), in line with recentstudies that have implicated the JNK pathway in AbO-inducedIRS-1 inhibition (Ma et al., 2009; Bomfim et al., 2012; De Felice,2013). It is notable that infliximab did not block oligomer bindingto neurons (Figures 2F and 2G), substantiating the notion thatactivation of TNF-a/PKR signaling is independent of direct bind-ing of AbOs to individual neurons and is likely mediated by TNF-asecreted to the medium. Indeed, TNF-a levels were increased inthe culture medium after exposure to oligomers (Figure 2H),consistent with our recent finding that TNF-a levels are increasedin the brains of mice that received i.c.v infusions of oligomers(Ledo et al., 2013).
Activation of the TNF-a/PKR/eIF2a-P Pathway Is Linkedto Synapse Loss and Memory ImpairmentWe next hypothesized that activation of proinflammatory TNF-asignaling might be connected to AbO-induced memory impair-ment. Supporting this hypothesis, infliximab prevented memoryimpairment triggered by AbOs in mice (Figure 3A). We nextinjected oligomers i.c.v. in TNFR1!/! mice. Significantly, AbOscaused memory deficits in wild-type (WT) mice, but not inTNFR1!/!mice (Figures 3B, 3C, and S3). These results implicateTNF-a signaling in the mechanism underlying memory impair-ment induced by AbOs in mice. Interestingly, AbOs triggered
phosphorylation of PKR and eIF2a in the hippocampus of WTmice, but not in TNFR1!/!mice (Figures 3D and 3E), establishingthat activation of TNF-a receptors lies upstream of PKR andeIF2a-P in vivo.Synapse loss has been proposed to be the best pathological
correlate of the extent of dementia in AD (Terry et al., 1991), andAD brains present reduced levels of synaptophysin and PSD-95, pre- and postsynaptic markers, respectively (Terry et al.,1991).AbOshavebeenshown to reduce the levelsof synaptophy-sin or PSD-95 in neuronal cultures, in the brains of mice receivingi.c.v. infusions of oligomers, and in ex vivo human cortical slices(Sebollela et al., 2012; Figueiredo et al., 2013). Supporting thenotion that synaptic deterioration underlies TNF-a-dependentmemory impairment induced by AbOs, levels of synaptophysinand PSD-95 were decreased in hippocampi of WT, but not ofTNFR1!/!, mice i.c.v. injected with AbOs (Figure 3F).To determine the role of PKR in AbO-induced cognitive impair-
ment, we investigated the effect of AbOs in PKR!/!mice. Impor-tantly, we found that AbOs induced hippocampal eIF2a-P andcognitive deficits in WT mice, but not in PKR!/! mice (Figures3G–3I). These results demonstrate that PKR, recently implicatedin metabolic stress and impaired insulin signaling in diabetes(Nakamura et al., 2010), is a key mediator of neuronal eIF2a-Pand memory impairment induced by AbOs.To further examine the impact of PKR activation on synapses,
we exposed hippocampal cultures to AbOs in the absence orpresence of a PKR inhibitor. After 24 hr, we evaluated synapse
Figure 2. TNF-a Mediates Oligomer-Induced Phospho-PKR and eIF2a-P(A) PKR-pThr451 immunolabeling in cultured hip-
pocampal neurons exposed for 3 hr to vehicle or
500 nM AbOs in the absence or presence of in-
fliximab.
(B) PKR-pThr451 immunofluorescence levels,
determined from four experiments using inde-
pendent cultures.
(C) eIF2a-P immunolabeling in cultured hippo-
campal neurons exposed for 3 hr to vehicle or
500 nM AbOs in the absence or presence of in-
fliximab.
(D) eIF2a-P immunofluorescence levels, deter-
mined from four experiments using independent
cultures exposed to vehicle or 500 nM AbOs in the
absence or presence of infliximab or JNK inhibitor
(JNKi). **p < 0.01, ANOVA followed by Bonferroni
post hoc test.
(E) Immunoblot analysis for eIF2a-P in hippo-
campal neuronal cultures exposed for 3 hr to
500 nM AbOs in the absence or in the presence of
infliximab or JNK inhibitor (n = 3 independent ex-
periments; *p < 0.05, Student’s t test).
(F) Imunolabeling of AbOs (with anti-AbO, NU4) in
neurons exposed to 500 nM AbOs in the absence
or presence of infliximab.
(G) Quantification of Ab oligomer binding in neu-
rons exposed to AbOs in the absence or presence
of infliximab.
(H) Soluble TNF-a levels in conditionedmedia from
cultured hippocampal neurons exposed to vehicle
(veh) or 500 nM AbOs for 3 hr (n = 3 independent
experiments; *p < 0.05, Student’s t test). Graphs
show means ± SEM. See also Figure S2.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
834 Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc.
density by determining immunoreactivities of synaptophysin andPSD-95 and their colocalization at synapses. Results showedthat inhibition of PKR attenuated synapse loss induced byAbOs (Figures 3J–3M) and suggest that loss of synaptic proteinsunderlies the deleterious effects of PKR on memory.Based on the findings described above, we hypothesized that
elevated eIF2a-P in the brain might be linked to memory impair-ment triggered by AbOs. To explore the connection betweeneIF2a-P and memory, we performed i.p. injections of salubrinal(an inhibitor of GADD34, a phosphatase that preferentiallydephosphorylates eIF2a) to increase eIF2a-P levels in the hippo-campi of adult Swiss mice. Animals that received salubrinalpresented memory impairment in the novel object recognitiontask (Figure 4A) and significantly lower hippocampal levels of
PSD-95 and synaptophysin (Figures 4B–4D). We also founddecreased levels of synaptophysin and PSD-95, as well asdecreased synapse density, in salubrinal-exposed hippocampalcultures (Figures 4E–4H). Control experiments indicated that, asexpected, salubrinal promoted eIF2a-P in hippocampal neuronsin culture (Figures S4A and S4B) and in the brains of injectedmice (Figure S4C). These results show that eIF2a-P is sufficientto cause memory impairment and synapse loss in mice.Additional support to the notion that eIF2a-P and, more gener-
ally, ER stress cause memory impairment came from the obser-vation that thapsigargin, a classical inducer of ER stress thattriggers eIF2a-P in neurons (Figures S5A and S5B), caused braineIF2a-P and memory impairment when injected i.c.v. in mice(Figures S5C and S5D). 4-phenylbutyrate (4-PBA), a chemical
Figure 3. TNF-a/PKR Signaling MediatesCognitive Impairment and Synapse LossCaused by Ab Oligomers(A) Exploration times of mice i.c.v. injected with
vehicle or 10 pmol AbOs in the absence or pres-
ence of infliximab in the novel object recognition
task (n = 7–10 per experimental group).
(B) Exploration times of WT or TNFR1!/! mice
i.c.v. injected with vehicle or 10 pmol AbOs in
the novel object recognition task (n = 9–10 per
experimental group). Asterisks denote a statisti-
cally significant (p < 0.05) difference from 50%
(reference value).
(C) Freezing times of WT or TNFR1!/! mice in-
jected with vehicle or 10 pmol AbOs in the
contextual fear conditioning task. n = 9–10 animals
per experimental group. *p < 0.05, ANOVA fol-
lowed by Bonferroni post hoc test.
(D–F) Immunoblot analysis of PKR-pThr451
(normalized by total PKR) (D), eIF2a-P (normalized
by total eIF2a) (E), and synaptophysin (white bars)
and PSD95 (gray bars) (normalized by b-actin) (F)
in hippocampal homogenates of 2- to 3-month-old
WT or TNFR1!/! mice injected with vehicle or 10
pmol AbOs (n = 7 for each experimental condition).
(G) Exploration times of WT or PKR!/! mice
exposed to vehicle or 10 pmol AbOs in the novel
object recognition task (n = 8–10 per experimental
group). Asterisks denote a statistically significant
difference (p < 0.05) from 50% (reference value).
(H) Freezing times of WT or PKR!/! mice injected
with vehicle or 10 pmol AbOs in the contextual fear
conditioning task. n = 9–10 animals per experi-
mental group. *p < 0.05, ANOVA followed by
Bonferroni post hoc test.
(I) Immunoblot analysis of eIF2a-P (normalized
by total eIF2a) in hippocampal homogenates of 2-
to 3-month-old WT or PKR!/! mice injected with
vehicle or 10 pmol AbOs (n = 7 for each experi-
mental condition).
(J) Synaptophysin (green) and PSD95 (red) im-
munolabeling of cultured hippocampal neurons
exposed for 3 hr to vehicle or 500 nM AbOs in
the absence or presence of PKR inhibitor. Syn-
apses, evidenced by colocalized puncta, appear
in yellow.
(K–M) Quantification of synaptophysin (K), PSD95
(L), and colocalized (M) puncta, determined from
four experiments using independent cultures. *p <
0.05, ANOVA followed by Bonferroni post hoc test.
Graphs show means ± SEM. See also Figure S3.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 835
chaperone known to alleviate ER stress, prevented memory loss(Figure S5D). 4-PBA further blockedmemory impairment causedby i.c.v. injection of AbOs in mice (Figure S5E), implicating ERstress in the impact of AbOs on memory.
TNF-a, but Not eIF2a-P, Causes Neuronal IRS-1InhibitionWe recently reported that TNF-a and PKR mediate IRS-1 inhibi-tion in cultured hippocampal neurons (Bomfim et al., 2012).Establishing that proinflammatory TNF-a mediates oligomer-induced IRS-1 inhibition in vivo, AbOs triggered IRS-1pSer636in the hippocampus of WT mice, but not in TNFR1!/! mice(Figure 5A). We also examined IRS-1pSer levels in the brains ofPKR!/! mice. Possibly reflecting different patterns of activationof IRS-1 in mice of different genetic backgrounds (Xu et al.,2013), we did not detect increased IRS-1pSer levels inducedby AbOs in WT 129/SvEv mice. Interestingly, however, lowerIRS-1pSer levels were found in PKR!/! mice than in WT mice,demonstrating that suppression of PKR per se attenuatesIRS-1 inhibition (Figure 5B).
Because ER stress and eIF2a-P are linked to insulin resistancein peripheral tissues (Ozcan et al., 2004; Birkenfeld et al., 2011),we next aimed to determine whether they might be related toIRS-1 inhibition in neurons. We initially found that thapsgargintriggered dendritic IRS-1pSer636 in hippocampal neurons, andthis was blocked by 4-PBA (Figures 5C and 5D). However, levelsof IRS-1pSer were unaffected in hippocampal neuronal culturesexposed to salubrinal (Figures 5E and 5F) or in hippocampi ofsalubrinal-injected mice (Figures 5G and 5H). These results sug-gest that, while eIF2a-P alone is not sufficient to cause IRS-1pSer in neurons, aberrant activation of TNF-a signaling andinduction of ER stress play important roles in brain IRS-1 inhibi-tion. In this regard, it is interesting to note that AbOs inducedupregulation of XBP1s, GRP78, and CHOP (Figures S1B, S1D,and S1E), implicated in mechanisms by which ER dysfunctionis linked to inflammatory signaling and insulin resistance(Hotamisligil, 2010). Based on our results, it is conceivable that
different branches of the UPR respond to AbO-induced TNFRactivation and lead to IRS-1 inhibition.
Stimulation of Insulin Signaling Prevents Phospho-PKRand eIF2a-PLastly, we asked whether antidiabetic agents, recently shown torestore insulin signaling and exert neuroprotective actions in ADmodels (De Felice et al., 2009; McClean et al., 2011; Bomfimet al., 2012), could alleviate phospho-PKR and eIF2a-P triggeredby AbOs. Insulin treatment blocked the phosphorylation of PKRand eIF2a in hippocampal cultures exposed to AbOs (Figures6A–6D). Exendin-4, a GLP-1 receptor agonist approved fortreatment of diabetes (Ryan and Hardy, 2011), blocked AbO-trig-gered eIF2a-P in hippocampal neurons (Figures 6C and 6D), andintraperitoneal treatment with exendin-4 rescued eIF2a-P levelsin hippocampi of APP/PS1 mice (Figure 6E).Liraglutide, a long-lasting GLP-1 receptor agonist, has also
been shown to exhibit neuroprotective actions in animal models.Liraglutide treatment significantly reduced the levels of ER stressmarker GRP78 in the brains of APP/PS1 mice (Figure S6A). Thiswas accompanied by a significant increase in levels of synapticmarker drebrin (Figure S6B), suggesting increased synapticdensity. We further asked whether liraglutide would affect hippo-campal Ab oligomer burden in APP/PS1 mice. Interestingly,levels of 28 kDa and 108 kDa Ab oligomers, recently implicatedin AD pathogenesis (Tomiyama et al., 2010; Bao et al., 2012),were markedly reduced in liraglutide-treated animals (FiguresS6C and S6D).The neuroprotective actions of exendin-4 and liraglutide trans-
lated into memory benefit, as indicated by improved perfor-mance in fear conditioning learning in APP/PS1 mice (FiguresS6E and S6F). These findings are in line with recent studiesthat demonstrated beneficial effects of GLP-1R activationon memory in AD mice (McClean et al., 2011; Bomfim et al.,2012). Control measurements showed that neither exendin-4nor liraglutide altered animal body weight during experiments(Figures S6G and S6H). Collectively, these data suggest that
Figure 4. eIF2a-P Triggers CognitiveImpairment and Synapse Loss(A) Exploration times ofmice i.p. injected for 7 days
with vehicle or 1 mg/kg salubrinal in the novel
object recognition task (n = 10 per experimental
group). Asterisks denote a statistically significant
difference (p < 0.05) from 50% (reference value).
(B) Representative immunoblot analysis of syn-
aptophysin and PSD-95 levels in hippocampal
homogenates of 2- to 3-month-old mice receiving
vehicle or salubrinal intraperitoneally for 7 days
(n = 7 per experimental group).
(C and D) Levels of synaptophysin (C) and PSD-95
(D) were normalized by b-actin.
(E) Synaptophysin (green) and PSD95 (red) im-
munolabeling in cultured hippocampal neurons
exposed for 3 hr to vehicle or 10 mM salubrinal.
Synapses, evidenced by colocalized puncta,
appear in yellow.
(F–H) Quantification of synaptophysin (F), PSD-95
(G), and colocalized (H) puncta, determined from
four experiments using independent cultures.
*p < 0.05, Student’s t test. Graphs show means ±
SEM. See also Figure S4.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
836 Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc.
the beneficial actions of GLP-1R agonists in AD transgenicmice involve decreased AbO levels and attenuation of braineIF2a-P and ER stress. Finally, systemic treatment with liraglu-tide reduced eIF2a-P induced by AbOs in the entorhinal cortexand hippocampus of two cynomolgus monkeys (Figures 6F–6H).
DISCUSSION
An intriguingmolecular connectionhasbeenestablishedbetweentype 2 diabetes and AD, following the discovery that impairedinsulin signaling, a hallmark of diabetes, is present in AD brains(Bomfimetal., 2012;Talbotet al., 2012).Clinical andepidemiolog-ical studies have further linked AD and diabetes, with each dis-ease increasing the risk of developing the other (Ott et al., 1996;Janson et al., 2004). AbOs, synaptotoxins that accumulate in ADbrains (Gong et al., 2003), were recently found to disrupt neuronalinsulin signaling by causing cellular redistribution of insulin recep-tors and inhibitory serine phosphorylation of IRS-1 (Zhao et al.,2008; De Felice et al., 2009; Bomfim et al., 2012). These studies
Figure 5. TNF-a and ER Stress, But NoteIF2a-P Alone, Cause Neuronal IRS-1Inhibition(A) Immunoblot analysis of IRS-1pSer636
(normalized by total IRS-1) in hippocampal ho-
mogenates of 2- to 3-month-old WT or TNFR1!/!
mice injected with vehicle or 10 pmol AbOs (n = 7
for each experimental condition).
(B) Immunoblot analysis of IRS-1pSer636 in hip-
pocampal homogenates of 2- to 3-month-old WT
or PKR!/! mice injected with vehicle or 10 pmol
AbOs (n = 8 for each experimental condition).
(C) MAP2 and IRS-1pSer636 immunolabeling
in dendrite segments from hippocampal neurons
exposed to vehicle, 1 mM thapsigargin, or 1 mM
4-PBA + 1 mM thapsigargin for 3 hr.
(D) Graph shows IRS-1pSer636 immunofluo-
rescence levels (3 independent experiments; 80
dendrite segments analyzed per experimental
condition per experiment). Scale bar: 5 mm.
(E) IRS-1pSer636 immunolabeling in cultured
hippocampal neurons exposed to vehicle or 10 mM
salubrinal for 3 hr (scale bars = 10 mm).
(F) Graph shows IRS-1pSer636 immunofluo-
rescence levels (3 independent experiments; 30
images/experimental condition/experiment).
(G) Representative immunoblot analysis of IRS-
1pSer636 (normalized by total IRS-1) in hippo-
campal homogenates of 2- to 3-month-old mice
injected intraperitoneally with vehicle or 1 mg/kg
salubrinal (n = 7 per experimental condition).
(H) IRS-1pSer636 levels were normalized by total
IRS-1. *p < 0.05, ANOVA followed by Bonferroni
post hoc test. Graphs show means ± SEM. See
also Figure S5.
have provided initial evidence thatmechanisms similar to those underlyingperipheral insulin resistance in metabolicdiseases lead to impaired brain insulinsignaling in AD (Bomfim et al., 2012;Talbot et al., 2012; De Felice, 2013).
AbOs exert multiple neurotoxic actions, including disruptionof neuronal calcium homeostasis (De Felice et al., 2007;Mattson, 2010), abnormal ER calcium release (Paula-Limaet al., 2011), and activation of JNK (De Felice et al., 2009;De Felice, 2013), conditions known to favor the developmentof ER stress in peripheral tissues (Hotamisligil, 2010). ER stressplays a key role in metabolic disorders, including type 2 dia-betes and obesity, and is linked to peripheral insulin resistanceand inflammation (Ozcan et al., 2004). Elevated ER stressmarkers, including eIF2a-P, have been reported in AD brains(Hoozemans et al., 2009; Yoon et al., 2012). Using differentexperimental models, including monkeys that received i.c.v.injections of AbOs, we demonstrate here that eIF2a-P andother ER stress responses are induced by AbOs in neurons.Our findings are in accord with studies that reported elevatedlevels of ER stress markers in other cellular and animalmodels of AD (Yoon et al., 2012) and indicate that pathologicalfindings in those studies can be attributed to the toxic impactof AbOs.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 837
We have identified PKR as an eIF2a kinase activated by AbOsin neurons and shown that AbOs act via the TNF-a pathway toactivate PKR. Active PKR, present in AD brains (Bullido et al.,2008), is an important mediator of inflammation and IRS-1dysfunction in metabolic diseases (Nakamura et al., 2010; Gre-gor and Hotamisligil, 2011). Of direct relevance to the currentstudy, PKR was recently shown to be involved in neuronal IRS-1 inhibition triggered by AbOs (Bomfim et al., 2012) and to nega-
tively regulate memory in mice (Zhu et al., 2011). Current findingsindicate that PKR activation does not depend on direct bindingof oligomers to individual neurons, as elevated phospho-PKRand eIF2a-P levels were detected in neurons regardless ofwhether or not they had oligomers bound to their dendrites.Therefore, AbOs do not seem to act directly on neurons to phos-phorylate PKR. Rather, it is likely that a crosstalk between neu-rons and microglia leads to elevated levels of TNF-a, causing
Figure 6. Antidiabetic Agents Block AbO-Induced eIF2a-P In Vitro and In Vivo(A) PKR-pThr451 immunolabeling in cultured hippocampal neurons exposed for 3 hr to vehicle or 500 nM AbOs in the absence or presence of 1 mM insulin (scale
bar = 10 mm).
(B) PKR-pThr451 immunofluorescence levels, determined from four experiments using independent cultures.
(C) eIF2a-P immunolabeling in hippocampal neurons exposed for 3 hr to 500 nM AbOs, 1 mM insulin + 500 nM AbOs, or 300 nM exendin-4 + 500 nM AbOs (scale
bar = 10 mm).
(D) eIF2a-P immunofluorescence levels (n = 3 experiments using independent cultures; 30 images analyzed per experimental condition per experiment).
**p < 0.01, ANOVA followed by Bonferroni post hoc test.
(E) Immunoblot analysis for eIF2a-P in hippocampal homogenates from 13- to 16-month-old APP/PS1 (n = 7) or exendin-4-treated APP/PS1 (n = 5) mice. Graphs
show means ± SEM.
(F) eIF2a-P immunolabeling in the hippocampi (representative images from CA3) and entorhinal cortices of sham, AbO-injected, or liraglutide-treated and
AbO-injected monkeys (scale bars = 200 mm).
(G and H) eIF2a-P immunolabeling densities in the hippocampi (G) and entorhinal cortices (H) of sham (white bar), AbO-injected (black bar), or liraglutide-treated
AbO-injectedmonkeys (gray bars). Graphs showmeans ± SEM obtained for different animals in each experimental group (n = 3, 4, or 2 for sham, AbO-injected, or
liraglutide-treated AbO-injected monkeys, respectively). Asterisk indicates a statistically significant (p < 0.05; Student’s t test) difference between sham and
AbO-injected animals. See also Figure S6.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
838 Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc.
activation of neuronal TNF-a/PKR/eIF2a signaling. TNF-a hasbeen suggested recently to play a role in brain dysfunction indifferent diseases, including AD, trauma, and Parkinson’s dis-ease (Clark et al., 2012). Elevated TNF-a levels are furtherthought to cause cognitive deficits (He et al., 2007). Our resultsdemonstrate that, in Alzheimer’s disease, elevated TNF-a is aconsequence of the brain accumulation and impact of AbOs.AD is a devastating disease affecting memory. AbOs are
recognized as potent synaptotoxins that inhibit synaptic plas-ticity (Ferreira and Klein, 2011). We found here that oligomer-induced aberrant TNF-a/PKR/eIF2a signaling and induction ofER stress are linked to synapse loss and memory impairment.It is notable that, in both PKR!/! and TNFR1!/! mice, oligomersfailed to trigger eIF2a-P and cognitive impairment. Inhibition ofPKRwas found to attenuate the loss of PSD-95 and synaptophy-sin induced by AbOs, implicating synapse deterioration in thedeleterious impact of PKR on memory. PKR and eIF2a haveboth been shown to be critical for memory regulation (Costa-Mattioli et al., 2007; Zhu et al., 2011). More recently, eIF2a-Pwas found to mediate prion-related neurodegeneration in thehippocampus (Moreno et al., 2012). We report that upregulationof eIF2a-P triggers synapse loss, suggesting that synergisticneurotoxic events that culminate in eIF2a-P may respond, atleast in part, for synapse damage in AD. Our results thus estab-lish that AbO-induced TNFa, PKR, and eIF2a-P dysregulation isdirectly linked to synapse failure and cognitive impairment,revealing a mechanism by which AbOs disrupt memory in AD.The parallel we now describe between AD and diabetes sheds
light on how insulin signaling is impaired in AD. In peripheral tis-sues, inflammatory and metabolic stress signaling cascadestrigger disruption of insulin signaling (Ozcan et al., 2004, 2006;Hotamisligil, 2010; Nakamura et al., 2010; Gregor and Hotamisli-gil, 2011). Our findings show that ER stress is linked to neuronalIRS-1 inhibition andmay act synergistically with proinflammatorysignals to disrupt brain insulin signaling in AD.It is important to note that our conclusion that TNF-a signaling
is linked to both defective brain insulin signaling and memoryimpairment caused by AbOs does not necessarily imply thatmemory impairment is a direct consequence of disruption ofinsulin signaling. In fact, the role of insulin signaling in memoryformation, and how defective signaling might result in neurode-generative disorders, is still under investigation. While insulinhas been shown to positively modulate hippocampal synapticplasticity (van der Heide et al., 2005), an early study showedthat spatial memory was preserved in neural-specific insulin re-ceptor b subunit knockout (NIRKO) mice (Schubert et al., 2004).A recent study, however, reported that IRb haploinsufficiencycauses reduced brain insulin signaling and defects in late-phaselong-term potentiation (LTP) and long-term recognition memorystorage, thereby implicating insulin receptor (IR)-dependentmechanisms in memory formation (Nistico et al., 2012). Signifi-cantly, intranasal insulin administration has been found toenhance memory in healthy volunteers (Benedict et al., 2004),in memory-impaired older subjects (Reger et al., 2006), andin early AD patients (Craft et al., 2012), with beneficial effectsreported for both acute and long-term insulin treatment.In sporadic AD (which corresponds to >90% of AD cases), the
exact mechanism that leads to accumulation of Ab oligomersand amyloid in the brain remains to be fully elucidated. Interest-
ingly, eIF2a-P promotes BACE1 expression, Ab production, anddeposition (O’Connor et al., 2008). Thus, AbO-induced TNF-a,PKR, and eIF2a-P may constitute a hub in a feedforward delete-rious cycle involving increased AbO generation and perpetuationand amplification of neuronal dysfunction.In line with our current findings demonstrating that eIF2a-P is
sufficient to cause synapse loss and memory impairment inmice, a very recent study showed that the eIF2a kinase PERKmediates Ab-induced LTP impairment (Ma et al., 2013). Impor-tantly, Ma and colleagues further reported that genetically sup-pressing the eIF2a kinases PERK or GCN2 prevented spatialmemory impairment in AD mice (Ma et al., 2013). Althoughthe complete set of mechanisms remains to be elucidated,it is conceivable that TNF-a represents an initial trigger thatorchestrates activation of multiple stress response pathways(of which the PKR/eIF2a pathway here investigated appearscentral) that culminate with synapse dysfunction and memoryloss in AD.In recent years, there has been a strong effort to develop new
therapeutic strategies for diabetes and insulin resistance disor-ders. GLP-1 receptor stimulation has insulinotropic action andrestores glucose homeostasis in peripheral tissue (Yusta et al.,2006), and several GLP-1 analogs are currently used for diabetestreatment. We demonstrate here that both insulin and GLP-1Ragonists prevent abnormal neuronal phospho-PKR and eIF2a-P.The observation that insulin protects neurons from AbO-inducedPKR activation suggests that blockade of eIF2a-P by insulin ismediated by suppression of PKR. Recent studies have shownbeneficial effects of exendin-4 and liraglutide against neurode-generation and cognitive impairment in AD models (Li et al.,2010; McClean et al., 2011; Bomfim et al., 2012), but thesignaling mechanisms involved in neuroprotection are onlypartially known. The present study suggests a mechanisminvolving suppression of the PKR/eIF2a-P pathway. Importantly,we provide evidence that a GLP-1R agonist exerts neuroprotec-tive actions in the primate brain, as systemic liraglutide treatmentreduced oligomer-induced brain eIF2a-P in monkeys.In conclusion, our findings establish that activation of TNF-a
signaling mediates AbO-induced brain IRS-1 inhibition andPKR-dependent eIF2a-P, synapse loss, and memory impair-ment (Figure 7), revealing mechanisms that lead to synapseloss and memory impairment. Identifying a pathogenic mecha-nism that is shared between AD and diabetes and contributesto memory loss in AD may open avenues for rapid implemen-tation of clinically approved antidiabetic drugs as therapeuticsin AD.
EXPERIMENTAL PROCEDURES
Ab OligomersOligomers were prepared weekly from synthetic Ab1–42 and routinely charac-
terized by size-exclusion chromatography and, occasionally, by western
immunoblots and transmission electron microscopy, as previously described
(De Felice et al., 2007, 2008; Sebollela et al., 2012). Oligomers were kept at
4"C and used within 48 hr of preparation.
Mature Hippocampal CulturesPrimary rat hippocampal neuronal cultures, prepared and developed in
Neurobasal Medium supplemented with B27 (Invitrogen) and antibiotics
according to established procedures (De Felice et al., 2007), were used after
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 839
18–21 days in vitro. All procedures were approved by the Institutional Animal
Care and Use Committee of the Federal University of Rio de Janeiro (protocol
#IBqM 022). Cultures were exposed at 37!C for 3 hr to 500 nM Ab oligomers
or an equivalent volume of vehicle (2% DMSO in phosphate-buffered
saline [PBS]). When present, PKR inhibitor (1 mM), insulin (1 mM), exendin-4
(300 nM), SP600125 (10 mM), or infliximab (1 mg/mL) were added to cultures
30 min before Ab oligomers. For ER stress induction, thapsigargin (1 mM)
was added to neuronal cultures for 3 hr, and in some experiments 4-phenylbu-
tyrate (4-PBA) (1 mM) was also present. For eIF2a-P induction, salubrinal
(10 mM) was added to neuronal cultures for 3 hr.
Experimental SubjectsMale Swiss mice were obtained from our animal facility (Federal University of
Rio de Janeiro) and were 2.5–3 months old at the beginning of experiments.
PKR"/" male mice on a 129/SvEv background (Yang et al., 1995) were
obtained from Federal University of Minas Gerais Animal Centre. 129/SvEv
wild-type mice were used as controls for experiments with PKR"/" mice.
TNFR1"/" (TNFRp55"/") female mice on a C57BL/6 background (Pfeffer
et al., 1993) were obtained from the University of Campinas Breeding Centre
and were 3 months old at the beginning of experiments. C57BL/6 wild-type
mice were used as controls for experiments with TNFR1"/" mice. APPSwe/
PS1DE9 mice on a C57BL/6 background (Jankowsky et al., 2001) were ob-
tained from The Jackson Laboratory. Wild-type littermates were used as con-
trols. Animals were genotyped prior to the studies using specific primers (see
Supplemental Experimental Procedures). All procedures involving transgenic
mice were approved by the Institutional Animal Care and Use Committee of
the Federal University of Rio de Janeiro (protocol #IBqM 055). Animals were
housed in groups of five in each cage with free access to food and water,
with controlled room temperature and humidity, and under a 12 hr light/12 hr
dark cycle. All procedures used in the present study followed the ‘‘Principles
of Laboratory Animal Care’’ from the US National Institutes of Health.
Intracerebroventricular Injections in MiceFor i.c.v. injection of AbOs, animals were anesthetized for 7 min with 2.5% iso-
flurane (Cristalia) using a vaporizer system and gently restrained only during
the injection procedure itself, as described (Figueiredo et al., 2013; Ledo
et al., 2013). A 2.5 mm long needle was unilaterally inserted 1 mm to the right
of the midline point equidistant from each eye and 1 mm posterior to a line
drawn through the anterior base of the eye (Ledo et al., 2013). AbOs
(10 pmol), 1 mg of thapsigargin, or vehicle was injected in a final volume of
3 ml, and the needle was kept in place for 30 s to avoid backflow. Before eutha-
nasia, blue staining was injected using the same hole used previously, which
allowed us to determine the accurate placement of the injection. Behavioral
results from mice that showed signs of misplaced injections or any sign of
hemorrhage were excluded from the final statistical analysis (this happened
in 5% of cases, on average).
In Vivo Drug Treatments in MiceExendin-4 and liraglutide are two long-lasting GLP-1 receptor agonists.
APPSwe/PS1DE9 mice (13–14 months old) received daily intraperitoneal
injections of exendin-4 (25 nmol/kg, dissolved in saline) or vehicle (saline) for
3 weeks. Another group of transgenic animals received daily intraperitoneal
injections of liraglutide (25 nmol/kg, dissolved in saline) or vehicle (saline) for
6 weeks. Male Swiss mice (3 months old) received daily intraperitoneal
injections of infliximab (20 mg/day) for 7 days starting immediately after i.c.v.
injection of AbOs. In experiments with 4-phenylbutyrate (4-PBA), one intraper-
itoneal injection (200mg/kg) was given immediately after i.c.v injection of either
Ab oligomers or thapsigargin in male Swiss mice. 4-PBA solutions were pre-
pared as described. Salubrinal (1 mg/kg) or vehicle was administered intraper-
itoneally in 3-month-old male Swiss mice for 7 days before cognitive analysis
(Moreno et al., 2012). All procedures were approved by the Institutional Animal
Care and Use Committee of the Federal University of Rio de Janeiro (protocol
#IBqM 041).
Intracerebroventricular Injection of Ab Oligomers in Monkeys andTreatment with LiraglutideAdult cynomolgus monkeys (Macaca fascicularis) (n = 9) were used (body
weights 4.7–7.0 kg). All procedures were approved by the Queen’s University
Animal Care Committee and were in full compliance with the Canada Council
on Animal Care (Animal Care Protocol Original Munoz-2011-039-Or). Animals
were under the close supervision of an animal technician and the institute
veterinarian. AbOs were infused chronically through an intracerebroventricular
cannula. A total of 4 animals received 100 mg Ab oligomers i.c.v. every 3 days
for 24 days, while 3 animals served as sham-operated controls. Control
animals had the cannula implanted into the lateral ventricle in the samemanner
as the experimental animals but did not receive oligomer injections. Two addi-
tional animals received daily subcutaneous injections of liraglutide (25 nmol/kg)
beginning 1 week prior to Ab oligomer infusion and continuing until the end
of AbO injections. Oligomers were freshly prepared and characterized by
size-exclusion chromatography before each injection. Upon completion of
the experimental protocol, animals were sedated with ketamine (10 mg/kg,
intramuscular) plus buprenorphine (0.01 mg/kg) for analgesia, followed by
intravenous sodium pentobarbital (25 mg/kg). Next, animals were perfused
with PBS and then, sequentially, by 4% paraformaldehyde in PBS, 4% para-
formaldehyde in PBS containing 2.5% glycerol, PBS + 5% glycerol, and
PBS + 10% glycerol. Serial brain sections (40 mm thick) were obtained, and
neuropathological analyses were performed.
Figure 7. Ab Oligomers Trigger Synapse Loss, Memory Impairment,and IRS-1 Inhibition via TNF-a/PKR SignalingAb oligomers lead to increased brain levels of TNF-a, leading to TNFR1-
mediated activation of PKR and other stress kinases. Activated PKR phos-
phorylates neuronal IRS-1 (see also Bomfim et al., 2012) and eIF2a. Increased
eIF2a-P levels trigger synapse loss and memory impairment.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
840 Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc.
Statistical AnalysisAll analyses were performed with GraphPad Prism, and data sets were
assessed for normality parameters prior to significance determination. Values
are expressed as means ± SEM, unless otherwise stated. Statistical confi-
dence levels are indicated in each figure (*p < 0.05; **p < 0.01).
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures
and six figures and can be found with this article online at http://dx.doi.org/
10.1016/j.cmet.2013.11.002.
AUTHOR CONTRIBUTIONS
M.V.L., D.P.M., S.T.F., and F.G.D.F. designed the study. M.V.L., J.R.C., R.L.F.,
T.R.B., L.F.-G., A.F.B., J.B.-M., L.F.-C., C.A.S., L.B.S., and S.E.-S. performed
the research. M.V.L., T.R.B., C.A.S., L.F.-C., P.C.-C., O.B.A., S.T.F., and
F.G.D.F. analyzed data. J.B.C., L.A.V., A.M.S., W.L.K., and C.H. contributed
animals, reagents, materials, and analysis tools. M.V.L., J.-C.H., D.P.M.,
S.T.F., and F.G.D.F. analyzed and discussed results. M.V.L., S.T.F., and
F.G.D.F. wrote the manuscript.
ACKNOWLEDGMENTS
This work was supported by grants from Human Frontiers Science Program
(HFSP) (to F.G.D.F.), National Institute for Translational Neuroscience (INNT/
Brazil), the Brazilian funding agencies Conselho Nacional de Desenvolvimento
Cientıfico e Tecnologico (CNPq) and Fundacao de Amparo a Pesquisa do
Estado do Rio de Janeiro (FAPERJ) (to S.T.F. and F.G.D.F.), Canadian Insti-
tutes for Health Research (CIHR), and Canada Research Chair Program
(to D.P.M.). M.V.L., L.B.S., L.F.-G., A.F.B., T.R.B., J.B.-M., and L.F.-C. were
supported by CNPq predoctoral fellowships. We thank Drs. Matthias Gralle,
Wagner Seixas, and Claudio A. Masuda (Federal University of Rio de Janeiro,
Brazil) for insightful discussions and Dr. Claudia P. Figueiredo (Federal Univer-
sity of Rio de Janeiro, Brazil) for advice on immunohistochemical analysis of
monkey brains. W.L.K. is a cofounder of Acumen Pharmaceuticals, which
has been licensed by Northwestern University to develop ADDL technology
for Alzheimer’s therapeutics and diagnostics.
Received: August 2, 2012
Revised: September 17, 2013
Accepted: October 18, 2013
Published: December 3, 2013
REFERENCES
Bao, F., Wicklund, L., Lacor, P.N., Klein, W.L., Nordberg, A., and Marutle, A.
(2012). Different b-amyloid oligomer assemblies in Alzheimer brains correlate
with age of disease onset and impaired cholinergic activity. Neurobiol. Aging
33, e1–e13.
Benedict, C., Hallschmid, M., Hatke, A., Schultes, B., Fehm, H.L., Born, J.,
and Kern, W. (2004). Intranasal insulin improves memory in humans.
Psychoneuroendocrinology 29, 1326–1334.
Birkenfeld, A.L., Lee, H.Y., Majumdar, S., Jurczak, M.J., Camporez, J.P.,
Jornayvaz, F.R., Frederick, D.W., Guigni, B., Kahn, M., Zhang, D., et al.
(2011). Influence of the hepatic eukaryotic initiation factor 2alpha (eIF2alpha)
endoplasmic reticulum (ER) stress response pathway on insulin-mediated
ER stress and hepatic and peripheral glucose metabolism. J. Biol. Chem.
286, 36163–36170.
Bomfim, T.R., Forny-Germano, L., Sathler, L.B., Brito-Moreira, J., Houzel, J.C.,
Decker, H., Silverman, M.A., Kazi, H., Melo, H.M., McClean, P.L., et al. (2012).
An anti-diabetes agent protects the mouse brain from defective insulin
signaling caused by Alzheimer’s disease- associated Ab oligomers. J. Clin.
Invest. 122, 1339–1353.
Bullido, M.J., Martınez-Garcıa, A., Tenorio, R., Sastre, I., Munoz, D.G., Frank,
A., and Valdivieso, F. (2008). Double stranded RNA activated EIF2 a kinase
(EIF2AK2; PKR) is associated with Alzheimer’s disease. Neurobiol. Aging 29,
1160–1166.
Chiu, S.-L., Chen, C.-M., and Cline, H.T. (2008). Insulin receptor signaling
regulates synapse number, dendritic plasticity, and circuit function in vivo.
Neuron 58, 708–719.
Clark, I., Atwood, C., Bowen, R., Paz-Filho, G., and Vissel, B. (2012). Tumor
necrosis factor-induced cerebral insulin resistance in Alzheimer’s disease links
numerous treatment rationales. Pharmacol. Rev. 64, 1004–1026.
Costa-Mattioli, M., Gobert, D., Stern, E., Gamache, K., Colina, R., Cuello, C.,
Sossin, W., Kaufman, R., Pelletier, J., Rosenblum, K., et al. (2007). eIF2a
phosphorylation bidirectionally regulates the switch from short- to long-term
synaptic plasticity and memory. Cell 129, 195–206.
Craft, S., Baker, L.D., Montine, T.J., Minoshima, S., Watson, G.S., Claxton, A.,
Arbuckle, M., Callaghan, M., Tsai, E., Plymate, S.R., et al. (2012). Intranasal
insulin therapy for Alzheimer disease and amnestic mild cognitive impairment:
a pilot clinical trial. Arch. Neurol. 69, 29–38.
De Felice, F.G. (2013). Alzheimer’s disease and insulin resistance: translating
basic science into clinical applications. J. Clin. Invest. 123, 531–539.
De Felice, F.G., Velasco, P.T., Lambert, M.P., Viola, K., Fernandez, S.J.,
Ferreira, S.T., and Klein, W.L. (2007). Abeta oligomers induce neuronal
oxidative stress through an N-methyl-D-aspartate receptor-dependent
mechanism that is blocked by the Alzheimer drug memantine. J. Biol. Chem.
282, 11590–11601.
De Felice, F.G., Wu, D., Lambert, M.P., Fernandez, S.J., Velasco, P.T., Lacor,
P.N., Bigio, E.H., Jerecic, J., Acton, P.J., Shughrue, P.J., et al. (2008).
Alzheimer’s disease-type neuronal tau hyperphosphorylation induced by A
beta oligomers. Neurobiol. Aging 29, 1334–1347.
De Felice, F.G., Vieira, M.N.N., Bomfim, T.R., Decker, H., Velasco, P.T.,
Lambert, M.P., Viola, K.L., Zhao, W.Q., Ferreira, S.T., and Klein, W.L. (2009).
Protection of synapses against Alzheimer’s-linked toxins: insulin signaling
prevents the pathogenic binding of Abeta oligomers. Proc. Natl. Acad. Sci.
USA 106, 1971–1976.
de la Monte, S.M., and Wands, J.R. (2008). Alzheimer’s disease is type 3
diabetes-evidence reviewed. J. Diabetes Sci. Tech. 2, 1101–1113.
Ferreira, S.T., and Klein, W.L. (2011). The Ab oligomer hypothesis for synapse
failure and memory loss in Alzheimer’s disease. Neurobiol. Learn. Mem. 96,
529–543.
Figueiredo, C.P., Clarke, J.R., Ledo, J.H., Ribeiro, F.C., Costa, C.V., Melo,
H.M., Mota-Sales, A.P., Saraiva, L.M., Klein, W.L., Sebollela, A., et al. (2013).
Memantine rescues transient cognitive impairment caused by high-molecu-
lar-weight ab oligomers but not the persistent impairment induced by low-
molecular-weight oligomers. J. Neurosci. 33, 9626–9634.
Gkogkas, C., Sonenberg, N., and Costa-Mattioli, M. (2010). Translational con-
trol mechanisms in long-lasting synaptic plasticity and memory. J. Biol. Chem.
285, 31913–31917.
Gong, Y., Chang, L., Viola, K.L., Lacor, P.N., Lambert, M.P., Finch, C.E., Krafft,
G.A., and Klein, W.L. (2003). Alzheimer’s disease-affected brain: presence of
oligomeric A b ligands (ADDLs) suggests a molecular basis for reversible
memory loss. Proc. Natl. Acad. Sci. USA 100, 10417–10422.
Gregor, M.F., and Hotamisligil, G.S. (2011). Inflammatory mechanisms in
obesity. Annu. Rev. Immunol. 29, 415–445.
He, P., Zhong, Z., Lindholm, K., Berning, L., Lee, W., Lemere, C., Staufenbiel,
M., Li, R., and Shen, Y. (2007). Deletion of tumor necrosis factor death receptor
inhibits amyloid b generation and prevents learning and memory deficits in
Alzheimer’s mice. J. Cell Biol. 178, 829–841.
Hoozemans, J.J.M., Veerhuis, R., Van Haastert, E.S., Rozemuller, J.M., Baas,
F., Eikelenboom, P., and Scheper, W. (2005). The unfolded protein response
is activated in Alzheimer’s disease. Acta Neuropathol. 110, 165–172.
Hoozemans, J.J.M., van Haastert, E.S., Nijholt, D.A.T., Rozemuller, A.J.M.,
Eikelenboom, P., and Scheper, W. (2009). The unfolded protein response is
activated in pretangle neurons in Alzheimer’s disease hippocampus. Am. J.
Pathol. 174, 1241–1251.
Hotamisligil, G.S. (2010). Endoplasmic reticulum stress and the inflammatory
basis of metabolic disease. Cell 140, 900–917.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 841
Hotamisligil, G.S., Budavari, A., Murray, D., and Spiegelman, B.M. (1994).
Reduced tyrosine kinase activity of the insulin receptor in obesity-diabetes.
Central role of tumor necrosis factor-a. J. Clin. Invest. 94, 1543–1549.
Hotamisligil, G.S., Peraldi, P., Budavari, A., Ellis, R., White, M.F., and
Spiegelman, B.M. (1996). IRS-1-mediated inhibition of insulin receptor
tyrosine kinase activity in TNF-a- and obesity-induced insulin resistance.
Science 271, 665–668.
Jankowsky, J.L., Slunt, H.H., Ratovitski, T., Jenkins, N.A., Copeland, N.G., and
Borchelt, D.R. (2001). Co-expression of multiple transgenes in mouse CNS:
a comparison of strategies. Biomol. Eng. 17, 157–165.
Janson, J., Laedtke, T., Parisi, J.E., O’Brien, P.O., Petersen, R.C., and Butler,
P.C. (2004). Increased risk of type 2 diabetes in Alzheimer disease. Diabetes
53, 474–481.
Lacor, P.N., Buniel, M.C., Furlow, P.W., Clemente, A.S., Velasco, P.T., Wood,
M., Viola, K.L., and Klein, W.L. (2007). Abeta oligomer-induced aberrations in
synapse composition, shape, and density provide a molecular basis for loss
of connectivity in Alzheimer’s disease. J. Neurosci. 27, 796–807.
Lai, E., Teodoro, T., and Volchuk, A. (2007). Endoplasmic reticulum stress:
signaling the unfolded protein response. Physiology (Bethesda) 22, 193–201.
Ledo, J.H., Azevedo, E.P., Clarke, J.R., Ribeiro, F.C., Figueiredo, C.P., Foguel,
D., De Felice, F.G., and Ferreira, S.T. (2013). Amyloid-b oligomers link
depressive-like behavior and cognitive deficits in mice. Mol. Psychiatry 18,
1053–1054.
Li, Y., Duffy, K.B., Ottinger, M.A., Ray, B., Bailey, J.A., Holloway, H.W.,
Tweedie, D., Perry, T., Mattson, M.P., Kapogiannis, D., et al. (2010). GLP-1
receptor stimulation reduces amyloid-b peptide accumulation and cytotoxicity
in cellular and animal models of Alzheimer’s disease. J. Alzheimers Dis. 19,
1205–1219.
Ma, Q.L., Yang, F., Rosario, E.R., Ubeda, O.J., Beech, W., Gant, D.J., Chen,
P.P., Hudspeth, B., Chen, C., Zhao, Y., et al. (2009). b-amyloid oligomers
induce phosphorylation of tau and inactivation of insulin receptor substrate
via c-Jun N-terminal kinase signaling: suppression by omega-3 fatty acids
and curcumin. J. Neurosci. 29, 9078–9089.
Ma, T., Trinh, M.A., Wexler, A.J., Bourbon, C., Gatti, E., Pierre, P., Cavener,
D.R., and Klann, E. (2013). Suppression of eIF2a kinases alleviates
Alzheimer’s disease-related plasticity and memory deficits. Nat. Neurosci.
16, 1299–1305.
Mattson, M.P. (2010). ER calcium and Alzheimer’s disease: in a state of flux.
Sci. Signal. 3, pe10.
McClean, P.L., Parthsarathy, V., Faivre, E., and Holscher, C. (2011). The
diabetes drug liraglutide prevents degenerative processes in a mouse model
of Alzheimer’s disease. J. Neurosci. 31, 6587–6594.
McNay, E.C., and Recknagel, A.K. (2011). Brain insulin signaling: a key compo-
nent of cognitive processes and a potential basis for cognitive impairment
in type 2 diabetes. Neurobiol. Learn. Mem. 96, 432–442.
Moloney, A.M., Griffin, R.J., Timmons, S., O’Connor, R., Ravid, R., and O’Neill,
C. (2010). Defects in IGF-1 receptor, insulin receptor and IRS-1/2 in
Alzheimer’s disease indicate possible resistance to IGF-1 and insulin signal-
ling. Neurobiol. Aging 31, 224–243.
Moreno, J.A., Radford, H., Peretti, D., Steinert, J.R., Verity, N., Martin, M.G.,
Halliday, M., Morgan, J., Dinsdale, D., Ortori, C.A., et al. (2012). Sustained
translational repression by eIF2a-P mediates prion neurodegeneration.
Nature 485, 507–511.
Nakamura, T., Furuhashi, M., Li, P., Cao, H., Tuncman, G., Sonenberg, N.,
Gorgun, C.Z., and Hotamisligil, G.S. (2010). Double-stranded RNA-dependent
protein kinase links pathogen sensing with stress and metabolic homeostasis.
Cell 140, 338–348.
Nistico, R., Cavallucci, V., Piccinin, S., Macrı, S., Pignatelli, M., Mehdawy, B.,
Blandini, F., Laviola, G., Lauro, D., Mercuri, N.B., and D’Amelio, M. (2012).
Insulin receptor b-subunit haploinsufficiency impairs hippocampal late-phase
LTP and recognition memory. Neuromolecular Med. 14, 262–269.
O’Connor, T., Sadleir, K.R., Maus, E., Velliquette, R.A., Zhao, J., Cole, S.L.,
Eimer, W.A., Hitt, B., Bembinster, L.A., Lammich, S., et al. (2008).
Phosphorylation of the translation initiation factor eIF2a increases BACE1
levels and promotes amyloidogenesis. Neuron 60, 988–1009.
Ott, A., Stolk, R.P., Hofman, A., van Harskamp, F., Grobbee, D.E., and
Breteler, M.M.B. (1996). Association of diabetes mellitus and dementia: the
Rotterdam Study. Diabetologia 39, 1392–1397.
Ozcan, U., Cao, Q., Yilmaz, E., Lee, A.H., Iwakoshi, N.N., Ozdelen, E.,
Tuncman, G., Gorgun, C.Z., Glimcher, L.H., and Hotamisligil, G.S. (2004).
Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes.
Science 306, 457–461.
Ozcan, U., Yilmaz, E., Ozcan, L., Furuhashi, M., Vaillancourt, E., Smith, R.O.,
Gorgun, C.Z., and Hotamisligil, G.S. (2006). Chemical chaperones reduce
ER stress and restore glucose homeostasis in a mouse model of type 2 dia-
betes. Science 313, 1137–1140.
Park, S.W., Zhou, Y., Lee, J., Lu, A., Sun, C., Chung, J., Ueki, K., and Ozcan, U.
(2010). The regulatory subunits of PI3K, p85alpha and p85beta, interact with
XBP-1 and increase its nuclear translocation. Nat. Med. 16, 429–437.
Paula-Lima, A.C., Adasme, T., SanMartın, C., Sebollela, A., Hetz, C., Carrasco,
M.A., Ferreira, S.T., and Hidalgo, C. (2011). Amyloid b-peptide oligomers stim-
ulate RyR-mediated Ca2+ release inducing mitochondrial fragmentation in
hippocampal neurons and prevent RyR-mediated dendritic spine remodeling
produced by BDNF. Antioxid. Redox Signal. 14, 1209–1223.
Pfeffer, K., Matsuyama, T., Kundig, T.M., Wakeham, A., Kishihara, K.,
Shahinian, A., Wiegmann, K., Ohashi, P.S., Kronke, M., and Mak, T.W.
(1993). Mice deficient for the 55 kd tumor necrosis factor receptor are resistant
to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 73,
457–467.
Raven, J.F., and Koromilas, A.E. (2008). PERK and PKR: old kinases learn new
tricks. Cell Cycle 7, 1146–1150.
Reger, M.A., Watson, G.S., Frey, W.H., 2nd, Baker, L.D., Cholerton, B.,
Keeling, M.L., Belongia, D.A., Fishel, M.A., Plymate, S.R., Schellenberg,
G.D., et al. (2006). Effects of intranasal insulin on cognition in memory-
impaired older adults: modulation by APOE genotype. Neurobiol. Aging 27,
451–458.
Ryan, G.J., and Hardy, Y. (2011). Liraglutide: once-daily GLP-1 agonist for the
treatment of type 2 diabetes. J. Clin. Pharm. Ther. 36, 260–274.
Schubert, M., Gautam, D., Surjo, D., Ueki, K., Baudler, S., Schubert, D.,
Kondo, T., Alber, J., Galldiks, N., Kustermann, E., et al. (2004). Role for
neuronal insulin resistance in neurodegenerative diseases. Proc. Natl. Acad.
Sci. USA 101, 3100–3105.
Sebollela, A., Freitas-Correa, L., Oliveira, F.F., Paula-Lima, A.C., Saraiva, L.M.,
Martins, S.M., Mota, L.D., Torres, C., Alves-Leon, S., de Souza, J.M., et al.
(2012). Amyloid-b oligomers induce differential gene expression in adult
human brain slices. J. Biol. Chem. 287, 7436–7445.
Steinberg, G.R., Michell, B.J., van Denderen, B.J.W., Watt, M.J., Carey, A.L.,
Fam, B.C., Andrikopoulos, S., Proietto, J., Gorgun, C.Z., Carling, D., et al.
(2006). Tumor necrosis factor a-induced skeletal muscle insulin resistance
involves suppression of AMP-kinase signaling. Cell Metab. 4, 465–474.
Talbot, K.,Wang, H.Y., Kazi, H., Han, L.Y., Bakshi, K.P., Stucky, A., Fuino, R.L.,
Kawaguchi, K.R., Samoyedny, A.J., Wilson, R.S., et al. (2012). Demonstrated
brain insulin resistance in Alzheimer’s disease patients is associated with
IGF-1 resistance, IRS-1 dysregulation, and cognitive decline. J. Clin. Invest.
122, 1316–1338.
Terry, R.D., Masliah, E., Salmon, D.P., Butters, N., DeTeresa, R., Hill, R.,
Hansen, L.A., and Katzman, R. (1991). Physical basis of cognitive alterations
in Alzheimer’s disease: synapse loss is the major correlate of cognitive impair-
ment. Ann. Neurol. 30, 572–580.
Tomiyama, T., Matsuyama, S., Iso, H., Umeda, T., Takuma, H., Ohnishi, K.,
Ishibashi, K., Teraoka, R., Sakama, N., Yamashita, T., et al. (2010). A mouse
model of amyloid b oligomers: their contribution to synaptic alteration,
abnormal tau phosphorylation, glial activation, and neuronal loss in vivo.
J. Neurosci. 30, 4845–4856.
van der Heide, L.P., Kamal, A., Artola, A., Gispen, W.H., and Ramakers, G.M.J.
(2005). Insulin modulates hippocampal activity-dependent synaptic plasticity
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
842 Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc.
in a N-methyl-d-aspartate receptor and phosphatidyl-inositol-3-kinase-
dependent manner. J. Neurochem. 94, 1158–1166.
Winnay, J.N., Boucher, J., Mori, M.A., Ueki, K., and Kahn, C.R. (2010). A reg-
ulatory subunit of phosphoinositide 3-kinase increases the nuclear accumula-
tion of X-box-binding protein-1 to modulate the unfolded protein response.
Nat. Med. 16, 438–445.
Xu, J., Gontier, G., Chaker, Z., Lacube, P., Dupont, J., and Holzenberger, M.
(2013). Longevity effect of IGF-1R(+/-) mutation depends on genetic back-
ground-specific receptor activation. Aging Cell. Published online July 30,
2013. http://dx.doi.org/10.1111/acel.12145.
Yang, Y.L., Reis, L.F., Pavlovic, J., Aguzzi, A., Schafer, R., Kumar, A.,
Williams, B.R., Aguet, M., and Weissmann, C. (1995). Deficient signaling in
mice devoid of double-stranded RNA-dependent protein kinase. EMBO J.
14, 6095–6106.
Yoon, S.O., Park, D.J., Ryu, J.C., Ozer, H.G., Tep, C., Shin, Y.J., Lim, T.H.,
Pastorino, L., Kunwar, A.J., Walton, J.C., et al. (2012). JNK3 perpetuates
metabolic stress induced by Ab peptides. Neuron 75, 824–837.
Yusta, B., Baggio, L.L., Estall, J.L., Koehler, J.A., Holland, D.P., Li, H.,
Pipeleers, D., Ling, Z., and Drucker, D.J. (2006). GLP-1 receptor activation
improves b cell function and survival following induction of endoplasmic
reticulum stress. Cell Metab. 4, 391–406.
Zhao, W.Q., De Felice, F.G., Fernandez, S., Chen, H., Lambert, M.P., Quon,
M.J., Krafft, G.A., and Klein, W.L. (2008). Amyloid beta oligomers induce
impairment of neuronal insulin receptors. FASEB J. 22, 246–260.
Zhu, P.J., Huang, W., Kalikulov, D., Yoo, J.W., Placzek, A.N., Stoica, L., Zhou,
H., Bell, J.C., Friedlander, M.J., Krnjevi!c, K., et al. (2011). Suppression of
PKR promotes network excitability and enhanced cognition by interferon-g-
mediated disinhibition. Cell 147, 1384–1396.
Cell Metabolism
TNF-a, PKR, Insulin Signaling, and Memory
Cell Metabolism 18, 831–843, December 3, 2013 ª2013 Elsevier Inc. 843
Cell Metabolism, Volume 18
Supplemental Information
TNF-� Mediates Brain IRS-1 Inhibition and PKR-Dependent Memory Impairment Induced by
���������-Linked �-Amyloid Oligomers in Mice and Monkeys
Mychael V. Lourenco, Julia R. Clarke, Rudimar L. Frozza, Theresa R. Bomfim, Letícia Forny-Germano, André F. Batista, Luciana B. Sathler, Jordano Brito-Moreira, Olavo B. Amaral, Cesar A. Silva, Léo Freitas-Correa, Sheila Espírito-Santo, Paula Campello-Costa, Jean-Christophe Houzel, William L. Klein, Christian Holscher, José B. Carvalheira, Aristobolo M. Silva, Lício A. Velloso, Douglas P. Munoz, Sergio T. Ferreira, and Fernanda G. De Felice!
Lourenco et al, Figure S1
Lourenco et al, Figure S2
Lourenco et al, Figure S3
Lourenco et al, Figure S4
Lourenco et al, Figure S5
Lourenco et al, Figure S6
Supplemental Figure Legends
Figure S1, related to Figure 1 – A"O-induced ER stress, eIF2!-P and phospho-
PKR in hippocampal neurons. A, IRE1!-pSer724 immunolabeling (yellow),
showing intense perinuclear immunoreactivity. B-D, Immunoblot analyses for spliced
XBP1 (XBP1s) (B), eIF2!-pSer51 (C) and GRP78 (D) in hippocampal cultures
exposed to vehicle or 500 nM A!Os for 3 hours (n = 3 independent experiments). E,
CHOP/gadd153 mRNA levels in hippocampal cultures exposed to vehicle or 500 nM
A!Os for 24 hours (n = 4 independent experiments). No change in CHOP mRNA
level was detected after 12-hour exposure to A"Os. * p < 0.05, Student’s t-test.
Graphs show means ± standard error (SEM). F,H, eIF2!-P (F) and phospho-PKR (H)
immunoreactivities in hippocampal CA2 and subiculum of cynomolgus monkeys that
received i.c.v. injections of A!Os compared to sham-operated control monkeys (scale
bar = 200 µm). G, I, eIF2!-P (G) and phospho-PKR (I) immunolabeling densities in
CA2 (upper graph) and subiculum (lower graph) in sham or A!O-injected monkeys.
Graphs show means ± standard error (SEM) of animals. N = 3 and 4 for sham and
A"O-injected monkeys, respectively. *p < 0.05, Student’s t-test.
Figure S2, related to Figure 2 – PERK is not activated by A"Os in hippocampal
neurons. A, PERK-pThr981 immunolabeling (green) in hippocampal neurons exposed
to vehicle or 500 nM A!Os for 3 h (scale bar = 10 µm). A!O-specific NU4 labeling is
shown in red. B, PERK-pThr981 immunofluorescence levels (n = 4 experiments using
independent cultures; 30 images analyzed/experimental condition/experiment). C,
Immunoblot analysis for PERK-pThr981 (normalized by total PERK) in hippocampal
homogenates from 13-16 month old WT (n = 5) or APP/PS1 (n = 7) mice. Graphs
show means ± standard error (SEM).
Figure S3, related to Figure 3 – TNFR1-mediated memory impairment caused
by A" oligomers. Step-down latency of WT or TNFR1-/- mice injected with vehicle
or 10 pmol A!Os in the step-down inhibitory avoidance task (* p < 0.05, ANOVA
followed by Bonferroni post-hoc test). Graphs show means ± standard error (SEM).
Figure S4, related to Figure 4 – Salubrinal causes neuronal eIF2!-P in vitro and
in vivo. A, eIF2!-P immunolabeling in cultured hippocampal neurons exposed for 3
hours to vehicle or 10 µM salubrinal. B, Quantification of eIF2!-P levels, determined
from 3 experiments using independent cultures. C, Immunoblot analysis of eIF2!-P
levels (normalized by total eIF2!) in hippocampal homogenates of 2-3 month old
mice injected i.p. with vehicle or 1 mg/kg salubrinal for 7 days (n=7 per experimental
group). * p < 0.05, Student’s t-test. Graphs show means ± standard error (SEM).
Figure S5, related to Figure 5 – ER stress promotes neuronal eIF2!-P and
cognitive impairment in mice. A, eIF2!-P immunolabeling in cultured hippocampal
neurons exposed for 3 hours to vehicle or 1 µM thapsigargin. B, Quantification of
eIF2!-P levels, determined from 3 experiments using independent cultures. C,
Immunoblot analysis of eIF2!-P levels (normalized by total eIF2!) in hippocampal
homogenates of 2-3 month old mice injected i.c.v. with vehicle or a single dose of 1
µg thapsigargin (n=7 per experimental group). D, Exploration times of mice i.c.v.
injected with vehicle (white bars), 1 µg thapsigargin in the absence (black bars) or
presence (dashed bars) of 200 mg/kg 4-phenylbutyrate (4-PBA) in the novel object
recognition task (n=10 per experimental group). E, Exploration times of mice injected
with vehicle (white bars), 10 pmol A!Os (i.c.v.) in the absence (black bars) or
presence (hatched bars) of 200 mg/kg 4-PBA (i.p.) in the novel object recognition
task (n=10 per experimental group). Asterisks denote a statistically significant (p <
0.05) difference from 50% (reference value). Graphs show means ± standard error
(SEM).
Figure S6, related to Figure 6 – Anti-diabetic agents rescue AD pathology and
cognitive impairment in APP/PS1 mice. A-D, Immunoblot analyses for GRP78 (A),
drebrin (B), 28 kDa A"Os (C) and 108 kDa A!Os (D) in hippocampal homogenates
from 13-16 month old APP/PS1 (n = 7) or liraglutide-treated APP/PS1 (n = 5) mice. *
p < 0.05, Student’s t-test. E-F, Freezing times of exendin-4- (E) or liraglutide-treated
(F) APP/PS1 mice compared to untreated APP/PS1 mice in a contextual fear
conditioning task. N = 10 animals per experimental group. *p < 0.05, Student t-test.
G-H, Body weights (means !" SEM; n = 12 animals per experimental group) in
exendin-4- (G) or liraglutide-treated mice (H), before (B) and after (A) treatments.
Graphs show means ± standard error (SEM).
Supplemental Experimental Procedures
Reagents
Synthetic A!1–42 peptide was from American Peptide (Sunnyvale, CA). Human
insulin, 3,3’-diaminobenzidine, 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), DMSO,
DAPI, 4-phenylbutyrate, thapsigargin and poly-L-lysine were from Sigma (St. Louis,
MO). Culture media/reagents, RNA extraction and qPCR kits, Alexa-labeled
secondary antibodies and ProLong anti-fade reagent were from Invitrogen (Carlsbad,
CA). Electrophoresis buffers were from BioRad (Hercules, CA). SuperSignal
chemiluminescence reagents, BCA protein assay kits and the antibody against
synaptophysin were from Pierce (Deerfield, IL). The antibody against the ! subunit of
eukaryotic initiation factor 2 phosphorylated at serine 51 (eIF2!#P) was from Enzo
Life Sciences (Farmingdale, NY). Antibodies against inositol-requiring enzyme 1!
phosphorylated at serine 724 (IRE1!#pSer724), glucose-regulated protein 78
(GRP78/Bip), drebrin, beta-actin and cyclophilin B were from Abcam (Cambridge,
MA). Antibodies against total or phosphorylated double-stranded RNA-dependent
protein kinase (PKR or PKR-pThr451, respectively), total or phosphorylated PKR-like
endoplasmic reticulum kinase (PERK or PERK-pThr981, respectively), PSD95, insulin
receptor substrate 1 phosphorylated at serine 636 (IRS-1pSer636) and total IRS-1 were
from Santa Cruz Biotechnology (Santa Cruz, CA). Exendin-4 was from Bachem
(Torrance, CA). Liraglutide was from GL Biochem (Shanghai). SP600125 was from
Tocris Bioscience (Ellisville, MO). Infliximab (Remicade) was from Schering-Plough
(Kenilworth, NJ). PKR inhibitor was from Santa Cruz Biotechnology (Santa Cruz,
CA). Salubrinal was from Merck Millipore (Darmstadt, Germany). Rat TNF-!
ELISA kits were from Peprotech (Rocky Hill, NJ). A! oligomer-specific antibody
(NU4) was generated in William L. Klein’s laboratory (Northwestern University,
Evanston, IL) and has been previously characterized (Lambert et al., 2007).
Immunofluorescence
Cells were fixed and blocked as described (De Felice et al., 2009) and were double-
labeled with oligomer-specific NU4 mouse monoclonal antibody plus eIF2!#P,
IRE1!#pSer724, IRS-1pSer636, PKR-pThr451 or PERK-pThr981 rabbit polyclonal
antibodies followed by Alexa-conjugated secondary antibodies (Invitrogen, CA).
Nuclei were counterstained with DAPI. Coverslips were imaged on a Zeiss
AxioObserver Z1 microscope. eIF2!#P, IRE1!#pSer724, PKR-pThr451 and PERK-
pThr981 immunofluorescence intensities were each analyzed in 4–6 experiments (see
figure legends) using independent neuronal cultures. In each experiment, 20-30
images were acquired from each of 3 coverslips in each experimental condition.
Histogram analysis of fluorescence intensities at each pixel across the images was
performed using NIH Image J (Abràmoff et al., 2004) as described (De Felice et al.,
2007). When indicated, cell bodies were digitally removed from the images so that
only immunostaining on dendritic processes was quantified. For synapse
quantification, cells were double-labeled for synaptophysin (pre-synaptic marker) and
PSD95 (post-synaptic marker) and imaged on a Nikon TE Eclipse microscope.
Synapses were defined as a juxtaposition between synaptophysin and PSD95 puncta
(Diniz et al., 2012) and were quantified using Puncta Analyzer ImageJ plugin,
developed by Ben Barres lab (Stanford University) and previously described
(Christopherson et al., 2005). Results are from at least 3 independent experiments,
carried out in duplicates. Statistical significances of differences between experimental
groups were assessed by ANOVA followed by post-hoc Bonferroni test, and p-values
are indicated in figure legends.
RNA extraction
Total RNA was extracted from hippocampal cultures using Trizol (Invitrogen, CA),
following manufacturer’s instructions. Briefly, 1 mL of Trizol was used to extract
RNA from 1.5 x 106 cells. Purity and integrity of RNA preparations were checked by
the 260/280 nm absorbance ratio and by agarose gel electrophoresis. Only
preparations with 260/280 nm OD ratios higher than 1.8 and no signs of rRNA
degradation were used. RNA concentrations were determined by absorption at 260
nm.
Quantitative RT-PCR
One microgram of total RNA was used for cDNA synthesis using 50 pmol of oligo
dT20 and the Superscript III First Strand cDNA kit. Quantitative expression analysis
of CHOP was performed by qRT-PCR on a 7500 Applied Biosystems Real-Time
PCR system with the Power SYBR kit (Applied Biosystems, Foster City, USA). "-
actin (actb) was used as an endogenous reference gene for data normalization. qRT-
PCR was performed in 20 "L reaction volumes according to manufacturer’s
protocols. The following primer sequences were used: CHOP/gadd153 forward
(5’GAAAGCAGAAACCGGTCCAAT3’), CHOP/gadd153 reverse (5’GGATGAGA
TATAGGTGCCCCC3’), actb forward (5’GTCTTCCCCTCCATCGTG3’) and actb
reverse (5’AGGATGCCTCTCTTGCTCTG3’) for the detection of CHOP/gadd153
and "-actin mRNAs, respectively. Cycle threshold (Ct) values were used to calculate
fold changes in gene expression using the 2-##Ct method (Livak and Schmittgen,
2001). Statistical significance of changes in expression was assessed using Student’s t
test.
Neuropathology in monkey brains
Immunohistochemistry was performed as described (Medeiros et al., 2007). Briefly,
hippocampal or cortical sections from monkey brains were incubated in pre-heated
0.1 M citrate buffer, pH 6.0, for 40 min. Sections were blocked with 5% bovine serum
albumin (BSA), 5% normal goat serum (NGS) and 1% Triton X-100 for 3 h at room
temperature. Primary antibodies (eIF2!#P, PKR-pThr451, 1:200 dilution) were diluted
in blocking solution and sections were incubated overnight at 4 °C followed by
incubation with biotinylated secondary antibodies for 1 h at room temperature.
Sections were then exposed to HRP-conjugated biotin-streptavidin (Vector Labs, CA)
for 30 min and developed with 3,3’-diaminobenzidine. Light counterstaining was
performed with hematoxylin. Slides were imaged on a Zeiss AxioPlan microscope
using brightfield illumination under the same acquisition settings for all conditions.
eIF2!#P and PKR-pThr451 immunolabeling densities were determined using a
multithreshold plugin within NIH ImageJ software. For each animal, densities were
measured in a set of 15-30 microscopic fields (20X objective) throughout defined
hippocampal and/or cortical regions (see “Results”). Brain regions were defined
according to a cynomolgus stereotaxical atlas (Martin and Bowden, 1996). Statistical
significances were assessed by one-way ANOVA followed by post-hoc Bonferroni
test and p-values are indicated in figure legends.
Western blotting
Thirteen to fourteen month-old APPSwe/PS1#E9 transgenic mice and three month-
old PKR-/- and TNFR1-/- mice and wild-type control animals were used. Animals (at
least 5 per experimental group) were euthanized and their hippocampi were removed.
For Western blot analysis, hippocampi or mature hippocampal cell cultures were
homogenized in RIPA buffer containing protease and phosphatase inhibitor cocktails
and resolved on 4-20% polyacrylamide pre-cast gels with Tris/glycine/SDS buffer run
at 125 V for 80 min at room temperature. The gel (30 µg total protein/lane) was
electroblotted onto Hybond ECL nitrocellulose using 25 mM Tris, 192 mM glycine,
20% (v/v) methanol, 0.02% SDS, pH 8.3, at 350 mA for 2 h at 4 °C. Membranes were
blocked with 5% non-fat milk in Tris-buffered saline containing Tween-20 (TBS-T)
(0.1% Tween-20 in 20 mM Tris-HCl, pH 7.5, 0.9% NaCl) for 1 h at room
temperature. Primary antibodies (anti-eIF2!-P, anti-p-PERK, anti-PERK, anti-
synaptophysin, anti-PSD95, anti-drebrin antibodies; anti-A"Os NU4 (1:1000), anti-
phospho-PKR, anti-PKR, anti-IRS-1pSer636, anti-IRS-1 (1:400), anti-beta actin
monoclonal antibodies or anti-cyclophilin B polyclonal antibody (1:10,000)) were
diluted in 5% milk/TBS and incubated with the membranes overnight at 4 oC. After
incubation with HRP-conjugated anti-mouse or anti-rabbit IgGs (1:10,000 in TBS-T)
for 60 min, membranes were washed, developed with SuperSignal West Femto
Maximum Sensitivity substrate and imaged on photographic film.
Soluble TNF-! levels
Soluble TNF-! levels were measured using an ELISA kit (Peprotech) according to
manufacturer instructions. Prior to analysis, hippocampal cultures were exposed to
500 nM A!Os or an equivalent volume of vehicle for 3 hours. The medium was then
removed and concentrated by Speedvac (Savant Instruments, Inc., Farmingdale, NY)
centrifugation. Statistical significance of differences between experimental groups
was determined by Student’s t-test.
Novel object recognition paradigm
Object recognition experiments were carried out in an open field arena measuring 0.3
(w) x 0.3 (d) x 0.45 (h) m. Test objects were made of glass or plastic and had different
shapes, colors, sizes and textures. During behavioral sessions, objects were fixed with
tape to the floor so that the animals could not move them. None of the objects used in
our experiments evoked innate preference. Before training, each animal was
submitted to a 5 minute-long habituation session, in which they were allowed to
freely explore the empty arena. During habituation sessions, the number of lines that
each animal crossed on the floor (number of crossings) and the number of rearings
(elevation on rear paws, denoting exploratory behavior) were recorded to verify
possible effects of treatments on locomotor exploratory activities. Training consisted
in a 5 minute-long session during which animals were placed at the centre of the arena
in the presence of two identical objects. The time spent exploring each object was
recorded by a trained researcher. Sniffing and touching the object were considered as
exploratory behavior. The arena and stimulus objects were cleaned thoroughly
between trials with 20% alcohol (vol/vol) to ensure minimal olfactory cues. Two
hours after training, animals were reinserted into the arena for the test session, when
one of the two objects used in the training session was replaced by a new one. Again,
the time exploring familiar and novel object was measured. Results are expressed as
percentage of time exploring each object during the training or test session and were
analyzed using a one-sample Student’s t-test comparing the mean exploration time for
each object with the fixed value of 50%. By definition, animals that recognize the
familiar object as such (i.e., normal learning) explore the novel object for a time
significantly longer than 50% of the total time.
Contextual Fear Conditioning
For the experiments using APPSwe/PS1#E9 mice, vehicle-, exendin-4- or liraglutide-
treated transgenic mice were allowed to freely explore the conditioning chamber (0.4
x 0.25 x 0.3 m) for 2 min, after which a 2-sec shock stimulus (0.8 mA) was applied to
the floor. Animals remained in the cage for 1 additional minute. After 24 h, mice were
placed in the same cage and allowed to explore it for 3 min in the absence of electric
shock. Freezing time was measured during this period. Statistical significances of
differences between groups were evaluated by Student’s t-test. In experiments with
TNFR1-/- and PKR-/- mice and corresponding wild-type controls, animals were
allowed to freely explore the training chamber (0.25 x 0.25 x 0.25 m; Harvard
Apparatus) for 3 minutes, after which they received two 2-sec long 0.35 mA foot-
shocks with a 30 sec interval. Animals were removed from the cage after 30 seconds.
Twenty-four hours thereafter, they were reinserted into the box for 5 minutes and total
freezing time during test session was determined. Statistical significances of
differences between groups were evaluated by two-way ANOVA followed by
Bonferroni post-hoc test.
Inhibitory Avoidance
The inhibitory avoidance apparatus consists on a box measuring 0.5 x 0.25 x 0.25 m
(Insight) with a 0.09 x 0,05 x 0.02 m platform placed in the centre, surrounded by a
floor made of parallel bronze bars and connected to a power source. During the
training sessions, TNFR1-/- mice and wild-type controls were gently placed on the
platform and when they stepped down with four paws onto the grip they received a 2
sec-long, 0.7 mA scrambled foot shock. Latency to step down during training session
was registered. For evaluation of memory retention, animals were again placed on top
of the platform twenty-four hours after training, and latency to step down was
registered again. Prior to test, all animals were subjected to an open field session to
eliminate any locomotor or exploratory deficit that could interfere with the latency to
step down.
Mouse genotyping
Genotyping was carried out according to Jackson’s Laboratories protocols
(http://jaxmice.jax.org/strain/004462.html). Briefly, genomic DNA was extracted
from thin sections of mice tails and subjected to amplification using specific forward
and reverse primers for the transgenic construct. The thermal cycling consisted of 35
cycles at 94 °C for 1 min, 52 °C for 1 min, and 72 °C for 1 min. PCR products were
resolved on a 1.5% agarose gel, evidencing a band of 377 bp for transgenic animals
after ethidium bromide staining.
!
!
!
!
!
!
!
"#$$%&'&()*%!+&,&-&(.&/!
Abràmoff, M.D., Magalhães, P.J., and Ram, S.J. (2004). Image processing with ImageJ. Biophotonics International 2004, 1-7.
Christopherson, K.S., Ullian, E.M., Stokes, C.C.A., Mullowney, C.E., Hell, J.W., Agah, A., Lawler, J., Mosher, D.F., Bornstein, P., and Barres, B.A. (2005). Thrombospondins are astrocyte-secreted proteins that promote CNS synaptogenesis. Cell 120, 421-433.
Diniz, L.P., Almeida, J.C., Tortelli, V., Vargas Lopes, C., Setti-Perdigao, P., Stipursky, J., Kahn, S.A., Romao, L.F., de Miranda, J., Alves-Leon, S.V., et al. (2012). Astrocyte-induced synaptogenesis is mediated by transforming growth factor ! signaling through modulation of D-serine levels in cerebral cortex neurons. Journal of Biological Chemistry 287, 41432-41445.
Lambert, M.P., Velasco, P.T., Chang, L., Viola, K.L., Fernandez, S., Lacor, P.N., Khuon, D., Gong, Y., Bigio, E.H., Shaw, P., et al. (2007). Monoclonal antibodies that target pathological assemblies of A!. Journal of Neurochemistry 100, 23-35.
Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408.
Martin, R.F., and Bowden, D.M. (1996). A stereotaxic template atlas of the macaque brain for digital imaging and quantitative neuroanatomy. Neuroimage 4, 119-150.
Medeiros, R., Prediger, R.D.S., Passos, G.F., Pandolfo, P., Duarte, F.S., Franco, J.L., Dafre, A.L., Di Giunta, G., Figueiredo, C.P., Takahashi, R.N., et al. (2007). Connecting TNF-$ signaling pathways to iNOS expression in a mouse model of Alzheimer's disease: relevance for the behavioral and synaptic deficits induced by amyloid-! protein. Journal of Neuroscience 27, 5394-5404.
"""
"
Research Article
Alzheimer-associated Ab oligomers impact thecentral nervous system to induce peripheralmetabolic deregulationJulia R Clarke1,2,†, Natalia M Lyra e Silva1,†, Claudia P Figueiredo2, Rudimar L Frozza1, Jose H Ledo1,
Danielle Beckman1, Carlos K Katashima3, Daniela Razolli3, Bruno M Carvalho3, Renata Frazão4,
Marina A Silveira4, Felipe C Ribeiro1, Theresa R Bomfim1, Fernanda S Neves2, William L Klein5,
Rodrigo Medeiros6, Frank M LaFerla6, Jose B Carvalheira3, Mario J Saad3, Douglas P Munoz7,
Licio A Velloso3, Sergio T Ferreira1,8 & Fernanda G De Felice1,*
Abstract
Alzheimer’s disease (AD) is associated with peripheral metabolicdisorders. Clinical/epidemiological data indicate increased risk ofdiabetes in AD patients. Here, we show that intracerebroventricu-lar infusion of AD-associated Ab oligomers (AbOs) in mice triggeredperipheral glucose intolerance, a phenomenon further verified intwo transgenic mouse models of AD. Systemically injected AbOsfailed to induce glucose intolerance, suggesting AbOs target brainregions involved in peripheral metabolic control. Accordingly, weshow that AbOs affected hypothalamic neurons in culture, induc-ing eukaryotic translation initiation factor 2a phosphorylation(eIF2a-P). AbOs further induced eIF2a-P and activated pro-inflammatory IKKb/NF-jB signaling in the hypothalamus of miceand macaques. AbOs failed to trigger peripheral glucose intoler-ance in tumor necrosis factor-a (TNF-a) receptor 1 knockout mice.Pharmacological inhibition of brain inflammation and endoplasmicreticulum stress prevented glucose intolerance in mice, indicatingthat AbOs act via a central route to affect peripheral glucosehomeostasis. While the hypothalamus has been largely ignored inthe AD field, our findings indicate that AbOs affect this brain regionand reveal novel shared molecular mechanisms between hypotha-lamic dysfunction in metabolic disorders and AD.
Keywords Alzheimer’s disease; ER stress; hypothalamus; inflammation;
insulin resistance
Subject Categories Metabolism; Neuroscience
DOI 10.15252/emmm.201404183 | Received 30 April 2014 | Revised 12
December 2014 | Accepted 17 December 2014
EMBO Mol Med (2015) 7: 190–210
Introduction
Increasing evidence suggests an association between metabolic
disorders, notably type 2 diabetes (T2D), and Alzheimer’s disease
(AD) (Craft, 2007; De Felice, 2013). Clinical and epidemiological
studies indicate that diabetic patients have increased risk of devel-
oping AD (Ott et al, 1999; Sims-Robinson et al, 2010; Wang et al,
2012) and AD brains exhibit defective insulin signaling (Moloney
et al, 2010; Bomfim et al, 2012; Craft, 2012; Talbot et al, 2012).
Recent studies have shown that soluble amyloid-b peptide oligomers
(AbOs), toxins that build up in AD brains and have been proposed
to be major players in synapse failure in AD (reviewed in Ferreira
& Klein, 2011; Selkoe, 2011; Mucke & Selkoe, 2012), are linked to
impaired hippocampal insulin signaling. AbOs were found to cause
internalization and cellular redistribution of insulin receptors, to
block downstream hippocampal insulin signaling (De Felice et al,
2009; Ma et al, 2009; Bomfim et al, 2012) and to cause hippocampal
endoplasmic reticulum (ER) stress (Lourenco et al, 2013), establish-
ing molecular parallels between AD and T2D. Hyperinsulinemic/
hyperglycemic individuals and mice show increased plasma and
brain levels of Ab (Ho et al, 2004; Takeda et al, 2010; Zhang et al,
2012), suggesting that altered peripheral metabolic homeostasis
1 Institute of Medical Biochemistry Leopoldo de Meis, Federal University of Rio de Janeiro, Rio de Janeiro, RJ, Brazil2 School of Pharmacy, Federal University of Rio de Janeiro, Rio de Janeiro, RJ, Brazil3 Department of Internal Medicine, Faculty of Medical Sciences, State University of Campinas, Campinas, SP, Brazil4 Department of Anatomy, Institute of Biomedical Sciences, University of São Paulo, SP, Brazil5 Department of Neurobiology, Northwestern University, Evanston, IL, USA6 Institute for Memory Impairments and Neurological Disorders, University of California, Irvine, CA, USA7 Center for Neuroscience Studies, Queen’s University, Kingston, ON, Canada8 Institute of Biophysics Carlos Chagas Filho, Federal University of Rio de Janeiro, Rio de Janeiro, RJ, Brazil
*Corresponding author. Tel: +55 21 38888308; E-mail: [email protected]†These authors contributed equally to this work
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors. Published under the terms of the CC BY 4.0 license190
may increase Ab levels and influence AD development (De Felice,
2013; De Felice & Ferreira, 2014).
Intriguingly, AD has been associated with increased risk of T2D
development (Janson et al, 2004), suggesting that the connection
between AD and T2D may be a two-way road. Early studies demon-
strated peripheral glucose intolerance in AD patients (Craft et al,
1992). Recently, hyperglycemia and hyperinsulinemia, cardinal
features of T2D and other metabolic disorders, were found to posi-
tively correlate with the development of AD-like brain pathology in
humans (Matsuzaki et al, 2010). Obesity-induced insulin resistance
is exacerbated in transgenic mouse models of AD (Takeda et al,
2010; Jimenez-Palomares et al, 2012). However, the molecular
mechanisms underlying these observations are still largely
unknown.
We hypothesized that AbOs could impact brain regions responsi-
ble for metabolic control and therefore represent a key pathogenic
link between AD and deregulated peripheral glucose homeostasis.
The hypothalamus plays a central role in neuroendocrine interaction
between the central nervous system and the periphery (Schwartz &
Porte, 2005; Koch et al, 2008). Emerging evidence further indicates
that hypothalamic inflammation and ER stress are critical patho-
genic events in the establishment of peripheral insulin resistance in
metabolic disorders (Zhang et al, 2008; Milanski et al, 2009; Denis
et al, 2010; Arruda et al, 2011; Thaler et al, 2012). An interesting
recent study showed that hypothalamic inflammation accelerates
aging and shortens lifespan in mice (Zhang et al, 2013). In post-
mortem AD brains, early studies identified Ab deposits in the hypo-
thalamus (Ogomori et al, 1989; Standaert et al, 1991). More
recently, voxel-based morphometry revealed reduced hypothalamic
volume in early AD compared to healthy controls (Loskutova et al,
2010), and a decrease in the number of hypothalamic orexin
neurons has been reported in AD brains (Fronczek et al, 2012). In
rats that received an intracerebroventricular injection of amyloid-
b25–35 fibrils, Zussy et al, (2011) detected accumulation of fibrillar
aggregates in the hypothalamus for as long as 3 weeks after the
injection, as well as hypothalamic astrocytosis. In addition, oligo-
meric species of the amyloid-b peptide were recently shown to
induce oxidative stress in a hypothalamic cell line (Gomes et al,
2014). While the hypothalamus has been largely ignored in the AD
field, these studies indicate that this brain region could indeed be
affected in AD. If so, hypothalamic dysfunction may have important
consequences, predisposing AD patients to develop diabetes.
Several studies have established that AbOs target hippocampal
neurons and induce synapse loss and neuronal dysfunction, eventu-
ally leading to memory impairment in AD (Ferreira & Klein, 2011;
Mucke & Selkoe, 2012; Selkoe, 2012). Intracerebroventricular
(i.c.v.) administration of AbOs has been shown to cause synapse
loss and behavioral alterations linked to AD in mice (Figueiredo
et al, 2013; Ledo et al, 2013) and AD-like pathology in non-human
primates (Forny-Germano et al, 2014), providing a suitable model
to investigate mechanisms germane to AD. Here, we show that
i.c.v.-injected AbOs induce peripheral glucose intolerance and hall-
marks of insulin resistance, including adipose tissue inflammation
and impaired insulin-induced surface translocation of GLUT-4 in
skeletal muscle. Peripheral glucose intolerance appeared to be medi-
ated by a direct effect of AbOs in the central nervous system, and
not by leakage of oligomers to peripheral tissues, as peripherally
administered AbOs failed to induce glucose intolerance in mice.
Glucose intolerance was further verified in two transgenic mouse
models of AD, namely 3xTg-AD (Oddo et al, 2003) and APP/PS1
(Jankowsky et al, 2001) mice. We show that AbOs target primary
hypothalamic neurons in vitro and accumulate in the hypothalamus
of cynomolgus macaques given i.c.v. infusions of AbOs. AbOsfurther triggered aberrant generation of reactive oxygen species
(ROS) and phosphorylation of eIF2a in cultured hypothalamic
neurons, as well as activation of IKKb/NF-jB inflammatory signal-
ing in the hypothalamus of mice and macaques. The impact of AbOsin the hypothalamus of mice preceded alterations in peripheral
glucose homeostasis. In TNF-a receptor 1 knockout mice (Romanatto
et al, 2009), AbOs failed to trigger hypothalamic IKK activation
and IRS-1 inhibition. AbO-associated glucose intolerance was
prevented in TNFR1!/! mice as well as in wild-type mice given
i.c.v. infusions of tauroursodeoxycholic acid (TUDCA), an ER stress
inhibitor. i.c.v treatment with infliximab, a TNF-a neutralizing anti-
body, further prevented glucose intolerance in AbO-injected mice
and in APP/PS1 mice. Collectively, results establish a novel patho-
genic mechanism by which AbOs impact the hypothalamus, causing
peripheral metabolic deregulation.
Results
Mouse models of AD exhibit impaired glucose tolerance
Alzheimer’s disease has been associated with increased risk of
T2D development. We hypothesized that brain accumulation of
AbOs could represent a key pathogenic link between AD and
deregulated peripheral glucose homeostasis. To test this hypothe-
sis, we initially performed a single injection of 10 pmol AbOs into
the right lateral cerebral ventricle of adult Swiss mice (Supplemen-
tary Fig S1; Figueiredo et al, 2013; Ledo et al, 2013). AbOs were
freshly prepared before each experiment and were routinely char-
acterized by size-exclusion chromatography, Western blots using
anti-oligomer monoclonal antibody NU4 (Lambert et al, 2007) and,
occasionally, by transmission electron microscopy, as previously
described (Jurgensen et al, 2011; Sebollela et al, 2012; Figueiredo
et al, 2013). Interestingly, mice that received an i.c.v. injection of
AbOs exhibited impaired peripheral glucose tolerance and insulin
resistance 7 days after injection (Fig 1A and B). Control experi-
ments showed that peripheral glucose tolerance was unaffected by
i.c.v. injection of a preparation of scrambled Ab peptide submitted
to the same oligomerization protocol used for regular AbO prepa-
rations (Supplementary Fig S2A). The impairment in glucose toler-
ance induced by i.c.v. AbOs was comparable to that verified in
mice submitted to a high-fat diet for 7 days (Supplementary Fig
S2B). Impaired glucose tolerance could be detected as early as
36 h, but not 12 h after i.c.v. injection of AbOs (Supplementary
Fig S2D and C), and persisted for at least 14 days post-injection
(Supplementary Fig S2E). We further examined the possibility that
leakage of AbOs from the brain might explain the observed effects
on peripheral glucose metabolism. To this end, we injected 10
pmol AbOs (the same amount used in i.c.v. injections) directly
into the caudal vein or into the peritoneum of mice. In either case,
systemic administration of AbOs failed to impair glucose tolerance
(Fig 1C and D), ruling out a direct action of AbOs on peripheral
tissues in our conditions.
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
191
A B
C D
E F
Figure 1. AD mouse models show peripheral glucose intolerance.
A Adult Swiss mice (n = 11 Veh; 15 AbOs) received a single i.c.v. injection of vehicle or 10 pmol AbOs and were assessed in a glucose tolerance test (2 g glucose/kgbody weight, i.p.) 7 days after injection. Blood levels of glucose were measured at several time points following glucose administration. Bar graph represents areasunder the curves in the time course plot. Data are representative of three independent experiments with similar results. Left panel: ***P = 0.0006, two-way ANOVAfollowed by Bonferroni post hoc test; right panel: *P = 0.0207, Student’s t-test.
B Insulin tolerance test (1 IU insulin/kg body weight, i.p.) (n = 7 Veh; 8 AbOs). Blood levels of glucose were measured at several time points following insulinadministration. Bar graph represents the kinetic constants for glucose disappearance (Kitt) calculated from the time course plot. Data are representative of twoindependent experiments with similar results. Left panel: *P = 0.0456 and ***P = 0.0007, two-way ANOVA followed by Bonferroni post hoc test; right panel:**P = 0.0033, Student’s t-test.
C, D Glucose tolerance test (2 g glucose/kg body weight, i.p.) in mice 7 days after a single intracaudal (C; n = 8 animals/group) or intraperitoneal (D; n = 13 animals/group) injection of AbOs (10 pmol) or vehicle.
E, F Glucose tolerance test (2 g glucose/kg body weight, i.p.) in 8- to 13-month-old APP/PS1 mice (E; n = 9 animals/group) or 6-month-old 3xTg-AD male mice(F; n = 10 WT; 9 3xTg), or their corresponding wild-type littermates. Bar graph represents areas under the curves in the time course plots. In (E), left panel:*P = 0.0466, two-way ANOVA followed by Bonferroni post hoc test; right panel: &P = 0.072, Student’s t-test. In (F), left panel: *P = 0.0171 and #P = 0.0781,two-way ANOVA followed by Bonferroni post hoc test; right panel: *P = 0.0101, Student’s t-test.
Data information: Data are expressed as means ! SEM.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
192
Significantly, altered peripheral glucose homeostasis was also
verified in 9- to 13-month-old APPSwePS1∆E9 (APP/PS1) mice
compared to wild-type animals (Fig 1E). Those mice harbor trans-
genes for human amyloid precursor protein (APP) bearing the Swed-
ish mutation and a deletion mutant form of presenilin 1 (Shi et al,
2011a), and present increased Ab production and cognitive deficits
(Jankowsky et al, 2001). Similar results were obtained using the
triple-transgenic mouse model of AD (3xTg-AD), which presents
increased Ab levels and develops tau and synaptic pathology, hall-
mark features of AD (Oddo et al, 2003). We found that 6-month-old
3xTg-AD mice show glucose intolerance compared to wild-type
littermates (Fig 1F). The fact that altered peripheral glucose homeo-
stasis was detected in both mouse models exhibiting progressive Abaccumulation in the brain underscores the notion that our observa-
tions in the acute model consisting of brain infusion of AbOs are
relevant when compared to clinical observations in early AD
patients (Craft et al, 1992).
i.c.v. injection of AbOs induces metabolic changes in muscle andadipose tissue and increases plasma noradrenaline levels
We next sought to analyze metabolic changes and insulin respon-
siveness in metabolically active tissues. We found increased CD68
immunoreactivity in adipose tissue of mice that received an i.c.v.
injection of AbOs (Fig 2A), indicating macrophage/myeloid cell
infiltration. Further, AbO-injected mice had higher amounts of
epididymal fat (Fig 2B) and increased expression of leptin and pro-
inflammatory cytokines, TNF-a and IL-6, in white adipose tissue
(Fig 2C–E). In obese mice, adipose-derived TNF-a is involved in
insulin resistance through the activation of JNK, leading to
increased inhibitory serine phosphorylation of insulin receptor
substrate-1 (IRS-1pSer) in muscle (Hotamisligil et al, 1996; Ozcan
et al, 2004). Therefore, we investigated whether this pathway was
affected in AbO-injected mice. Indeed, skeletal muscle from mice
i.c.v. injected with AbOs showed increased levels of activated JNK
(Fig 2F) and IRS-1pSer312 (Fig 2G). Physiologically, insulin signaling
in muscle induces translocation of glucose transporter-4 (GLUT-4)
from intracellular compartments to the plasma membrane (Huang &
Czech, 2007). In line with our finding of IRS-1 inhibition, insulin-
stimulated translocation of GLUT-4 to the plasma membrane was
severely impaired in skeletal muscle of mice that received an i.c.v.
injection of AbOs (Fig 2H), while GLUT-4 expression and total
protein levels in muscle remained unaltered (Fig 2I and J).
In order to provide a more comprehensive view of metabolic
deregulation in AbO-injected mice, we next measured serum levels
of leptin and insulin in mice 7 days after i.c.v. injection of AbOs. We
found no changes in serum levels of insulin or leptin under these
conditions (Fig 2K and L). As noted above, the impairment in
glucose tolerance induced by i.c.v. administration of AbOs is compa-
rable to that verified in mice submitted to a high-fat diet (HFD) for
7 days (Supplementary Fig S2B). In harmony with our results, previ-
ous studies have shown that plasma leptin and insulin levels are not
affected in mice (wild-type or ob/ob) submitted to a short-term
(4–7 days) high-fat diet (HFD), whereas glucose tolerance and insu-
lin sensitivity are clearly impaired under the same conditions (e.g.,
El-Haschimi et al, 2000; Ji et al, 2012; Le et al, 2014). Further, short-
term HFD induces increases in epididymal white adipose tissue
weight, adipocyte hypertrophy and increased transcript levels of
TNF-a and IL-6 (e.g., Lee et al, 2011; Ji et al, 2012), similar to our
observations in mice i.c.v. injected with AbOs. Moreover, plasma
levels of cholesterol and triglycerides were comparable between
vehicle- and AbO-injected animals (Fig 2M and N). We further found
elevated plasma noradrenaline (NA) levels (Fig 2O), indicating that
AbOs cause deregulation of peripheral sympathetic control.
AbOs bind to hypothalamic neurons in culture and induceaberrant ROS generation and TNF-a-dependent increasein eIF2a-P
Since i.p. or i.v. administration of AbOs had no effect on peripheral
glucose homeostasis, we hypothesized that AbOs could target brain
regions involved in control of peripheral glucose homeostasis.
Because interference in the hypothalamus of mice has been
shown to be sufficient to induce peripheral metabolic deregulation
(Purkayastha et al, 2011), and early studies showed that Abaccumulates in the hypothalamus of AD patients, we next aimed to
determine whether this brain region was particularly affected in our
experimental models. Initially, highly differentiated primary hypo-
thalamic neuronal cultures were exposed to AbOs (500 nM) for 3 h
and AbO binding to neurons was investigated by double immunoflu-
orescence labeling using oligomer-sensitive antibody NU4 (Lambert
et al, 2007) and microtubule-associated protein 2 (MAP-2). Results
showed that AbOs bind to the soma and, especially, to dendrites of
selected hypothalamic neurons (Fig 3A), similar to previous results
demonstrating that oligomers bind to a specific subset of neurons in
hippocampal cultures, rather than to all neurons (Lacor et al, 2004;
Zhao et al, 2008; Bomfim et al, 2012; Lourenco et al, 2013). To
examine the possibility that AbOs could bind to astrocytes, we
further double-labeled cultures with anti-GFAP and NU4. Results
indicate that oligomers do not bind to astrocytes in culture (Fig 3B).
We further asked whether AbOs would instigate oxidative stress in
primary hypothalamic neurons in culture, as previously shown in
hippocampal neurons (De Felice et al, 2007) and in a hypothalamic
cell line (Gomes et al, 2014). We found that AbOs induce a robust
increase in reactive oxygen species (ROS) levels in cultured hypo-
thalamic neurons (Fig 3C). Under the same conditions, the lactate
dehydrogenase cytotoxicity assay provided no evidence of cell death
induced by exposure to AbOs in culture (Fig 3D).
Because phosphorylation of eIF2a-P, one of the branches of the
unfolded protein response (UPR) activated upon ER stress, was
recently shown to underlie AbO toxicity in the hippocampus (Costa
et al, 2012; Lourenco et al, 2013; Ma et al, 2013), and hypothalamic
ER stress has been proposed to play an important role in the patho-
genesis of metabolic disorders (Ozcan et al, 2004, 2006; Hotamisli-
gil, 2010), we asked whether AbOs might trigger eIF2a-P in mature
cultured hypothalamic neurons. We found increased eIF2a-pSer51(eIF2a-P) in neuronal dendrites and cell bodies after exposure of
neurons to AbOs for 3 h (Fig 3E). Importantly, elevated eIF2a-Plevels were found independent of whether or not neurons exhibited
oligomers bound to their dendrites (Fig 3F). This indicates that
eIF2a phosphorylation is not triggered by direct binding of oligo-
mers to individual neurons, but rather is instigated by soluble
factors released to the medium upon exposure of cultures to AbOs.In a recent study, we found that pro-inflammatory TNF-a signaling
induced eIF2a-P in hippocampal neurons (Lourenco et al, 2013). To
determine whether TNF-a activation was involved in AbO-induced
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
193
eIF2a-P in hypothalamic neurons, we treated cultures with inflix-
imab, a TNF-a neutralizing monoclonal antibody. Infliximab attenu-
ated eIF2a-P triggered by AbOs (Fig 3E). It is noteworthy that
infliximab did not block oligomer binding to neurons (Fig 3G),
substantiating the notion that activation of TNF-a/eIF2a-P signaling
is independent of direct binding of AbOs to individual neurons and
is likely mediated by TNF-a secreted to the medium.
i.c.v. injection of AbOs induces increased hypothalamicinflammation and eIF2a-P in mice and macaques
We next asked whether i.c.v.-infused AbOs might trigger eIF2a-Pin the mouse hypothalamus. We found a significant increase in
hypothalamic levels of eIF2a-P 4 h after i.c.v. injection of AbOs
(Fig 4A), but not 7 days after oligomer injection (Fig 4B). We next
investigated levels of other components of the UPR 4 h after i.c.v.
injection of AbOs. Consistent with increased eIF2a-P, levels of
ATF4, a downstream effector of eIF2a, were increased in AbO-injected mice (Fig 4C). Other ER stress markers analyzed remained
unaltered, including PERKpThr980, ATF6, IRE1a-pSer724, spliced
Xbp1 and Grp78 (Supplementary Fig S3A–G). We note that we have
examined ER stress markers at a single time point (4 h post-AbOinjection) and future studies aimed to analyze in more detail the
time course of changes in levels of ER stress markers may provide
additional insight into the mechanisms by which AbOs instigate
hypothalamic deregulation.
In animal models of T2D and obesity, an inflammatory response
in the hypothalamus, notably via the activation of the IKKb/NF-jB
A
C
H I J
D E F G
K L M N O
B
Figure 2.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
194
pathway, is an important part of the mechanism underlying patho-
genesis (Zhang et al, 2008; Thaler et al, 2012). Compared to vehicle-
injected mice, AbO-injected mice exhibited early activation of IKKbin the hypothalamus (Fig 4D, 4 h after i.c.v. injection), which
persisted for 7 days after i.c.v. injection of AbOs (Fig 4E). Once acti-
vated, IKKb phosphorylates IjBa, which undergoes ubiquitination
and proteasomal degradation, allowing NF-jB phosphorylation and
nuclear translocation. Accordingly, we found decreased levels of
IjBa (Fig 4F), a trend of increase in cytoplasmic NF-jB phosphory-
lation (Fig 4G), and significantly increased levels of NF-jB in the
nucleus (Fig 4H) in the hypothalamus of AbO-injected mice. On the
other hand, no differences in activated JNK or PKR levels were
detected in the hypothalamus of AbO-injected mice compared with
vehicle-injected mice 4 h or 7 days after i.c.v. injection of oligomers
(Supplementary Fig S4G–J).We further found that IRS-1pSer636 levels were increased and
IRS-1pTyr465 levels were decreased in the hypothalamus of mice
7 days after oligomer injection (Fig 4I and J), indicating that AbOsimpaired hypothalamic insulin signaling. To determine whether
AbO-induced insulin resistance in neuroendocrine brain regions
impaired the ability of the brain to respond to insulin signaling by
reducing food intake, mice were kept in metabolic cages for 7 days
following i.c.v. injection of AbOs (or vehicle) and food intake was
measured following an acute i.c.v. infusion of insulin (Schwartz
et al, 2000; Sanchez-Lasheras et al, 2010). Significantly, AbO-injected mice failed to exhibit the expected suppression in acute
food intake upon i.c.v. administration of insulin, indicating central
insulin resistance (Fig 4K).
To determine the impact of AbOs in an animal model with
greater proximity to humans, we have recently developed a non-
human primate model of AD by delivering i.c.v. infusions of oligo-
mers in adult cynomolgus macaques (Forny-Germano et al, 2014).
Our previous studies showed that this macaque model of AD
presents hippocampal IRS-1 pathology and elevated hipocampal
eIF2a-P levels (Bomfim et al, 2012; Lourenco et al, 2013). Three
macaques received i.c.v. injections of AbOs, while three sham-
operated animals were used as controls, and their hypothalami were
analyzed (Supplementary Fig S4). Strong AbO immunoreactivity
was found in the hypothalamus of oligomer-injected macaques, but
not in sham animals (Fig 5A). We next investigated whether similar
effects to those found in mice could be observed in AbO-injectedmacaques. We found significantly elevated hypothalamic levels of
eIF2a-P (Fig 5B) and pIKKb (Fig 5C), as well as a trend of decrease
in hypothalamic IjBa levels in AbO-injected macaques (Fig 5D).
Results indicate that abnormal inflammatory signaling and ER stress
are triggered by AbOs in the primate hypothalamus.
AbOs induce increased expression of orexigenic peptides andchow intake in mice
Intriguingly, AbO-injected mice presented increased chow intake
(Fig 6A), even though no significant differences in body weight
(Fig 6B) were found between experimental groups. Consistent with
increased chow ingestion, elevated hypothalamic expression of orexi-
genic neuropeptides AgRP and NPY (but no alterations in anorexigenic
POMC mRNA levels) was detected in AbO-injected mice (Fig 6C–E).To gain insight into how AbOs cause the observed peripheral meta-
bolic alterations, we asked whether AbO injection might lead to death
of hypothalamic cells. We carried out Fluorojade staining in brain
tissue from vehicle- or AbO-injected mice (7 days post-injection).
Results showed no evidence of cell degeneration in AbO-injected mice
compared to vehicle-injected animals (Fig 6F). We next performed
whole-cell patch-clamp recordings in brain slices from AbO-injectedmice to determine whether AbOs affected hypothalamic neuron elec-
trophysiology. We targeted cells from the arcuate nucleus, a region
enriched in NPY neurons (Allen Brain Atlas [http://mouse.brain-
map.org]; Hahn et al, 1998). No changes were detected in frequency
or amplitude of either excitatory or inhibitory post-synaptic currents,
or in resting membrane potential of the recorded neurons (Supplemen-
tary Fig S5A–E), suggesting that the mechanism by which AbOs inducefunctional deregulation of hypothalamic neurons does not include
major alterations in their electrophysiological properties.
Blockade of brain ER stress or inflammation attenuates glucoseintolerance and normalizes plasma noradrenaline levels in mice
Recent observations indicate that transient hypothalamic ER stress
is sufficient to deregulate peripheral insulin signaling and upregulate
◀ Figure 2. i.c.v-injected AbOs induce adipose tissue inflammation and insulin resistance in muscle.
A CD68 immunoreactivity in white adipose tissue (scale bar = 25 lm, images representative of one animal each from a total of four animals per experimental group).Arrow points to a region stained with CD68 antibody. *P = 0.0109, Student’s t-test.
B Epididymal fat mass was analyzed in mice (n = 6 animals/group) 7 days after i.c.v. injection of vehicle or AbOs. Data are representative of three independentexperiments with similar results. *P = 0.0255.
C–E Relative expression of leptin (C), TNF-a (D) and IL-6 (E), respectively, in white adipose tissue of mice (n = 7 Veh; 9 AbOs) 7 days after i.c.v. injection of vehicle orAbOs. In (C), *P = 0.0394; in (D), **P = 0.0038; in (E), *P = 0.0305; Student’s t-test.
F, G p-JNK (F; n = 5 animals/group) and IRS-1pSer312 (G; n = 6 animals/group) levels (normalized by total JNK and total IRS-1, respectively) in skeletal muscle of mice7 days after i.c.v. injection of vehicle or AbOs. In (F), *P = 0.0464; in (G), *P = 0.0081; Student’s t-test.
H Representative images of GLUT-4 immunofluorescence in insulin-stimulated skeletal muscle from mice that were i.c.v.-injected with vehicle (Veh) or 10 pmol AbOs.Bar graphs show quantification of GLUT-4 surface immunoreactivity in skeletal muscle of mice that received intraperitoneal injections of PBS or insulin (1 IU/kgbody weight) 7 days after i.c.v. injection of vehicle or AbOs, as indicated (n = 5 animals/group). Scale bar = 25 lm. *P = 0.0144, one-way ANOVA followed byBonferroni post hoc test.
I, J GLUT-4 mRNA (n = 4 animals/group) and total protein levels (normalized to actin levels; n = 5 Veh; 6 AbOs) were unchanged in skeletal muscle of Swiss miceinjected with vehicle (Veh) or 10 pmol AbOs.
K–O Plasma levels of insulin (K; n = 12 animals/group), leptin (L; n = 11 Veh; 12 AbOs), cholesterol (M; n = 8 Veh; 6 AbOs), triglycerides (N; n = 8 Veh; 6 AbOs) ornoradrenaline (O; n = 7 Veh; 8 AbOs) measured 7 days after i.c.v. injection of vehicle (Veh) or 10 pmol AbOs. In (O), *P = 0.0361, Student’s t-test.
Data information: Data are expressed as means ! SEM, and data are representative of two independent experiments with similar results. To assess statisticalsignificance, AbO-injected mice were compared to vehicle-injected mice.Source data are available online for this figure.
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
195
A
C D
E
F
G
B
Figure 3. AbOs bind to and impact hypothalamic neurons.
A Representative immunocytochemistry images of mature hypothalamic neurons in culture exposed to vehicle (Veh) or AbOs (500 nM) for 3 h. Binding of AbOs wasdetected using anti-oligomer monoclonal antibody NU4 (red). Neurons were double-labeled using MAP-2 antibody (green). Images represent typical results fromexperiments with three independent hypothalamic cultures (three coverslips/experimental condition per independent experiment). Scale bar = 30 and 10 lm formain panels and insets, respectively.
B Representative immunocytochemistry image of mature hypothalamic culture exposed to AbOs (500 nM) and immunolabeled with anti-GFAP (green) and NU4 (red)antibodies. Insets show AbOs binding to neuronal dendrites, whereas no binding was detected to GFAP-positive cells.
C Representative DCF fluorescence images from hypothalamic neuronal cultures exposed to vehicle or AbOs (500 nM, 4 h). Insets show optical zoom images of theindicated areas. Scale bars = 100 and 50 lm for main panels and insets, respectively. Graph shows integrated DCF fluorescence intensities (relative units; seeMaterials and Methods) (n = 3 independent hypothalamic cultures; three wells/experimental condition per experiment; three images acquired per well). Barsrepresent means ! SEM. #P = 0.0604, one-sample t-test compared with a fixed value of 100 RUs.
D LDH activity (IU/l) in culture media of hypothalamic cultures exposed to vehicle or AbOs (500 nM, 3 h).E Representative immunofluorescence images of eIF2a-P in hypothalamic cultures exposed to vehicle or AbOs (500 nM, 3 h) in the absence or presence of infliximab
(1 lg/ml). Scale bar = 30 lm. Graph represents integrated immunofluorescence intensities of eIF2a-P levels from three independent hypothalamic cultures (threecoverslips/experimental condition per experiment, 20 images per coverslip). Bars represent means ! SEM. *P = 0.0489, one-way ANOVA followed by Bonferroni posthoc test comparing AbO-treated versus vehicle-treated cultures.
F Representative images of hypothalamic cultures exposed to AbOs (500 nM, 3 h) and double-labeled with NU4 (oligomer-sensitive) and eIF2a-P antibodies. Arrowpoints to a neuron presenting high levels of eIF2a-P in the absence of AbO binding. Nuclear staining (DAPI) is shown in blue. Scale bar = 30 lm.
G Representative images of hypothalamic neurons labeled with NU4 antibody exposed to AbOs (500 nM, 3 h) in the absence or presence of infliximab (1 lg/ml). Similarpatterns of AbO binding were observed in both conditions. Scale bar = 20 lm.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
196
peripheral sympathetic tonus (Purkayastha et al, 2011). Since we
found that AbOs induce transient hypothalamic eIF2a-P (Fig 4A and
B) and increased plasma noradrenaline levels in mice (Fig 2O), we
next investigated whether prevention of brain ER stress could atten-
uate AbO-induced defects in peripheral glucose homeostasis and in
plasma noradrenaline levels. We found that i.c.v. injections of
tauroursodeoxycholic acid (TUDCA), a chemical chaperone that
alleviates ER stress, prevented both the impairment in glucose toler-
ance and the increase in plasma noradrenaline levels induced by
i.c.v.-injected AbOs (Fig 7A and B). These results indicate that AbOsuse a central route to cause deregulation of peripheral glucose
homeostasis.
We recently reported that aberrant TNF-a signaling in the hippo-
campus mediates impaired neuronal insulin signaling, synapse dete-
rioration and memory loss in mice receiving i.c.v. infusions of AbOs(Bomfim et al, 2012; Lourenco et al, 2013). In addition, pioneering
studies have established that activation of pro-inflammatory TNF-ais a key mechanism leading to peripheral insulin resistance in diabe-
tes (Hotamisligil & Spiegelman, 1994; Hotamisligil et al, 1996;
Gregor & Hotamisligil, 2011) and that inhibition of hypothalamic
inflammation prevents peripheral insulin resistance (Milanski et al,
2012). Furthermore, our in vitro results indicated that TNF-a medi-
ates AbO-induced eIF2a-P (Fig 3E). Thus, we hypothesized that the
TNF-a pathway might be involved in AbO-induced deregulation of
glucose homeostasis in mice. To this end, we investigated the effects
of i.c.v.-injected AbOs in TNF-a receptor 1 knockout mice (Romanatto
et al, 2009). AbOs failed to induce glucose intolerance in TNFR1!/!
mice (Fig 7C). In metabolic disorders, ER stress has been linked to
insulin resistance and pro-inflammatory TNF-a signaling (Ozcan
et al, 2006; Steinberg et al, 2006). TNF-a signaling has further been
shown to activate intracellular stress kinases, including IKKb(Hotamisligil et al, 1996; Cai et al, 2005). i.c.v.-injected AbOstriggered IKKb activation and IRS-1pSer636 in the hypothalamus of
wild-type mice, but failed to do so in TNFR1!/! mice (Fig 7D and
E). Because whole-body TNF-a signaling would be expected to be
affected in TNFR1!/! mice, and to further investigate the specific
role of brain TNF-a signaling in deregulation of glucose metabolism,
we performed additional experiments in mice that were treated
i.c.v. with infliximab. We found that AbOs failed to trigger glucose
intolerance in mice that were previously treated with infliximab
(Supplementary Fig S6).
Our recent studies on the effects of oligomers in the hippocam-
pus indicate that, in addition to a direct effect on neurons, oligomers
also seem to impact microglial cells, the cellular components of the
innate immune system in the brain, to induce increased TNF-alevels and to deregulate hippocampal function (Lourenco et al,
2013). Therefore, we decided to test whether a similar indirect effect
of oligomers might lead to alterations in AgRP and NPY expressions
in the hypothalamus. To this end, we carried out experiments in
mice that had been treated intraperitoneally with minocycline, an
antibiotic known to prevent microglial activation and polarization
to an M1 proinflammatory profile. For reasons that are unclear to
us, minocycline treated-mice injected with vehicle showed increased
hypothalamic expression of AgRP and NPY (albeit not statistically
significant when compared to vehicle-injected mice) (Fig 7F and G).
Importantly, AbOs failed to induce increases in AgRP and NPY
levels in mice that had been treated with minocycline (Fig 7F and
G). This indicates that oligomers act on microglial cells, which likely
secret soluble factors (including TNF-a) to increase neuronal AgRP
and NPY expressions. Results thus indicate that a crosstalk between
neuronal and microglial cells is key to the effects of AbOs in the
hypothalamus. Finally, we tested whether infliximab treatment
would alleviate glucose intolerance in APP/PS1 mice. To this end,
we performed i.c.v. injections of infliximab in APP/PS1 mice and
found that infliximab rescued glucose intolerance in transgenic mice
(Fig 7H).
Discussion
Diabetes and AD are chronic degenerative diseases increasing in
prevalence in aging populations worldwide. Although clinical and
epidemiological studies have linked AD to diabetes, with each
disease increasing the risk of developing the other, the mechanisms
of pathogenesis connecting them at the molecular and cellular levels
remain to be elucidated. In particular, why AD patients present
increased probability of developing diabetes is unknown. Here, we
show that AbOs, toxins that accumulate in the AD brain and have
been linked to neuronal dysfunction in brain areas related to learn-
ing and memory, impact the hypothalamus of mice and macaques.
Intriguingly, infusion of AbOs in the brain triggers peripheral insulin
resistance in mice. Alterations in peripheral glucose homeostasis
were further detected in two transgenic mouse models of AD. These
results provide initial evidence implicating Ab oligomers in the
biological mechanisms underlying the clinical observations linking
AD to diabetes.
Numerous studies have investigated the impact of AbOs in
memory centers, specially the hippocampus (Ferreira & Klein,
2011), known to be fundamentally involved in the acquisition,
consolidation and recollection of new memories. This is because AD
is classically recognized as a disease of memory, and indeed
memory-related brain regions have long been known to be affected
in the course of disease (Walsh et al, 2002; Chhatwal & Sperling,
2012). However, early studies indicated that other brain regions, not
necessarily involved in learning and memory, might also be affected
in AD. For example, postmortem analysis of AD brains identified Abdeposits in the hypothalamus (Ogomori et al, 1989; Standaert et al,
1991), and evidence of peripheral glucose intolerance in AD patients
has been reported (Craft et al, 1992). More recently, voxel-based
morphometry analysis showed reduced hypothalamic volume and a
decreased number of orexin neurons in AD patients compared to
healthy controls (Loskutova et al, 2010; Fronczek et al, 2012).
Furthermore, hyperglycemia and hyperinsulinemia were shown to
positively correlate with the development of AD pathology (Matsuzaki
et al, 2010). In transgenic mouse models of AD, obesity-induced
insulin resistance is exacerbated (Takeda et al, 2010; Jimenez-
Palomares et al, 2012). Collectively, these observations raise the
intriguing possibility that the neuroendocrine axis, including the
hypothalamus, may be affected in AD. However, studies investigat-
ing the mechanisms underlying such clinical and postmortem obser-
vations are lacking. Using different experimental models, including
cell-based assays, mice and macaques that received i.c.v. injections
of AbOs, we now report that the hypothalamus is affected by AbOs.In both mice and macaques, i.c.v. infusion of AbOs induced
hypothalamic inflammation and eIF2a-P, recently implicated as
important pathogenic events in the onset of peripheral insulin
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
197
A B C D E
F
K
G H I J
Figure 4. AbOs induce hypothalamic inflammation, eIF2a phosphorylation and impaired insulin signaling.
A, B Western blot analysis of eIF2a-P levels in the hypothalamus of mice 4 h (A; n = 4 animals/group) or 7 days (B; n = 6 Veh; 5 AbOs) after a single i.c.v. injection ofvehicle (Veh) or 10 pmol AbOs. Graphs show densitometric data normalized by total eIF2a levels. *P = 0.0213.
C Western blot analysis of ATF4 levels in the hypothalamus of mice 4 h after i.c.v. injection of vehicle (Veh) or 10 pmol AbOs; graph shows densitometric datanormalized by b-actin (n = 7 Veh; 8 AbOs). #P = 0.0731; Student’s t-test.
D, E Western blot analysis of hypothalamic phospho-IKKb levels in the hypothalamus of mice 4 h (C; n = 6 animals/group) or 7 days (D; n = 4 Veh; 5 AbOs) after i.c.v.injection of vehicle or 10 pmol AbOs. Graphs show densitometric data normalized by total IKKb levels. In (D), *P = 0.0437; in (E), *P = 0.0444; Student’s t-test.
F, G Western blot analysis of IjBa (F; n = 6 animals/group) and cytoplasmic phospho-p65-NF-jB (G; n = 4 Veh; 5 AbOs) in the hypothalamus of mice 4 h after i.c.v.injection of vehicle or 10 pmol AbOs. Graphs show densitometric data normalized by actin (F) or total NF-jB levels (G). *P = 0.0207.
H Nuclear NF-jB levels in the hypothalamus 6 h after i.c.v. injection of vehicle or 10 pmol AbOs in mice. Graphs show NF-jB levels normalized by nuclear marker,lamin B (n = 6 animals/group). **P = 0.0024; Student’s t-test.
I, J IRS-1pSer636 (I; n = 4 animals/group) and pTyr465 (J; n = 6 Veh; 4 AbOs) levels in the hypothalamus 7 days after i.c.v. injection of vehicle or AbOs in mice. Graphsshow IRS-1pSer or IRS-1pTyr levels normalized by total IRS-1. In (I), *P = 0.0043; in (J), *P = 0.0275; Student’s t-test.
K Twelve-hour food intake after a single i.c.v. infusion of insulin (200 mU) in mice. Experiment was performed 7 days after i.c.v. injection of vehicle or AbOs (n = 5PBS; 5 Veh + Insulin; 9 AbOs + Insulin), data are representative of two independent experiments with similar results. ***P < 0.0001, one-way ANOVA followed byBonferroni post hoc test comparing Veh-Insulin versus PBS groups.
Data information: Data are expressed as means ! SEM. In (A–J), to assess statistical significance, AbO-injected mice were compared to vehicle-injected mice.Source data are available online for this figure.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
198
resistance in metabolic disorders (Zhang et al, 2008; Denis et al,
2010; Arruda et al, 2011; Thaler et al, 2012). Interestingly, while in
mice we found a transient increase in hypothalamic eIF2a-P levels
following a single i.c.v. injection of oligomers, persistently elevated
eIF2a-P levels were found in macaques after a series of AbO injec-
tions. This suggests that persistently elevated oligomer levels in the
brain may induce prolonged effects in eIF2a-P. AbOs further
induced IRS-1 inhibition (IRS-1pSer) in the hypothalamus of mice. It
is noteworthy that oligomers failed to trigger both hypothalamic
IKKb activation and IRS-1pSer in TNFR1!/! mice. Results thus indi-
cate that AbO-induced TNF-a/pIKK deregulation is directly linked to
disrupted insulin signaling in the hypothalamus.
Activated JNK and PKR were recently implicated in AbO-induceddefective hippocampal insulin signaling (Bomfim et al, 2012; Lourenco
et al, 2013). However, at the time points investigated (4 h or 7 days
post-AbO injection), no differences in pJNK and pPKR levels were
detected in the hypothalamus of AbO-injected mice compared to
vehicle-injected mice. Further, no changes were detected in other
markers of ER stress (4 h post-AbO injection), including phospho-
PERK, IRE1a-pSer724, ATF6 and Grp78. We note that future studies
aimed to analyze in more detail the time course of changes in levels
of ER stress markers may provide additional insight into the mecha-
nisms by which AbOs instigate hypothalamic deregulation.
Transient hypothalamic ER stress has been shown to induce
increased plasma levels of noradrenaline in mice, and this was
reported to be sufficient to induce peripheral glucose intolerance in
mice (Purkayastha et al, 2011). Consistent with that interesting
study, we found that prevention of brain ER stress by i.c.v. adminis-
tration of TUDCA normalized plasma noradrenaline levels and
blocked AbO-induced peripheral glucose intolerance. Moreover,
AbOs failed to induce glucose intolerance, hypothalamic IKKbactivation and IRS-1 inhibition in TNFR1!/! mice, or glucose
intolerance in mice treated i.c.v. with infliximab. These results
suggest that brain ER stress and inflammation underlie alterations in
peripheral glucose homeostasis induced by AbOs, and indicate that
AbOs hijack key signaling pathways in the CNS to deregulate
peripheral glucose handling.
We recently demonstrated that i.c.v.-injected AbOs disrupt insu-
lin signaling and induce inflammation in the hippocampus of mice
and macaques (Bomfim et al, 2012; Ledo et al, 2013; Lourenco
et al, 2013). AbO-induced abnormal hippocampal TNF-a signaling
was found to be directly linked to synapse deterioration and cogni-
tive impairment (Lourenco et al, 2013). It is thus possible that, in
the AD brain, progressive accumulation of Ab oligomers (due to
elevated Ab production or reduced clearance) brings about different
functional outcomes in different brain regions. While the impact of
A
C
B
D
Figure 5. AbOs accumulate in the hypothalamus of macaques and induce inflammation and eIF2a phosphorylation.
A Representative images of AbO immunoreactivity (detected using anti-oligomer monoclonal antibody NU4) in the hypothalamus of control, sham-operated adultcynomolgus macaques (Sh; n = 3) or macaques that received i.c.v. injections of AbOs (n = 3; see Materials and Methods). Nuclear staining (DAPI) is shown in blue.Insets show optical zoom images of the areas indicated by white dashed rectangles in the main panels. Scale bars = 100 and 20 lm for main panels and insets,respectively.
B–D Representative images showing eIF2a-P (B), phospho-IKKb (C) and IjBa (D) immunoreactivities in the hypothalamus of cynomolgus macaques that received i.c.v.injections of AbOs or control (sham-operated; Sh) macaques (n = 3 animals/group). Graphs show immunolabeling optical density analysis from three imagesacquired in the hypothalamus of each macaque (three control versus three AbO-injected animals). In (B), #P = 0.0523; in (C) #P = 0.1123; unpaired Student’s t-testwith Welch’s correction for unequal variances; AbO-injected monkeys compared to sham-operated monkeys. Scale bars = 50 lm
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
199
AbOs in the hippocampus involves inflammation, ER stress and
synapse deterioration, leading to memory deficits, AbO-inducedinflammation and eIF2a-P in the hypothalamus may be especially
relevant in terms of disrupting hypothalamic insulin signaling. The
hypothalamus is well known for its ability to respond to changes in
circulating insulin levels by regulating food ingestion (Sanchez-
Lasheras et al, 2010). We found that an acute i.c.v. injection of insu-
lin failed to suppress short-term food ingestion in AbO-injectedmice, suggesting that AbOs rendered the hypothalamus resistant to
insulin. Remarkably, activation of a hypothalamic inflammatory
pathway similar to the pathway we report in our model has been
implicated as a central mechanism regulating energy imbalance in
obese mice, and its suppression has been proposed to represent a
potential strategy to combat obesity-related diseases (Zhang et al,
2008). These findings further indicate that AbO- and obesity-
induced hypothalamic inflammation share common pathogenic
pathways.
Current findings indicate that AgRP and NPY levels remained
unaltered in AbO-injected mice that had been treated with minocy-
cline, suggesting that oligomers impact microglial cells, the cellular
components of the innate immune system in the brain, likely induc-
ing secretion of soluble factors (including TNF-a) to increase neuro-
nal AgRP and NPY expressions. Furthermore, it is noteworthy that
eIF2a-P does not depend on direct binding of oligomers to individ-
ual neurons, as elevated eIF2a-P levels were detected in neurons
regardless of whether or not they had oligomers bound to their
A
F
B C D E
Figure 6. i.c.v.-injected AbOs induce increased food intake, hypothalamic expression of orexigenic neuropeptides but no hypothalamic cell degeneration.
A Accumulated chow intake (normalized by body weight) measured during 7 days following a single i.c.v. injection of vehicle or 10 pmol AbOs in mice (n = 13 Veh;10 AbOs; data are representative of two independent experiments with similar results). ***P < 0.0001; Student’s t-test.
B Daily body weight measured during 7 days after i.c.v. injection of vehicle or AbOs (n = 7 animals/group; data are representative of two independent experimentswith similar results).
C–E Adult Swiss mice received a single i.c.v. injection of vehicle or 10 pmol AbOs, and hypothalamic levels of mRNA for AgRP (C; n = 6 Veh; 5 AbOs), NPY (D; n = 6 Veh;5 AbOs) and POMC (E; n = 7 animals/group) were analyzed 7 days after injection. In (C), *P = 0.0191; in (D), *P = 0.0115; Student’s t-test.
F Swiss mice received a single i.c.v. injection of vehicle (Veh) or 10 pmol AbOs, and their brains were analyzed by Fluorojade staining of degenerating cells 7 daysafter the injection. Representative images of Fluorojade staining in the hypothalamus of vehicle- or AbO-injected mice (n = 4/group). Scale bar = 100 lm in leftpanels (top and bottom) and 20 lm in right panels (top and bottom). Positive control (bottom left panel) was the hippocampus of a mouse that received one i.c.v.injection of quinolinic acid (36.8 nmol) and was analyzed 24 h after.
Data information: Data are expressed as means ! SEM. To assess statistical significance, AbO-injected mice were compared to vehicle-injected mice.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
200
A
C
F G H
D E
B
Figure 7. AbO-induced peripheral glucose intolerance and hypothalamic insulin resistance are mediated by TNF-a signaling and hypothalamic ER stress.
A Glucose tolerance test (2 g glucose/kg body weight, i.p.) in mice that received i.c.v. injections of vehicle, vehicle + TUDCA, AbOs or AbOs + TUDCA (when used,TUDCA was administered in 5 i.c.v. injections of 5 lg TUDCA each, before and after oligomer injection; see Materials and Methods. Control groups received injectionsof saline). Glucose tolerance test (GTT) was performed 7 days after i.c.v. injection of vehicle or AbOs. Bar graph represents areas under the curves (AUC) in the timecourse plots (n = 15 Veh; 15 AbOs; 10 Veh + TUDCA; 16 AbOs + TUDCA). Data are representative of two independent experiments with similar results. Left panel:**P = 0.0048, **P = 0.003, two-way ANOVA followed by Bonferroni post hoc test; right panel: *P = 0.0384, one-way ANOVA followed by Bonferroni post hoc test.
B Plasma noradrenaline (NA) levels measured 7 days after i.c.v. injection of vehicle, vehicle + TUDCA, AbOs or AbOs + TUDCA in mice (n = 7 animals/group). Data arerepresentative of two independent experiments with similar results. *P = 0.0071, one-way ANOVA followed by Bonferroni post hoc test.
C Glucose tolerance test (2 g glucose/kg body weight, i.p.) in TNFR1!/! mice or wild-type littermates performed 7 days after i.c.v. injection of vehicle or AbOs. Bargraph represents areas under the curves (AUC) in the time course plots (n = 8 WT + Veh; 7 WT + AbOs; 7 TNFR!/! + Veh; 8 TNFR!/! + AbOs). Left panel:**P = 0.0049, ***P < 0.0001, two-way ANOVA followed by Bonferroni post hoc test; right panel: *P = 0.0001, one-way ANOVA followed by Bonferroni post hoc test.
D, E Western blot analysis of phospho-IKKb (D; n = 6 WT + Veh; 6 WT + AbOs; 4 TNFR!/! + Veh; 6 TNFR!/! + AbOs) and IRS-1pSer636 levels (E; n = 6 WT + Veh; 5WT + AbOs; 6 TNFR!/! + Veh; 5 TNFR!/! + AbOs) in the hypothalamus of wild-type (WT) or TNFR1!/! mice 10 days after i.c.v. injection of vehicle or AbOs.Representative images from Western blot experiments were always run on the same gels but represent noncontiguous lanes. In (D), *P = 0.0088, Student’s t-test;in (E), *P = 0.0428, one-way ANOVA followed by Bonferroni post hoc test.
F, G Adult Swiss mice pre-treated with minocycline or PBS received a single i.c.v. injection of vehicle or 10 pmol AbOs, and hypothalamic levels of mRNA for AgRP(F; n = 5 Veh; 6 AbOs; 5 Veh + Mino; 4 AbOs + Mino) and NPY (G; n = 14 Veh; 13 AbOs; 8 Veh + Mino; 9 AbOs + Mino) were analyzed 7 days after injection. In (F),*P = 0.0097, one-way ANOVA followed by Bonferroni post hoc test; in (G), *P = 0.0219, one-way ANOVA followed by Bonferroni post hoc test.
H Glucose tolerance test (GTT) in APP/PS1 mice before and after i.c.v. injection of infliximab (0.2 lg daily for 4 days). Bar graph represents areas under the curves(AUC) in the time course plots (n = 9 animals/group). Left panel: *P = 0.0177, two-way ANOVA followed by Bonferroni post hoc test; right panel: *P = 0.0327, pairedt-test.
Data information: Data are expressed as means " SEM. To assess statistical significance, AbO-injected mice were compared to vehicle-injected mice.Source data are available online for this figure.
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
201
dendrites. Therefore, AbOs do not seem to act directly on neurons
to induce phosphorylation of eIF2a. Rather, it is likely that a cros-
stalk between neurons and microglia leads to elevated levels of
TNF-a, causing activation of neuronal TNF-a/eIF2a signaling to
deregulate hypothalamic function. We note that similar observa-
tions were made in studies of the effects of AbOs on hippocampal
cells (Lourenco et al, 2013).
We showed that no alterations in peripheral glucose homeostasis
were detected 12 h after an i.c.v. injection of AbOs (Supplementary
Fig S2C), but markers of hypothalamic inflammation were found to
be elevated as soon as 4 h after AbO infusion. This supports the
notion that hypothalamic inflammation precedes and may lead to
peripheral metabolic alterations, a possibility that deserves further
investigation. In this regard, an interesting recent study reported
that, unlike inflammation in peripheral tissues, which develops as a
consequence of obesity, hypothalamic inflammatory signaling is
evident in rats within 1 to 3 days of feeding on a high-fat diet, prior
to substantial weight gain (Thaler et al, 2012) and implicating
hypothalamic inflammation in obesity pathogenesis (Thaler et al,
2013). We further note that AbO-induced deregulation of peripheral
glucose homeostasis is similar in magnitude to the deregulation
induced by a short period (7 days) of high-fat diet. Extending the
findings of a recent study using APP/PS1 mice (Zhang et al, 2012),
we found altered peripheral glucose homeostasis both in APP/PS1
mice and in 3xTg-AD mice, two different experimental models of AD.
Importantly, we further demonstrated that i.c.v. injections of
infliximab rescued glucose tolerance in APP/PS1 mice, establishing
that brain inflammation triggers alterations in peripheral glucose
homeostasis in AbO-injected mice and in the APP/PS1 mouse model
of AD. Intracerebroventricular infusion of infliximab in AD trans-
genic mice has been reported to reduce the number of amyloid
plaques and phospho-tau levels (Shi et al, 2011a). Intrathecal
administration of infliximab was further reported to improve cogni-
tion in one patient with AD (Shi et al, 2011b), and clinical trials are
currently investigating the efficacy of infliximab in a wide range of
pathologies, including major depression, obesity-associated insulin
resistance and diabetic complications, among others (US National
Institute of Health; http://clinicaltrials.gov/). However, infliximab
does not cross the blood–brain barrier, and so far, it is important to
note that anti-TNF-a strategies for AD require invasive forms of
central administration, making this a difficult strategy to treat AD.
Nevertheless, our results suggest that pharmacological or other
approaches to prevent neuroendocrine dysfunction may provide
novel therapeutics for metabolic deregulation in AD.
Our results demonstrate that brain accumulation of AbOs affects
the hypothalamus and impacts peripheral metabolism by mecha-
nisms similar to those underlying peripheral insulin resistance in
type 2 diabetes and other metabolic diseases. Similar to what has
been described in metabolic disorders (Rossmeisl et al, 2003; Thaler
et al, 2013), i.c.v.-injected AbOs induce adipose tissue inflammation
and impaired insulin-induced surface translocation of GLUT-4 in
muscle cells. A previous study reported that a very high concentra-
tion of Ab (10 lM) induced hepatic insulin resistance in vitro
through a direct effect on hepatocytes (Zhang et al, 2012). However,
in our experimental conditions, AbOs failed to cause alterations in
peripheral glucose homeostasis when delivered via the caudal vein
or by intraperitoneal injection in mice, ruling out a direct effect of
AbOs on peripheral tissues. It is important to note that, besides the
hypothalamus, other brain regions involved in neuroendocrine
control might be also affected by AbOs. Whether AbOs indeed affect
other brain regions responsible for the control of peripheral glucose
homeostasis warrants further exploration.
In conclusion, our findings establish that i.c.v.-injected AbOstrigger inflammation in the hypothalamus and cause peripheral
glucose intolerance and insulin resistance. Results support the
emerging notion that pathological hypothalamic inflammation/ER
stress leads to impaired peripheral glucose homeostasis. We propose
that the impact of AbOs on the hypothalamus comprises a key novel
pathological mechanism that disrupts metabolic homeostasis and
leads to insulin resistance, revealing an important crosstalk between
central and peripheral pathogenic mechanisms in AD. Our discovery
that AbOs instigate hypothalamic deregulation draws attention to a
brain structure that has been largely ignored to date in the study of
AD pathogenesis, and highlights the importance of recognizing AD
as a disease of both the brain and the periphery. As peripheral insu-
lin resistance has been implicated in the development of AD (Janson
et al, 2004; De Felice, 2013), current results suggest the existence of
a vicious cycle, instigated by brain accumulation of AbOs, contribut-ing to the development of both AD and metabolic disorders, includ-
ing type 2 diabetes.
Materials and Methods
Preparation of Ab oligomers
Oligomers were prepared from synthetic Ab1–42 peptide (American
Peptide, Sunnyvale, CA) as originally described Lambert et al
(1998). The peptide was solubilized in hexafluoroisopropanol
(HFIP) and the solvent was evaporated to produce dried films,
which were subsequently dissolved in sterile anhydrous dimethyl-
sulfoxide to make a 5 mM solution. This solution was diluted to
100 lM in ice-cold PBS and incubated overnight at 4°C. The prepa-
ration was centrifuged at 14,000 g for 10 min at 4°C to remove
insoluble aggregates (protofibrils and fibrils), and the supernatants
containing soluble Ab oligomers were stored at 4°C. Protein concen-
tration was determined using the BCA kit (Pierce, Deerfield, IL).
Routine characterization of preparations was performed by size-
exclusion chromatography and Western blotting using anti-Ab 6E10
(Abcam, Cambridge, MA) or anti-Ab oligomer NU1 (Lambert et al,
2007) monoclonal antibodies and, occasionally, by transmission
electron microscopy, as previously described (Jurgensen et al, 2011;
Sebollela et al, 2012; Figueiredo et al, 2013). Oligomers were used
within 48 h of preparation.
Mature hypothalamic neuronal cultures, immunocytochemistry,ROS and LDH release assays
Primary hypothalamic neuronal cultures were prepared from rat
embryos (E16) according to the procedures established for hippo-
campal neuronal cultures (De Felice et al, 2007, 2009). Cultures
were plated at a density of 70,000 cells/cm2 on poly-L-lysine-coated
coverslips and were maintained in neurobasal medium with B27
supplement and L-glutamine (0.5 mM). After 14 days in vitro,
cultures were incubated with vehicle or 500 nM AbOs for 3 h at
37°C. Infliximab was added 30 min prior to AbOs. For experiments
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
202
designed to determine reactive oxygen species (ROS) formation,
20,000 cells/cm2 were plated directly on poly-L-lysine-coated wells
of 96-well plates. After 18–21 days in vitro, cultures were incubated
for 4 h at 37°C with vehicle or 500 nM AbOs. ROS formation was
assessed using 2 lM of the fluorescent probe CM-H2DCFDA (Invitro-
gen, Carlsbad, CA), as previously described in De Felice et al (2007).
CM-H2DCFDA is sensitive to the formation of various types of ROS,
including peroxide, hydroxyl radical, peroxyl radicals and peroxyni-
trite. After 30 min of loading with the fluorescent probe, neurons
were rinsed three times with warm PBS and two times with neuro-
basal medium without phenol red. Cells were immediately imaged
on a Nikon Eclipse TE 300-U fluorescence microscope. At least three
experiments with independent neuronal cultures were performed,
each with triplicate well per experimental condition. Three images
were acquired from randomly selected fields per well. Results
obtained in independent experiments were combined to allow quan-
titative estimates of changes in neuronal ROS levels. Quantitative
analysis of immunofluorescence data was carried using ImageJ
(Windows version) using appropriate thresholding to eliminate
background signal before histogram analysis, as described by De
Felice et al (2007).
Immunocytochemistry was performed as previously described by
De Felice et al (2009). Briefly, hypothalamic cultures were treated
for 3 h at 37°C with 500 nM AbOs or equivalent volumes of vehicle
and were fixed for 10 min with 4% paraformaldehyde containing
4% sucrose in PBS. Cells were blocked for 1 h with 10% normal
goat serum in PBS and incubated at 4°C with monoclonal AbO-selective NU4 antibody (1:2,000; (Lambert et al, 2007)) overnight.
Neurons were rinsed three times with PBS, permeabilized with
0.1% Triton X-100 for 5 min and incubated overnight at 4°Cwith anti-MAP2 (Santa Cruz Biotechnology, Santa Cruz, CA;
1:200, Cat#sc20172), anti-GFAP (DAKO, Carpinteria, CA; 1:200,
Cat#Z-0334) or anti-phospho-eIF2a (Enzo Life Sciences, Farming-
dale, NY; 1:200, Cat#BML-SA405) antibodies. After rinsing, neurons
were incubated for 2 h at room temperature with Alexa Fluor-555
anti-mouse IgG and Alexa Fluor-488 anti-rabbit IgG (1:2,000). After
washing, cells were mounted on coverslips using Prolong Gold
Antifade with DAPI (Invitrogen) and were imaged on a Zeiss Axio
Observer Z1 Microscope equipped with an Apotome module.
Measurement of lactate dehydrogenase (LDH) released to the
medium was assessed as a cell death indicator. LDH was assayed by
a commercial kit (Doles, Goiania, Brazil) according to manufac-
turer’s instructions. Briefly, culture medium was collected after
exposure to AbOs (or vehicle) and LDH activity was measured.
Absorbance was measured at 510 nm.
Animals and intracerebroventricular (i.c.v.) injections
Male Swiss mice obtained from our own animal facility were 2.5–3months old at the beginning of experiments. TNFR1!/! female mice
in a C57/BL6 background and wild-type littermates were obtained
from the University of Campinas Breeding Centre (CEMIB).
Six-month-old triple-transgenic (3xTg-AD) male mice and wild-type
littermates were obtained from University of California Irvine (Xu
et al, 2003). Nine- to thirteen-month-old APP/PS1 (seven males and
two females) and littermate wild-type mice (six males and three
females) were obtained from our own breeding facilities. Animals
were housed in groups of five in each cage with free access to food
and water, under a 12-h light/dark cycle, with controlled room
temperature and humidity. Animals were randomly assigned to
different experimental groups, and researchers conducting the
experiments were blind to experimental condition. All procedures
were performed in the light phase and followed the ‘Principles of
Laboratory Animal Care’ (US National Institutes of Health) and were
approved by the Institutional Animal Care and Use Committee of
the Federal University of Rio de Janeiro (protocol IBqM 072-05/16)
and UCI Institutional Animal Care and Use Committee. For i.c.v.
injection of AbOs, animals were anesthetized for 7 min with 2.5%
isoflurane (Cristalia, Sao Paulo, Brazil) using a vaporizer system
(Norwell, MA) and were gently restrained only during the injection
procedure itself, as recently described in Figueiredo et al (2013). A
2.5-mm-long needle was unilaterally inserted 1 mm to the right of
the midline point equidistant from each eye and 1 mm posterior to a
line drawn through the anterior base of the eye (Laursen & Belknap,
1986; Figueiredo et al, 2011, 2013); see Supplementary Fig S1). Ten
pmol of AbOs (concentration expressed in terms of Ab monomers)
or vehicle was injected in 30 s, in a total volume of 3 ll for Swiss
mice. When C57/BL6 mice were used, 100 pmol of AbOs or vehiclewas injected in 30 s in a total volume of 1 ll. Injection of 3 ll of ablue dye into the lateral ventricle of Swiss mice was performed to
verify diffusion along the CSF circulation so as to reach the whole
brain (Supplementary Fig S1). At the end of experiments, injection
of blue dye in the same injection site used for AbOs or vehicle was
employed to verify the accuracy of injection into the lateral ventri-
cle. Mice showing any signs of misplaced injections or brain hemor-
rhage (~5% of animals throughout our study) were excluded from
further analysis.
In experiments using macaques, six female cynomolgus maca-
ques (Macaca fascicularis; body weights 4.7–7.0 kg) were used.
Macaques were maintained at the Centre for Neuroscience at
Queen’s University (Kingston, Canada) under the close supervision
of a laboratory animal technician and the Institute veterinarian. All
animals had a cannula implanted in the lateral ventricle by aseptic
surgery. Anesthesia was induced by ketamine (10 mg/kg, intramus-
cular). During surgery, glycopyrrolate (0.013 mg/kg) and isoflurane
(1–3%) were also used. Correct placement of the cannula was
assessed by MRI. After a recovery period, three macaques received
intracerebroventricular injections of 100 lg of AbOs (one injection
per day every 3 days for 24 days). Three sham-operated macaques
were used as controls. Upon completion of the experimental
protocol, macaques were sedated with intramuscular ketamine
(10 mg/kg) plus buprenorphine (0.01 mg/kg) for analgesia, followed
by intravenous sodium pentobarbital (25 mg/kg), perfused with
phosphate-buffered saline (PBS) followed by 4% paraformaldehyde
in PBS; 4% paraformaldehyde in PBS containing 2.5% glycerol;
PBS + 5% glycerol; and PBS + 10% glycerol. All procedures were
approved by the Queen’s University Animal Care Committee and
were in full compliance with the Canada Council on Animal Care
(Animal Care Protocol Original Munoz-2011-039-Or).
Immunohistochemistry in macaque brain sections
Immunohistochemistry was performed using free-floating serial 40-
lm-thick coronal sections in PBS containing 1% Triton X-100 incu-
bated with 0.1 M citrate buffer, pH 6, at 60°C for 5 min. Endogenous
peroxidase was inactivated by incubation of sections with 3%
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
203
hydrogen peroxide in methanol for 2 h. Sections were then blocked
with 5% bovine serum albumin (BSA) and 5% normal goat serum
(NGS) in 1% Triton X-100 for 3 h at room temperature. Primary anti-
bodies against phospho-eIF2a (Enzo Life Sciences; 1:200, Cat#BML-
SA405), phospho-IKKb (Abcam; 1:200, Cat#ab59195) and IjBa (Cell
Signaling; 1:200, Cat#9242) were diluted in blocking solution, and
sections were incubated at 4°C for 16 h, followed by incubation with
biotinylated secondary antibody for 2 h at room temperature, and
then processed using the Vectastain Elite ABC reagent (Vector Labo-
ratories) according to manufacturer’s instructions. The sections were
washed in PBS and developed using DAB in chromogen solution,
and counterstained with Harris’ hematoxylin. Slides were mounted
with Entellan (Merck) and imaged on a Zeiss Axio Observer Z1
microscope. Omission of primary antibody was routinely used to
certify the absence of nonspecific labeling (data not shown). For
immunofluorescence analysis, tissue autofluorescence was
quenched by incubation with 0.06% potassium permanganate for
10 min at room temperature. Sections were blocked in 5% bovine
serum albumin (BSA) and 5% normal goat serum (NGS) in 1%
Triton X-100 for 3 h at room temperature. Primary antibody against
AbOs (NU4; 1:300; (Lambert et al, 2007)) was diluted in blocking
solution, and sections were incubated at 4°C for 16 h, followed by
incubation with Alexa-555-conjugated anti-mouse secondary anti-
body (1:1,500) for 2 h at room temperature. Slides were mounted
with Prolong Gold Antifade with DAPI (Invitrogen) and imaged on a
Zeiss Axio Observer Z1 microscope equipped with an Apotome
module to minimize out-of-focus light.
Immunohistochemistry in mouse tissues
For GLUT-4 immunohistochemistry, mice received one i.c.v. injec-
tion of vehicle or 10 pmol AbOs. Seven days later, mice received
one i.p. injection of either PBS or insulin (1 IU/kg body weight)
and were killed by decapitation 15 min later. The soleus muscle
was dissected and fixed in 4% paraformaldehyde. After 48 h,
tissues were cryoprotected in sucrose (20-30%) and 20 lmsections were obtained in a cryostat (Leica CM1850). Sections
were fixed with acetone for 30 min, washed twice with PBS and
incubated for 1 h with rabbit polyclonal anti-GLUT-4 antibody
(Abcam; 1:500, ab-654). Sections were then incubated with Alexa-
555-conjugated anti-rabbit antibody (1:1,000; Invitrogen) for 1 h
and mounted in Prolong Gold Antifade with DAPI (Invitrogen).
Sections were imaged on a Zeiss Axio Observer Z1 microscope
equipped with an Apotome module. Eight images were acquired
per section, and integrated immunofluorescence intensity was
determined using ImageJ software (Windows version). For adipose
tissue immunohistochemistry, mice i.c.v. injected with vehicle or
AbOs were killed 7 days after injection and samples of epididymal
adipose tissue were removed and fixed in 4% paraformaldehyde.
After 48 h, tissues were included into paraffin blocks, and 3 lmsections were obtained using a microtome and mounted in slides.
For immunohistochemistry, slides were immersed in xylene for
10 min, sequentially rehydrated in absolute, 95 and 70% ethanol
in water, and incubated with 3% H2O2 in methanol for inactiva-
tion of endogenous peroxidase. Antigens were reactivated by the
treatment with 0.01 M citrate buffer for 40 min at 95°C. Slides
were washed in PBS and incubated with CD68 antibody (Abcam;
1:200, Cat#ab125212) for 12–16 h at 2–8°C. After washing with
PBS, slides were incubated with biotinylated secondary antibody
for 1 h, washed twice with PBS and incubated with streptavidin-biotin peroxidase for 30 min. Slides were then covered with 3,30
diaminobenzidine solution (0.06% DAB in PBS containing 2%
DMSO and 0.018% H2O2) for 1 to 5 min or until a brown precipi-
tate could be observed. Identical conditions and reaction times
were used for slides from different animals to allow comparison
between immunoreactivity densities. Reaction was stopped by
immersion of slides in distilled water. Counterstaining was
performed with Harris’ hematoxylin. Four images were randomly
acquired for each animal using a Zeiss Axio Observer Z1 micro-
scope. An optical density threshold that best discriminated staining
from background was obtained using NIH ImageJ 1.36b imaging
software (NIH, Bethesda, MD).
Fluorojade (FJ) histochemistry was used as indicative of neuro-
nal degeneration. The paraffin-embedded brain tissue sections
were immersed into 100% ethanol for 3 min, then into 70% ethanol
for 1 min and distilled water for 1 min. Slices were then immersed
into 0.06% potassium permanganate solution for 10 min to
suppress endogenous background signal, and slices were washed
with distilled water for 1 min. Fluorojade B staining solution (10 ml
of 0.01% Fluorojade B aqueous solution added to 90 ml of 0.1%
acetic acid in distilled water) was added and slices were stained for
30 min. After staining, sections were rinsed three times with
distilled water. Excess water was drained off, and the slides were
cover-slipped with dibutylphthalate in xylene (D.P.X.) mounting
media (Aldrich Chem. Co., Milwaukee, WI). Sections comprising
the arcuate nucleus (Arc) and ventromedial hypothalamus (VMH)
were examined on epifluorescence microscopes (Olympus Bx41 or
Nikon Eclipse 50i). Positive staining controls consisted of sections
from the hippocampus of a mouse i.c.v. injected with 36.8 nmol
quinolinic acid and killed 24 h thereafter.
Intraperitoneal glucose tolerance test (GTT)
Mice were fasted for 12 h and blood samples were collected from a
tail incision. After collection of a baseline sample, mice received an
i.p. injection of glucose (2 g/kg body weight). Blood glucose
measurements were repeated at 15, 30, 45, 60 and 120 min after
glucose injection, using a One-Touch Ultra Glucose Meter and strips
(Johnson & Johnson). An additional measurement of blood glucose
levels (180 min after glucose injection) was performed in experi-
ments using 3xTg-AD mice. Mice with fasting glucose levels lower
than 50 mg/dl or higher than 100 mg/dl, or whose plasma glucose
levels did not increase at any time point after glucose injection were
excluded from the study.
Intraperitoneal insulin tolerance test (ITT)
Mice were fasted for 5 h and blood samples were collected from a
tail incision. After collection of a baseline sample, mice received an
i.p. injection of insulin (1 IU/kg body weight). Blood glucose
measurements were repeated at 15, 30, 45 and 60 min after insulin
injection, using a One-Touch Ultra Glucose Meter and strips (Johnson
& Johnson). If blood glucose levels fell below 20 mg/dl, mice were
immediately given an i.p. injection of glucose and were excluded
from the experiment. Kitt was calculated as described by Ropelle
et al (2010).
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
204
Plasma insulin and leptin measurements
Mice were i.c.v.-injected with vehicle or AbOs and 7 days later were
fasted for 3 h before being deeply anesthetized with 100 mg/kg
ketamine and 10 mg/kg xylazine. After complete loss of reflex,
blood samples were collected in EDTA-containing tubes and kept on
ice until plasma separation (centrifugation at 3,000 g for 10 min at
4°C). Samples were kept at 4°C, and insulin detection and leptin
detection were performed using the Ultra Sensitive Mouse Insulin
ELISA kit and Mouse Leptin ELISA kit (both from Crystal Chem Inc,
Downers Grove, IL).
High-fat diet
Mice were maintained for 7 days on normal chow or a high-fat diet
containing 55% of energy derived from fat, 29% from carbohy-
drates and 16% from protein, prepared as described (Romanatto
et al, 2009; Ropelle et al, 2010).
Treatment with tauroursodeoxycholic acid (TUDCA)
Mice received 5 lg TUDCA i.c.v. per injection. Injections were
carried out 20 min prior to AbO injection, and at 2, 24 and 96 h
thereafter. An extra TUDCA injection was given 12 h before the
GTT, which was performed 7 days after AbO administration.
Twenty-four hours after the GTT, mice were deeply anesthetized
with 100 mg/kg ketamine and 10 mg/kg xylazine, and blood
samples were collected by cardiac puncture in heparinized tubes.
Plasma was separated by centrifugation at 3,000 g at 4°C for
10 min, and samples were used for noradrenaline quantification (as
described below).
Treatment with infliximab
Swiss mice were given a single i.c.v. injection of 2 ll of a 0.1 lg/llsolution of Infliximab 20 min prior to AbOs. In APP/PS1 mice, daily
i.c.v. injections of 1 ll of a 0.2 lg/ll solution of Infliximab were
administered for 4 days. The last injection was performed 12 h prior
to the glucose tolerance test.
Minocycline treatment
Swiss mice received daily i.p. injections of minocycline (25 mg/kg)
for 3 days prior to i.c.v. injection of AbOs. Control mice received
i.p. injections of PBS.
Intracaudal injections
Animals were anesthetized with halothane and aseptically injected
via the tail vein with 10 pmol AbOs or Dulbecco’s PBS, in a final
injection volume of 100 ll.
Determination of accumulated food intake andintracerebroventricular insulin injection
Swiss mice were submitted to stereotaxic surgery for implantation
of a cannula directed to the third ventricle, as described in Ropelle
et al (2010). Mice were allowed to recover from surgery in their
home cages for 4 days before being placed in individual metabolic
cages. Animals then received i.c.v. injections of vehicle or AbOs,and food intake was measured every day at the same time for
7 days. Mice then received an i.c.v. injection of PBS or insulin
(200 mU) at the beginning of the dark cycle, and food intake was
determined by the difference between chow given to mice immedi-
ately after injection and the weight of remaining chow 12 h after.
Noradrenaline extraction and quantification
Norepinephrine levels in plasma were measured by HPLC separa-
tion coupled with electrochemical detection (HPLC-ED). Perchloric
acid was added to the plasma samples to a final concentration of
0.1 M. Samples were centrifuged (10,000 g) to remove precipitated
proteins, and supernatants were used for automated injection into
the HPLC. Fast isocratic separation was obtained using a reverse-
phase LC-18 column (4.6 × 250 mm; Supelco) with the following
mobile phase: 20 mM sodium dibasic phosphate, 20 mM citric acid,
pH 2.64, containing 10% methanol, 0.12 mM Na2EDTA and
566 mg/l heptanesulfonic acid.
Western blots
Four hours, 6 h or 7 days after i.c.v. injection of AbOs (as indicated in
‘Results’), mice were euthanized by decapitation and the hypothala-
mus and gastrocnemius muscle were rapidly dissected and frozen in
liquid nitrogen. For total protein extraction, samples were thawed and
homogenized in buffer containing 25 mM Tris–HCl, pH 7.5, 150 mM
NaCl, 1% NP-40 (Invitrogen), 1% sodium deoxycholate, 0.1% SDS,
5 mM EDTA, 1% Triton X-100 and phosphatase and protease inhibi-
tor cocktail (Pierce–Thermo Scientific, Rockford, IL). Protein concen-
tration was determined using the BCA kit. Aliquots containing 30 lgprotein were resolved by SDS–PAGE in 4–20% polyacrylamide gels
(Invitrogen) and were electrotransferred to nitrocellulose or PVDF
membranes for 1 h at 300 mA. Blots were blocked for 1 h with 5%
non-fat dry milk in Tween-Tris buffer solution at room temperature or
with Odyssey blocking buffer (Licor, Lincoln, NE; 1:2 dilution in
Tween-Tris Buffer) and were incubated overnight at 2°C with primary
antibodies diluted in blocking buffer. Molecular weight markers were
run in one lane in every gel (Benchmark pre-stained protein ladder;
Life Technologies). Primary antibodies used were IRS-1pSer636 (Santa
Cruz; 1:200, Cat. #sc-33957), IRS-1pSer312 (Invitrogen; 1:200,
Cat#44814-G and Cell Signaling; 1:1,000, Cat#2381), IRS-1pTyr465
(Santa Cruz; 1:200, Cat#sc-17194), total IRS-1 (Santa Cruz; 1:200.
Cat#sc-559), pJNK (Thr183/Tyr185) monoclonal antibody (Cell Signal-
ing; 1:1,000, Cat#9255S), JNK polyclonal antibody (Cell Signaling;
1:1,000, Cat#9252S), phospho-eIF2a (Enzo Life Sciences; 1:1,000,
Cat#BML-SA405 and Cell Signaling; 1:1,000, Cat#9721), total eIF2a(Abcam; 1:1,000, Cat#ab5369 and Cell Signaling; 1:1,000, Cat#9722),
pIKKb (Abcam; 1:1,000; Cat#ab59195), total IKKb (Abcam; 1:1,000,
Cat#ab55404), IjBa (Cell Signaling; 1:1,000, Cat#9242), pNF-jB p65
(Ser536; Cell Signaling; 1:1,000, Cat#3031), total NF-jB p65 (Santa
Cruz; 1:250, Cat#sc-372), p-PKR (Santa Cruz; 1:200, Cat#sc-101784),
total PKR (Santa Cruz; 1:250, Cat#sc-366778), ATF6 (Abcam; 1:1,000,
Cat#ab11909), GLUT-4 (Abcam; 1:500, Cat#ab654), PERKpThr981
(Santa Cruz; 1:500, Cat#sc-32577), total PERK (Abcam; 1:500,
Cat#ab65142), GRP78 (Abcam; 1:500, Cat#ab53068), ATF4 (Sigma;
1:500, Cat#WH0000468M1), spliced and unspliced Xbp1 (Abcam;
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
205
1:500, Cat#ab37152), phospho-IRE-1 (Novus Biological; 1:1,000,
Cat#NB100-2323), total IRE-1 (Novus Biological; 1:1,000, Cat#NB100-
2324), b-tubulin III (Sigma-Aldrich, St. Louis, MO; 1:10,000,
Cat#T8660) and b-actin (Cell Signaling; 1:10,000, Cat#12262). After
overnight incubation with primary antibodies, membranes were
incubated with horseradish peroxidase-conjugated secondary anti-
body (1:30–50,000), IRDye800CW- or IRDye680RD-conjugated
secondary antibodies (Licor; 1:10,000) at room temperature for 2 h.
Chemiluminescence was developed using SuperSignal West Femto
(Thermo Fisher Scientific). Alternatively, fluorescence intensities were
quantified in an Odyssey CLx apparatus (Licor).
Nuclear-enriched fractions
For the preparation of nuclear extracts, hypothalamus of vehicle- or
AbO-injected mice was homogenized in 0.1 ml hypotonic lysis
buffer (10 mM Hepes, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM
dithiothreitol plus a phosphatase and protease inhibitor cocktail) for
15 min at 4°C. Cells were then lysed by adding 0.5% Nonidet P-40.
The homogenate was centrifuged (13,000 g for 5 min at 4°C), andsupernatants containing the cytoplasmic extracts were stored
at !80°C. The nuclear pellet was resuspended in 75 ll ice-cold
hypertonic extraction buffer (20 mM Hepes, pH 7.9, 300 mM NaCl,
1.5 mM MgCl2, 0.25 mM EDTA, 25% glycerol, 0.5 mM dithiothrei-
tol plus phosphatase and protease inhibitors). After 40 min of inter-
mittent mixing, extracts were centrifuged (13,000 g for 20 min at
4°C), and supernatants containing nuclear proteins were saved.
Total protein concentration was determined using the BCA kit.
Aliquots containing 20 lg protein were resolved by SDS–PAGE in
4–20% polyacrylamide gels (Invitrogen) and were electrotransferred
to nitrocellulose membranes for 1 h at 300 mA. Blots were
processed and incubated with antibodies as described above.
Whole-cell recording
Whole-cell patch-clamp recordings were performed in neurons of
the Arc in brain slices of male Swiss mice (2–3 months old). During
the recordings, neurons were maintained in hypothalamic slice
preparations and data analyses were performed as previously
described Frazao et al (2013). Mice were decapitated and the entire
brain was removed. After removal, brains were immediately
submerged in ice-cold, carbogen-saturated (95% O2 and 5% CO2)
artificial cerebrospinal fluid (aCSF; 126 mM NaCl, 2.8 mM KCl,
1.2 mM MgCl2, 2.5 mM CaCl2, 1.25 mM NaH2PO4, 26 mM NaHCO3
and 5 mM glucose). Coronal sections from a hypothalamic block
(250 lM thick) were cut on a Leica VT1000S vibratome and incu-
bated in oxygenated aCSF at room temperature for at least 1 h
before recording. Slices were transferred to the recording chamber
and allowed to equilibrate for 10–20 min before recording. The
slices were bathed in oxygenated aCSF (32–34°C) at a flow rate of
~2 ml/min. The pipette solution for whole-cell recording was modi-
fied to include an intracellular dye (Alexa Fluor 488): 120 mM
K-gluconate, 10 mM KCl, 10 mM HEPES, 5 mM EGTA, 1 mM CaCl2,
1 mM MgCl2, 2 mM (Mg)-ATP and 0.03 mM Alexa Fluor 488 hydra-
zide dye, pH 7.3. Infrared differential interference contrast was used
to target and obtain the whole-cell recording of neurons at the Arc
(Leica DM6000 FS equipped with a fixed stage and a Leica DFC360
FX high-speed monochrome digital camera). Electrophysiological
signals were recorded using an Axopatch 700B amplifier (Molecular
Devices), low-pass-filtered at 2–5 kHz and analyzed offline on a PC
with pCLAMP programs (Molecular Devices). Recording electrodes
had resistances of 2.5–5 MΩ when filled with the K-gluconate inter-
nal solution. Input resistance was assessed by measuring voltage
deflection at the end of the response to a hyperpolarizing rectangu-
lar current pulse (500 ms of !10 to !50 pA). Membrane potential
values were compensated to account for junction potential
(!8 mV). Solutions containing insulin (50 nM) were typically
perfused for 5 min as previously described by Hill et al (2010). The
recorded cells were randomly chosen. Alexa Fluor 488 hydrazide
dye was used to verify the position of the recorded cells related to
the third ventricle. Only cells located laterally to the third ventricle
at a maximal distance of up to 100 micrometers were recorded.
RNA extraction and quantitative real-time PCR analysis
Hypothalamus and adipose tissue from vehicle- or AbO-injectedmice were homogenized in 500 or 1,000 ll Trizol (Invitrogen),
respectively, and RNA extraction was performed according to manu-
facturer’s instructions. Purity and integrity of RNA were determined
by the 260/280 nm absorbance ratio and by agarose gel electropho-
resis. Only preparations with ratios >1.8 and no signs of RNA degra-
dation were used. In adipose tissue samples, a 30-min-long
incubation at 30°C was performed, the lipid layer was removed and
discarded, and RNA extraction was performed in the water soluble
phase. One lg RNA was used for cDNA synthesis using the Super-
Strand III Reverse Transcriptase kit (Invitrogen). Expression of
genes of interest was analyzed by qPCR on an Applied Biosystems
7500 RT–PCR system using the Power SYBR kit (Applied Biosys-
tems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or
actin was used as endogenous control. Primer pairs used are shown
in Supplementary Table S1. Cycle threshold (Ct) values were used to
calculate fold changes in gene expression using the 2!DCt method. In
all cases, reactions were performed in 15 ll reaction volumes.
Statistical analysis
No previous statistical calculation was employed to determine sample
size. Instead, sample size in our experiments was chosen based on
usual procedures and best practices in the field. Gaussian distribution
of data was assessed using the D’Agostino-Pearson normality test.
Sample variances were assessed using the F test, when comparing two
independent groups, and using Bartletts’ test and Brown-Forsythe
test, when comparing three or more groups. Variances were equal
between groups, except when stated otherwise. Glucose tolerance test
curves were analyzed by two-way ANOVA followed by Bonferroni
post hoc test. Two-tailed Student’s t-test was performed when
comparing two groups with comparable variances. All data in
macaques shown unequal variances, and therefore, unpaired t-test
with Welch’s correction was applied. For experiments using APP/PS1
mice, a paired t-test was performed to compare groups before and
after treatment with infliximab, since the same animals were assessed
before and after drug administration. In Western blot experiments, a
few lanes (indicated by a red ‘X’ symbol in the source data) were
excluded from final analysis due to (i) excessive background, (ii) faint
or undetectable bands in either phospho- or total proteins or (iii)
fitting the mathematical definition of outliers.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
206
Supplementary information for this article is available online:
http://embomolmed.embopress.org
AcknowledgementsThis study is dedicated to the memory of Prof. Leopoldo de Meis (1938–2014),
founder of the Institute of Medical Biochemistry of the Federal University of
Rio de Janeiro. This work was supported by grants from Human Frontiers
Science Program (HFSP) (to FGF), National Institute for Translational Neurosci-
ence (INNT/Brazil) (to STF), the Brazilian funding agencies Conselho Nacional
de Desenvolvimento Científico e Tecnológico (CNPq) (to STF, FGF, CPF and JRC),
Fundação de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ) (to STF,
FGF, CPF and JRC), Fundação de Amparo à Pesquisa do Estado de São Paulo
(FAPESP2012/12202-4 to RF), Canadian Institutes for Health Research (CIHR)
and Canada Research Chair Program (to DPM). MAS, JRC, NMLS, RLF, JHL, DB,
FCR, TRB and FSN received fellowships from Brazilian agencies CAPES or CNPq.
We thank Drs. Matthias Gralle and Jordano Brito-Moreira for performing AbO
injections in macaques, Drs. Brito-Moreira and Adriano Sebollela for chromato-
graphic characterization of oligomer preparations, Dr. Leonardo M. Saraiva for
help with hypothalamic neuronal cultures and ROS assays, Maíra S. Oliveira,
Mariângela M. Viana, Sandra Bambrilla and Dioze Guadagnini for technical
support, Prof. Carla Tasca (Federal University of Santa Catarina) for the hippo-
campal sections used as positive controls in Fluorojade staining experiments
and Ana Claudia Rangel for secretarial and accounting support.
Author contributionsJRC, NML, CPF, RLF, RM, TRB, CKK, DR, BMC, FCR, FSN, JHL and DB performed
the experiments. JRC, NML, CPF, RLF, TRB, LAV, STF and FDF analyzed and
discussed the data. DPM and FDF designed the experiments in macaques, and
DPM performed the experiments in macaques. JRC, MAS and RF performed
and analyzed the electrophysiological experiments. WLK, MJS, JBC, FML, DPM
and LAV contributed animals, reagents, materials and analysis tools. JRC, NML,
STF and FDF analyzed and discussed the results. FDF supervised the project.
FDF, STF, JRC and NML wrote the manuscript.
Conflict of interestWLK is a cofounder of Acumen Pharmaceuticals, which has been licensed by
Northwestern University to develop ADDL technology for Alzheimer’s thera-
peutics and diagnostics.
References
Arruda AP, Milanski M, Coope A, Torsoni AS, Ropelle E, Carvalho DP,
Carvalheira JB, Velloso LA (2011) Low-grade hypothalamic inflammation
leads to defective thermogenesis, insulin resistance, and impaired insulin
secretion. Endocrinology 152: 1314 – 1326
Bomfim TR, Forny-Germano L, Sathler LB, Brito-Moreira J, Houzel JC, Decker
H, Silverman MA, Kazi H, Melo HM, McClean PL et al (2012) An
anti-diabetes agent protects the mouse brain from defective insulin
signaling caused by Alzheimer’s disease- associated Abeta oligomers. J Clin
Invest 122: 1339 – 1353
Cai D, Yuan M, Frantz DF, Melendez PA, Hansen L, Lee J, Shoelson SE (2005)
Local and systemic insulin resistance resulting from hepatic activation of
IKK-beta and NF-kappaB. Nat Med 11: 183 – 190
Chhatwal JP, Sperling RA (2012) Functional MRI of mnemonic networks
across the spectrum of normal aging, mild cognitive impairment, and
Alzheimer’s disease. J Alzheimers Dis 31(Suppl 3): S155 – S167
Costa RO, Lacor PN, Ferreira IL, Resende R, Auberson YP, Klein WL, Oliveira
CR, Rego AC, Pereira CM (2012) Endoplasmic reticulum stress occurs
downstream of GluN2B subunit of N-methyl-d-aspartate receptor in
mature hippocampal cultures treated with amyloid-beta oligomers. Aging
Cell 11: 823 – 833
Craft S, Zallen G, Baker LD (1992) Glucose and memory in mild senile
dementia of the Alzheimer type. J Clin Exp Neuropsychol 14: 253 – 267
Craft S (2007) Insulin resistance and Alzheimer’s disease pathogenesis:
potential mechanisms and implications for treatment. Curr Alzheimer Res
4: 147 – 152
Craft S (2012) Alzheimer disease: insulin resistance and AD–extending the
translational path. Nat Rev Neurol 8: 360 – 362
De Felice FG (2013) Alzheimer’s disease and insulin resistance: translating
basic science into clinical applications. J Clin Invest 123: 531 – 539
De Felice FG, Ferreira ST (2014) Inflammation, defective insulin signaling, and
mitochondrial dysfunction as common molecular denominators
connecting type 2 diabetes to Alzheimer disease. Diabetes 63: 2262 – 2272
De Felice FG, Velasco PT, Lambert MP, Viola K, Fernandez SJ, Ferreira ST, Klein
WL (2007) Abeta oligomers induce neuronal oxidative stress through an
N-methyl-D-aspartate receptor-dependent mechanism that is blocked by
the Alzheimer drug memantine. J Biol Chem 282: 11590 – 11601
De Felice FG, Vieira MN, Bomfim TR, Decker H, Velasco PT, Lambert MP, Viola
KL, Zhao WQ, Ferreira ST, Klein WL (2009) Protection of synapses against
Alzheimer’s-linked toxins: insulin signaling prevents the pathogenic
binding of Abeta oligomers. Proc Natl Acad Sci USA 106: 1971 – 1976
Denis RG, Arruda AP, Romanatto T, Milanski M, Coope A, Solon C, Razolli DS,
Velloso LA (2010) TNF-alpha transiently induces endoplasmic reticulum
stress and an incomplete unfolded protein response in the hypothalamus.
Neuroscience 170: 1035 – 1044
El-Haschimi K, Pierroz DD, Hileman SM, Bjorbaek C, Flier JS (2000) Two
defects contribute to hypothalamic leptin resistance in mice with
diet-induced obesity. J Clin Invest 105: 1827 – 1832
The paper explained
ProblemDiabetes and Alzheimer’s disease (AD) are chronic degenerativediseases increasing in prevalence in aging populations worldwide.Although clinical and epidemiological studies have linked AD to diabe-tes, with each disease increasing the risk of developing the other, whyAD patients present increased probability of developing diabetes isunknown.
ResultsWe demonstrate that AbOs, toxins that accumulate in the AD brainand have been linked to neuronal dysfunction in brain areas relatedto learning and memory, impact the hypothalamus of mice andmacaques. The hypothalamus is a brain region that regulates glucosehomeostasis in the body. Intriguingly, infusion of AbOs in the braintriggers glucose intolerance, insulin resistance and other manifesta-tions of diabetes in mice. Similar alterations were observed in twotransgenic mouse models of AD.
ImpactOur discovery that AbOs instigate hypothalamic deregulation andglucose intolerance draws attention to a brain structure that has beenlargely ignored to date in the study of Alzheimer’s pathogenesis. Sincethere is evidence that Alzheimer’s patients present glucose intoler-ance, our results highlight the importance of recognizing Alzheimer’sas a disease of both the brain and the periphery.
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
207
Ferreira ST, Klein WL (2011) The Abeta oligomer hypothesis for synapse
failure and memory loss in Alzheimer’s disease. Neurobiol Learn Mem 96:
529 – 543
Figueiredo CP, Bicca MA, Latini A, Prediger RD, Medeiros R, Calixto JB (2011)
Folic acid plus alpha-tocopherol mitigates amyloid-beta-induced
neurotoxicity through modulation of mitochondrial complexes activity. J
Alzheimers Dis 24: 61 – 75
Figueiredo CP, Clarke JR, Ledo JH, Ribeiro FC, Costa CV, Melo HM, Mota-Sales
AP, Saraiva LM, Klein WL, Sebollela A et al (2013) Memantine rescues
transient cognitive impairment caused by high-molecular-weight abeta
oligomers but not the persistent impairment induced by
low-molecular-weight oligomers. J Neurosci 33: 9626 – 9634
Forny-Germano L, Lyra E, Silva NM, Batista AF, Brito-Moreira J, Gralle M,
Boehnke SE, Coe BC, Lablans A, Marques SA et al (2014) Alzheimer’s
Disease-Like Pathology Induced by Amyloid-beta Oligomers in Nonhuman
Primates. J Neurosci 34: 13629 – 13643
Frazao R, Cravo RM, Donato J Jr, Ratra DV, Clegg DJ, Elmquist JK, Zigman JM,
Williams KW, Elias CF (2013) Shift in Kiss1 cell activity requires estrogen
receptor alpha. J Neurosci 33: 2807 – 2820
Fronczek R, van GS, Frolich M, Overeem S, Roelandse FW, Lammers GJ, Swaab
DF (2012) Hypocretin (orexin) loss in Alzheimer’s disease. Neurobiol Aging
33: 1642 – 1650
Gomes S, Martins I, Fonseca AC, Oliveira CR, Resende R, Pereira CM (2014)
Protective effect of leptin and ghrelin against toxicity induced by
amyloid-beta oligomers in a hypothalamic cell line. J Neuroendocrinol 26:
176 – 185
Gregor MF, Hotamisligil GS (2011) Inflammatory mechanisms in obesity. Annu
Rev Immunol 29: 415 – 445
Hahn TM, Breininger JF, Baskin DG, Schwartz MW (1998) Coexpression of
Agrp and NPY in fasting-activated hypothalamic neurons. Nat Neurosci 1:
271 – 272
Hill JW, Elias CF, Fukuda M, Williams KW, Berglund ED, Holland WL, Cho YR,
Chuang JC, Xu Y, Choi M et al (2010) Direct insulin and leptin action on
pro-opiomelanocortin neurons is required for normal glucose homeostasis
and fertility. Cell Metab 11: 286 – 297
Ho L, Qin W, Pompl PN, Xiang Z, Wang J, Zhao Z, Peng Y, Cambareri G,
Rocher A, Mobbs CV et al (2004) Diet-induced insulin resistance promotes
amyloidosis in a transgenic mouse model of Alzheimer’s disease. FASEB J
18: 902 – 904
Hotamisligil GS, Spiegelman BM (1994) Tumor necrosis factor alpha: a key
component of the obesity-diabetes link. Diabetes 43: 1271 – 1278
Hotamisligil GS, Peraldi P, Budavari A, Ellis R, White MF, Spiegelman BM
(1996) IRS-1-mediated inhibition of insulin receptor tyrosine kinase
activity in TNF-alpha- and obesity-induced insulin resistance. Science 271:
665 – 668
Hotamisligil GS (2010) Endoplasmic reticulum stress and the inflammatory
basis of metabolic disease. Cell 140: 900 – 917
Huang S, Czech MP (2007) The GLUT4 glucose transporter. Cell Metab 5:
237 – 252
Jankowsky JL, Slunt HH, Ratovitski T, Jenkins NA, Copeland NG, Borchelt DR
(2001) Co-expression of multiple transgenes in mouse CNS: a comparison
of strategies. Biomol Eng 17: 157 – 165
Janson J, Laedtke T, Parisi JE, O’Brien P, Petersen RC, Butler PC (2004)
Increased risk of type 2 diabetes in Alzheimer disease. Diabetes 53:
474 – 481
Ji Y, Sun S, Xia S, Yang L, Li X, Qi L (2012) Short term high fat diet challenge
promotes alternative macrophage polarization in adipose tissue via
natural killer T cells and interleukin-4. J Biol Chem 287: 24378 – 24386
Jimenez-Palomares M, Ramos-Rodriguez JJ, Lopez-Acosta JF, Pacheco-Herrero
M, Lechuga-Sancho AM, Perdomo G, Garcia-Alloza M, Cozar-Castellano I
(2012) Increased Abeta production prompts the onset of glucose
intolerance and insulin resistance. Am J Physiol Endocrinol Metab 302:
E1373 – E1380
Jurgensen S, Antonio LL, Mussi GE, Brito-Moreira J, Bomfim TR, De Felice FG,
Garrido-Sanabria ER, Cavalheiro EA, Ferreira ST (2011) Activation of D1/D5
dopamine receptors protects neurons from synapse dysfunction induced
by amyloid-beta oligomers. J Biol Chem 286: 3270 – 3276
Koch L, Wunderlich FT, Seibler J, Konner AC, Hampel B, Irlenbusch S, Brabant
G, Kahn CR, Schwenk F, Bruning JC (2008) Central insulin action regulates
peripheral glucose and fat metabolism in mice. J Clin Invest 118:
2132 – 2147
Lacor PN, Buniel MC, Chang L, Fernandez SJ, Gong Y, Viola KL, Lambert MP,
Velasco PT, Bigio EH, Finch CE et al (2004) Synaptic targeting by
Alzheimer’s-related amyloid beta oligomers. J Neurosci 24: 10191 – 10200
Lambert MP, Barlow AK, Chromy BA, Edwards C, Freed R, Liosatos M, Morgan
TE, Rozovsky I, Trommer B, Viola KL et al (1998) Diffusible, nonfibrillar
ligands derived from Abeta1-42 are potent central nervous system
neurotoxins. Proc Natl Acad Sci USA 95: 6448 – 6453
Lambert MP, Velasco PT, Chang L, Viola KL, Fernandez S, Lacor PN, Khuon D,
Gong Y, Bigio EH, Shaw P et al (2007) Monoclonal antibodies that target
pathological assemblies of Abeta. J Neurochem 100: 23 – 35
Laursen SE, Belknap JK (1986) Intracerebroventricular injections in mice.
Some methodological refinements. J Pharmacol Methods 16: 355 – 357
Le BJ, Pelletier AL, Arapis K, Hourseau M, Cluzeaud F, Descatoire V, Ducroc R,
Aparicio T, Joly F, Couvelard A et al (2014) Overexpression of gastric leptin
precedes adipocyte leptin during high-fat diet and is linked to
5HT-containing enterochromaffin cells. Int J Obes (Lond) 38:
1357 – 1364
Ledo JH, Azevedo EP, Clarke JR, Ribeiro FC, Figueiredo CP, Foguel D, De Felice
FG, Ferreira ST (2013) Amyloid-beta oligomers link depressive-like behavior
and cognitive deficits in mice. Mol Psychiatry 18: 1053 – 1054
Lee YS, Li P, Huh JY, Hwang IJ, Lu M, Kim JI, Ham M, Talukdar S, Chen A, Lu
WJ et al (2011) Inflammation is necessary for long-term but not
short-term high-fat diet-induced insulin resistance. Diabetes 60:
2474 – 2483
Loskutova N, Honea RA, Brooks WM, Burns JM (2010) Reduced limbic and
hypothalamic volumes correlate with bone density in early Alzheimer’s
disease. J Alzheimers Dis 20: 313 – 322
Lourenco MV, Clarke JR, Frozza RL, Bomfim TR, Forny-Germano L, Batista AF,
Sathler LB, Brito-Moreira J, Amaral OB, Silva CA et al (2013) TNF-alpha
mediates PKR-dependent memory impairment and brain IRS-1 inhibition
induced by Alzheimer’s beta-amyloid oligomers in mice and monkeys. Cell
Metab 18: 831 – 843
Ma QL, Yang F, Rosario ER, Ubeda OJ, Beech W, Gant DJ, Chen PP, Hudspeth
B, Chen C, Zhao Y et al (2009) Beta-amyloid oligomers induce
phosphorylation of tau and inactivation of insulin receptor substrate via
c-Jun N-terminal kinase signaling: suppression by omega-3 fatty acids and
curcumin. J Neurosci 29: 9078 – 9089
Ma T, Trinh MA, Wexler AJ, Bourbon C, Gatti E, Pierre P, Cavener DR, Klann E
(2013) Suppression of eIF2alpha kinases alleviates Alzheimer’s
disease-related plasticity and memory deficits. Nat Neurosci 16:
1299 – 1305
Matsuzaki T, Sasaki K, Tanizaki Y, Hata J, Fujimi K, Matsui Y, Sekita A, Suzuki
SO, Kanba S, Kiyohara Y et al (2010) Insulin resistance is associated with
the pathology of Alzheimer disease: the Hisayama study. Neurology 75:
764 – 770
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
208
Milanski M, Degasperi G, Coope A, Morari J, Denis R, Cintra DE, Tsukumo DM,
Anhe G, Amaral ME, Takahashi HK et al (2009) Saturated fatty acids
produce an inflammatory response predominantly through the activation
of TLR4 signaling in hypothalamus: implications for the pathogenesis of
obesity. J Neurosci 29: 359 – 370
Milanski M, Arruda AP, Coope A, Ignacio-Souza LM, Nunez CE, Roman EA,
Romanatto T, Pascoal LB, Caricilli AM, Torsoni MA et al (2012) Inhibition
of hypothalamic inflammation reverses diet-induced insulin resistance in
the liver. Diabetes 61: 1455 – 1462
Moloney AM, Griffin RJ, Timmons S, O’Connor R, Ravid R, O’Neill C (2010)
Defects in IGF-1 receptor, insulin receptor and IRS-1/2 in Alzheimer’s
disease indicate possible resistance to IGF-1 and insulin signalling.
Neurobiol Aging 31: 224 – 243
Mucke L, Selkoe DJ (2012) Neurotoxicity of amyloid beta-protein: synaptic
and network dysfunction. Cold Spring Harb Perspect Med 2: a006338
Oddo S, Caccamo A, Shepherd JD, Murphy MP, Golde TE, Kayed R, Metherate
R, Mattson MP, Akbari Y, LaFerla FM (2003) Triple-transgenic model of
Alzheimer’s disease with plaques and tangles: intracellular Abeta and
synaptic dysfunction. Neuron 39: 409 – 421
Ogomori K, Kitamoto T, Tateishi J, Sato Y, Suetsugu M, Abe M (1989)
Beta-protein amyloid is widely distributed in the central nervous
system of patients with Alzheimer’s disease. Am J Pathol 134:
243 – 251
Ott A, Stolk RP, van HF, Pols HA, Hofman A, Breteler MM (1999) Diabetes
mellitus and the risk of dementia: the Rotterdam Study. Neurology 53:
1937 – 1942
Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuncman G,
Gorgun C, Glimcher LH, Hotamisligil GS (2004) Endoplasmic reticulum
stress links obesity, insulin action, and type 2 diabetes. Science 306:
457 – 461
Ozcan U, Yilmaz E, Ozcan L, Furuhashi M, Vaillancourt E, Smith RO, Gorgun
CZ, Hotamisligil GS (2006) Chemical chaperones reduce ER stress and
restore glucose homeostasis in a mouse model of type 2 diabetes. Science
313: 1137 – 1140
Purkayastha S, Zhang H, Zhang G, Ahmed Z, Wang Y, Cai D (2011) Neural
dysregulation of peripheral insulin action and blood pressure by
brain endoplasmic reticulum stress. Proc Natl Acad Sci USA 108:
2939 – 2944
Romanatto T, Roman EA, Arruda AP, Denis RG, Solon C, Milanski M, Moraes
JC, Bonfleur ML, Degasperi GR, Picardi PK et al (2009) Deletion of tumor
necrosis factor-alpha receptor 1 (TNFR1) protects against diet-induced
obesity by means of increased thermogenesis. J Biol Chem 284:
36213 – 36222
Ropelle ER, Flores MB, Cintra DE, Rocha GZ, Pauli JR, Morari J, de Souza CT,
Moraes JC, Prada PO, Guadagnini D et al (2010) IL-6 and IL-10
anti-inflammatory activity links exercise to hypothalamic insulin and
leptin sensitivity through IKKbeta and ER stress inhibition. PLoS Biol 8:
e1000465
Rossmeisl M, Rim JS, Koza RA, Kozak LP (2003) Variation in type 2 diabetes–
related traits in mouse strains susceptible to diet-induced obesity.
Diabetes 52: 1958 – 1966
Sanchez-Lasheras C, Konner AC, Bruning JC (2010) Integrative neurobiology of
energy homeostasis-neurocircuits, signals and mediators. Front
Neuroendocrinol 31: 4 – 15
Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, Baskin DG (2000) Central
nervous system control of food intake. Nature 404: 661 – 671
Schwartz MW, Porte D Jr (2005) Diabetes, obesity, and the brain. Science 307:
375 – 379
Sebollela A, Freitas-Correa L, Oliveira FF, Paula-Lima AC, Saraiva LM, Martins
SM, Mota LD, Torres C, Alves-Leon S, de Souza JM et al (2012)
Amyloid-beta oligomers induce differential gene expression in adult
human brain slices. J Biol Chem 287: 7436 – 7445
Selkoe DJ (2011) Resolving controversies on the path to Alzheimer’s
therapeutics. Nat Med 17: 1060 – 1065
Selkoe DJ (2012) Preventing Alzheimer’s disease. Science 337: 1488 – 1492
Shi JQ, Shen W, Chen J, Wang BR, Zhong LL, Zhu YW, Zhu HQ, Zhang QQ,
Zhang YD, Xu J (2011a) Anti-TNF-alpha reduces amyloid plaques and tau
phosphorylation and induces CD11c-positive dendritic-like cell in the APP/
PS1 transgenic mouse brains. Brain Res 1368: 239 – 247
Shi JQ, Wang BR, Jiang WW, Chen J, Zhu YW, Zhong LL, Zhang YD, Xu J (2011b)
Cognitive improvement with intrathecal administration of infliximab in a
woman with Alzheimer’s disease. J Am Geriatr Soc 59: 1142 – 1144
Sims-Robinson C, Kim B, Rosko A, Feldman EL (2010) How does diabetes
accelerate Alzheimer disease pathology? Nat Rev Neurol 6: 551 – 559
Standaert DG, Lee VM, Greenberg BD, Lowery DE, Trojanowski JQ (1991)
Molecular features of hypothalamic plaques in Alzheimer’s disease. Am J
Pathol 139: 681 – 691
Steinberg GR, Michell BJ, van Denderen BJ, Watt MJ, Carey AL, Fam BC,
Andrikopoulos S, Proietto J, Gorgun CZ, Carling D et al (2006) Tumor
necrosis factor alpha-induced skeletal muscle insulin resistance
involves suppression of AMP-kinase signaling. Cell Metab 4:
465 –474
Takeda S, Sato N, Uchio-Yamada K, Sawada K, Kunieda T, Takeuchi D,
Kurinami H, Shinohara M, Rakugi H, Morishita R (2010)
Diabetes-accelerated memory dysfunction via cerebrovascular
inflammation and Abeta deposition in an Alzheimer mouse model with
diabetes. Proc Natl Acad Sci USA 107: 7036 – 7041
Talbot K, Wang HY, Kazi H, Han LY, Bakshi KP, Stucky A, Fuino RL, Kawaguchi KR,
Samoyedny AJ, Wilson RS et al (2012) Demonstrated brain insulin
resistance in Alzheimer’s disease patients is associated with IGF-1
resistance, IRS-1 dysregulation, and cognitive decline. J Clin Invest 122:
1316– 1338
Thaler JP, Yi CX, Schur EA, Guyenet SJ, Hwang BH, Dietrich MO, Zhao X,
Sarruf DA, Izgur V, Maravilla KR et al (2012) Obesity is associated with
hypothalamic injury in rodents and humans. J Clin Invest 122:
153 – 162
Thaler JP, Guyenet SJ, Dorfman MD, Wisse BE, Schwartz MW (2013)
Hypothalamic inflammation: marker or mechanism of obesity
pathogenesis? Diabetes 62: 2629 – 2634
Walsh DM, Klyubin I, Fadeeva JV, Cullen WK, Anwyl R, Wolfe MS, Rowan MJ,
Selkoe DJ (2002) Naturally secreted oligomers of amyloid beta protein
potently inhibit hippocampal long-term potentiation in vivo. Nature 416:
535 – 539
Wang KC, Woung LC, Tsai MT, Liu CC, Su YH, Li CY (2012) Risk of Alzheimer’s
disease in relation to diabetes: a population-based cohort study.
Neuroepidemiology 38: 237 – 244
Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS,
Tartaglia LA et al (2003) Chronic inflammation in fat plays a crucial role
in the development of obesity-related insulin resistance. J Clin Invest 112:
1821 – 1830
Zhang G, Li J, Purkayastha S, Tang Y, Zhang H, Yin Y, Li B, Liu G, Cai D (2013)
Hypothalamic programming of systemic ageing involving IKK-beta,
NF-kappaB and GnRH. Nature 497: 211 – 216
Zhang X, Zhang G, Zhang H, Karin M, Bai H, Cai D (2008) Hypothalamic
IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance
and obesity. Cell 135: 61 – 73
ª 2015 The Authors EMBO Molecular Medicine Vol 7 | No 2 | 2015
Julia R Clarke et al AbOs trigger peripheral metabolic deregulation EMBO Molecular Medicine
209
Zhang Y, Zhou B, Zhang F, Wu J, Hu Y, Liu Y, Zhai Q (2012) Amyloid-beta
induces hepatic insulin resistance by activating JAK2/STAT3/SOCS-1
signaling pathway. Diabetes 61: 1434 – 1443
Zhao WQ, De Felice FG, Fernandez S, Chen H, Lambert MP, Quon MJ, Krafft
GA, Klein WL (2008) Amyloid beta oligomers induce impairment of
neuronal insulin receptors. FASEB J 22: 246 – 260
Zussy C, Brureau A, Delair B, Marchal S, Keller E, Ixart G, Naert G, Meunier J,
Chevallier N, Maurice T et al (2011) Time-course and regional analyses of
the physiopathological changes induced after cerebral injection of an
amyloid b fragment in rats. Am J Pathol 179: 315 – 334
License: This is an open access article under the
terms of the Creative Commons Attribution 4.0
License, which permits use, distribution and reproduc-
tion in any medium, provided the original work is
properly cited.
EMBO Molecular Medicine Vol 7 | No 2 | 2015 ª 2015 The Authors
EMBO Molecular Medicine AbOs trigger peripheral metabolic deregulation Julia R Clarke et al
210
1"
"
Clarke et al. - Supplementary Information
Contents
Supplementary Figure 1. Injection of blue dye into the lateral cerebral ventricle of
mice…………………………………………………………………………………............
2
Supplementary Figure 2. Effects of i.c.v.-injected AβOs or scrambled Aβ peptide versus
short-term high-fat diet on peripheral glucose tolerance in mice…………………………...
3
Supplementary Figure 3. AβOs do not induce changes in hypothalamic levels of several
ER stress markers and of phosphorylated JNK and PKR…………………...........................
4
Supplementary Figure 4. Cytoarchitecture of monkey hypothalamus……………............... 5
Supplementary Figure 5. AβOs do not affect electrophysiological properties of NPY-
neurons………………………………………………………………………………………
6
Supplementary Figure 6. I.c.v. treatment with infliximab prevents AβO-induced glucose
intolerance in mice…………………………………………………………………………..
7
Supplementary Table 1. Primer sequences used for qPCR reactions………………………. 8
Supplementary References 9
2"
"
Supplementary Figure 1. Injection of blue dye into the lateral cerebral ventricle of Swiss
mice. A, Scheme of a coronal section of the mouse brain (adapted from Paxinos and Franklin,
1997). Blue labeling represents the right lateral ventricle targeted by i.c.v. injection. Cx, cortex;
CC, corpus callosum; Cpu, caudate putamen; LV, lateral ventricle; 3V, third ventricle; D3V,
dorsal third ventricle. (B, C) bottom-up and sagital (along the midline) views, respectively, of a
mouse brain after injection of 3 µl of blue dye into the lateral ventricle. Note the hypothalamus is
completely surrounded by the dye (B, C). Arrow in C indicates the site of injection. Scale bar =
0.5 cm.
3"
"
Supplementary Figure 2. Effects of i.c.v.-injected AβOs or scrambled Aβ peptide versus
short-term high-fat diet on peripheral glucose tolerance in mice. A, Adult Swiss mice that
received a single i.c.v. injection of vehicle, scrambled Aβ peptide (scrAβOs) or AβOs (10 pmol)
were tested on a glucose tolerance test 7 days post-injection (2g glucose/kg body weight, i.p.; n =
13 Veh; 12 AβOs; 10 scrAβOs). B, Swiss mice fed a high-fat diet for 7 days were submitted to a
glucose tolerance test (2g glucose/kg body weight, i.p.) and compared to Swiss mice that
received a single i.c.v. injection of vehicle or AβOs (10 pmol; 7 days post-injection, n = 8
animals/group). C-E, Glucose tolerance tests (2 g glucose/kg body weight, i.p.) performed 12 h
(C; n = 6 Veh; 9 AβOs), 36 h (D; n = 6 Veh; 9 AβOs) or 14 days (E; n = 6 animals/group) after
i.c.v. injection of vehicle or AβOs (10 pmol). Bar graphs represent areas under the curves in the
4"
"
time-course plots of the glucose tolerance test. Data are expressed as means ± S.E.M. A, * p =
0.0155; B, * p = 0.0061 and 0.0037; D, * p = 0.0247; E, # p = 0.0665) one-way ANOVA
followed by Bonferroni.
Supplementary Figure 3. AβOs do not induce changes in hypothalamic levels of several ER
stress markers and of phosphorylated JNK and PKR. (A-H) Western blot analysis of
hypothalamic levels of PERKpTHr980 (A; n = 5 Veh; 8 AβOs), ATF6 (B; n = 7 Veh; 8 AβOs),
pIRE-1α (C; n = 7 animals/group), spliced (D; n = 5 Veh; 8 AβOs) and unspliced Xbp1 (E; n = 6
Veh; 8 AβOs), GRP78 (F; n = 7 Veh; 8 AβOs), pJNK (G; n = 4 Veh; 5 AβOs) and pPKR (H; n =
5"
"
5 Veh; 4 AβOs) 4 h after a single i.c.v. injection of vehicle or 10 pmol AβOs in mice. (I, J),
Western blot analysis of hypothalamic levels of p-JNK (I; n = 5 animals/group) and pPKR (J; n
= 4 Veh; 5 AβOs) 7 days after i.c.v. injection of vehicle or AβOs in mice. Graphs show
densitometric data normalized by actin (B, D-F) or by the levels of total PERK (A), IRE-1 (C),
JNK (G and I) or PKR (H and J). Data are expressed as mean ± S.E.M.
Supplementary Figure 4. Cytoarchitecture of monkey hypothalamus. Cresyl violet staining
of a sham-operated monkey brain. 3V, third ventricle; VMH, ventromedial hypothalamus; PME,
posterior medial eminence; opt, optic tract; Hy, hypothalamus; ArcH, arcuate nucleus of
hypothalamus (Martin and Bowden, 1996). Scale bar = 200 µm in A and 100 µm in B.
6"
"
Supplementary Figure 5. AβOs do not affect electrophysiological properties of NPY-
neurons. Swiss mice received a single i.c.v. injection of vehicle (Veh) or 10 pmol AβOs and
their brains were used for whole-cell patch clamp recordings seven days after. (A-E) Coronal
slices were used for recording of spontaneous activity of NPY neurons in the arcuate nucleus. No
changes in amplitude or frequency of spontaneous excitatory (sEPSC) or inhibitory post-synaptic
currents (sIPSC) were detected between groups. E, resting membrane potential of recorded cells.
N = 20-21 slices obtained from 7 mice in each group, 3-4 cells recorded per slice. Data are
expressed as mean ± S.E.M.
7"
"
Supplementary Figure 6. I.c.v. treatment with infliximab prevents AβO-induced glucose
intolerance in mice. Adult Swiss mice received a single i.c.v. injection of PBS or infliximab
(0.2 µg) 20 min before receiving an i.c.v. injection of vehicle (Veh) or AβOs (10 pmol). Seven
days post injection, mice were submitted to a glucose tolerance test (2g glucose/kg body weight,
i.p.). Bar graphs represent areas under the curve in the time course plots of the glucose tolerance
test. Data are expressed as means ± S.E.M. * p = 0.0494, Student’s t-test (Veh vs AβOs) (n = 12
Veh; 11 AβOs; 14 Veh+Inflix; 14 AβOs+Inflix).
8"
"
Supplementary Table 1. Primer sequences used for qPCR reactions.
Target"gene" Forward"primer" Reverse"primer"
NPY" ATG"CTA"GGT"AAC"AAG"CGA"ATG"G" TGT"CGC"AGA"GCG"GAG"TAG"TAT"
POMC" ATG"CCG"AGA"TTC"TGC"TAC"AGT" TCC"AGC"GAG"AGG"TCG"AGT"TT"
AgRP" ATG"CTG"ACT"GCA"ATG"TTG"CTG" CAG"ACT"TAG"ACC"TGG"GAA"CTC"T"
IL6" TTC"TTG"GGA"CTG"ATG"CTG"GTG" CAG"AAT"TGC"CAT"TGC"ACA"ACT"C"
TNFα" CCC"TCA"CAC"TCA"GAT"CAT"CTT"CT" GCT"ACG"ACG"TGG"GCT"ACA"G"
Leptin" TGA"GCT"ATC"TGC"AGC"ACG"TT" TTC"ACA"CAC"GCA"GTC"GGT"AT"
GLUT4" AAA"AGT"GCC"TGA"AAC"CAG"AG" TCA"CCT"CCT"GCT"CTA"AAA"GG"
Actin" GCC"CTG"AGG"CTC"TTT"TCC"AG" TGC"CAC"AGG"ATT"CCA"TAC"CC"
GAPDH" AGG"TCG"GTG"TGA"TGA"ACG"GAT"TTG" TGT"AGA"CCA"TGT"AGT"TGA"GGT"CA"
9"
"
Supplementary References
Martin RF, Bowden DM (1996) A stereotaxic template atlas of the macaque
brain for digital imaging and quantitative neuroanatomy. NeuroImage 4:
119 – 150
Paxinos G, Franklin K (1997) The Mouse Brain in Stereotaxic Coordinates. San
Diego, USA: Academic Press