contribuiÇÕes À biogeografia do cerrado e da mata...
TRANSCRIPT
UNIVERSIDADE FEDERAL DE MINAS GERAIS INSTITUTO DE CIÊNCIAS BIOLÓGICAS DEPARTAMENTO DE BIOLOGIA GERAL PROGRAMA DE PÓS-GRADUAÇÃO EM GENÉTICA
TESE DE DOUTORADO
CONTRIBUIÇÕES À BIOGEOGRAFIA DO CERRADO E DA MATA ATLÂNTICA: FILOGEOGRAFIA E DIVERSIDADE GENÉTICA EM ESPÉCIES VICARIANTES DE JATOBÁ
(Hymenaea courbaril e H. stigonocarpa)
ORIENTANDA: Ana Carolina Simões Ramos
ORIENTADOR: Profª. Drª. Maria Bernadete Lovato
BELO HORIZONTE
Fevereiro - 2008
Livros Grátis
http://www.livrosgratis.com.br
Milhares de livros grátis para download.
Ana Carolina Simões Ramos
CONTRIBUIÇÕES À BIOGEOGRAFIA DO CERRADO E DA
MATA ATLÂNTICA: FILOGEOGRAFIA E DIVERSIDADE
GENÉTICA EM ESPÉCIES VICARIANTES DE JATOBÁ
(Hymenaea courbaril e H. stigonocarpa )
Tese apresentada ao Programa de Pós-
Graduação em Genética do Instituto de
Ciências Biológicas da Universidade Federal
de Minas Gerais, como requisito parcial para
a obtenção do título de Doutora em
Genética.
BELO HORIZONTE
Fevereiro - 2008
R175c Ramos, Ana Carolina Simões.
Contribuições à biogeografia do cerrado e da Mata Atlântica: filogeografia e
diversidade genética em espécies vicariantes de Jatobá (Hymenaea courbaril e
H. stigonocarpa) [manuscrito] / Ana Carolina Simões Ramos. – 2008.
ix, 78 f. : il. ; 29,5 cm. Orientadora: Maria Bernadete Lovato.
Tese (doutorado) – Universidade Federal de Minas Gerais, Instituto de Ciências Biológicas. 1. Genética – Teses. 2. Mata Atlântica – Teses. 3. Filogeografia. 4. Genética de populações – Teses. 5. Flora dos cerrados – Teses. 6. Hymenaea. 7. Jatobá. 8. Vicariância. I. Lovato, Maria Bernadete. II. Universidade Federal de Minas Gerais. Instituto de Ciências Biológicas. III. Título.
043
iv
“Digo: o real não está na saída nem na chegada: ele se dispõe para a gente é no meio da travessia.”
Riobaldo, protagonista de Grande Sertão: Veredas,
de João Guimarães Rosa.
v
AGRADECIMENTOS
Muito obrigada à minha orientadora Maria Bernadete Lovato por ter acreditado no meu
potencial logo no início das aulas de Genética de Populações, quando eu ainda estava
começando o 3º período do curso de Ciências Biológicas (noturno), e por ter confiado em
mim para iniciarmos uma nova linha de pesquisa no Laboratório. Ela soube muito bem
conviver com as minhas limitações e estimular as minhas capacidades. Acredito que as
poucas discussões que tivemos ao longo desses oito anos só serviram para melhorar o
nosso trabalho cada vez mais.
Ao Professor José Pires de Lemos Filho por colaborar com suas visões biogeográficas e
botânicas muito importantes para as discussões dos nossos trabalhos, e também por
auxiliar nas coletas do material vegetal.
À pesquisadora Ana Y. Ciampi e aos colegas do Laboratório de Genética Vegetal do
CENARGEN (EMBRAPA) pelas colaborações e auxílios durante minha temporada nessa
empresa e por tornarem possível a realização das análises de microssatélites.
Aos pesquisadores Ricardo Alía e Santiago González Martínez por possibilitarem meu
aperfeiçoamento no Instituto Nacional de Investigación y Tecnología Agraria e Alimentaria
(INIA), da Espanha, contribuindo para modificar minha visão sobre determinados projetos e
estudos.
Claro que não poderia esquecer-me da Maria Dolores que mesmo ausente nesses últimos
anos, foi muito importante para minha formação, alegrando os nossos dias com suas risadas
e conselhos.
Um anjo caiu na minha vida e esse anjo tem nome, é Renata Acácio, sem ela com certeza
esse trabalho não seria possível, tanto do ponto de vista emocional como intelectual. Muito
obrigada Rezinha!
Aos colegas de laboratório de Genética de Populações: Reinaldo, Rosângela, Maíra,
Juliano, Lucianas, Renan, Rennan e Helena por terem me ajudado nas coletas do material
ou nas extrações de DNA, e também aos outros alunos que passaram ou ainda estão
conosco por tornarem a convivência sempre mais agradável.
Aos colegas de departamento e especialmente aos amigos do LBEM (Dani, Rodrigo,
Leandro, Eloisa, Paula, etc) e do LGM (Dani Pontes, Lilia, Raquel, Gilka, Cláudias, Michelle,
etc).
Aos amigos Marco, Vânia, Marina e aos outros colegas do CENARGEN pela ajuda e por
proporcionarem a mim uma excelente estadia em Brasília.
vi
Aos professores do departamento de Biologia Geral, especialmente ao Fabrício, que sempre
colaborou com a realização desta tese mesmo quando estava super ocupado (e ele sempre
está) e às professoras Marisa, Cristina e Mônica, que trabalharam mais diretamente comigo
durante o ano de monitoria.
Ao Professor José Miguel Ortega (Migueliiito!) por estar sempre animado, simplificar até os
piores problemas e estar sempre disposto a ajudar e a ir a um sambinha.
À secretária Marina, que sempre resolveu todos os meus “pepinos”.
Aos membros da banca, que concordaram em participar da minha defesa e que com certeza
trarão grandes contribuições ao meu desenvolvimento intelectual.
À CAPES, ao CNPq, ao Governo Brasileiro e a todos os cidadãos brasileiros que pagam
impostos, e portanto, financiaram o meu projeto de pesquisa e a minha bolsa de 5 anos.
Aos meus amigos do peito Ferdi, Chico, Sávio (Pablo para os íntimos), Rezinha
(novamente) e aos meus primos (especialmente “nós somos quatro”) e irmãos (que são
muitos para listar) por despertarem em mim um grande amor e por sempre estarem ao meu
lado mesmo que distantes geograficamente.
Aos meus colegas de turma da graduação, que tornaram divertidíssimos os quatro anos
juntos e até hoje em nossas festinhas me fazem morrer de rir.
À Anita e ao Kléber Galvêas por me acolherem como uma segunda família.
Ao meu namorado, Augusto, que me ajudou muito nesses dois últimos anos e por contribuir
cada dia para que a minha vida seja mais feliz!
À vovó Ruth pela comidinha gostosa e pelo convívio que proporcionaram tranqüilidade para
o meu estudo.
À vovó Edy, que sempre está disposta a me ajudar e que mesmo com mais de 20 netos nos
trata como se fossemos únicos.
Ao vovô Éder por ser um exemplo intelectual, por estimular em mim o interesse pelo estudo
mais aprofundado de todas as coisas e por ter tentado me ensinar português, mesmo sem
sucesso.
E ao papai e à mamãe pelo amor e apoio incondicionais!
vii
SUMÁRIO
LISTA DE FIGURAS..................................................................................................................... IX
LISTA DE TABELAS......................................................................................................................X
RESUMO……………………………………………...................…………………….…..…...……...1
ABSTRACT……………………………………………....................………………….…..…………..3
PREFÁCIO..................................................................................................................................5
INTRODUÇÃO ………………...………………………………….....................……….……..……....6
CAPÍTULO I - Phylogeography of the tree Hymenaea stigonocarpa (Fabaceae:
Caesalpinioideae) and the influence of Quaternary climate changes in the Brazilian
Cerrado……………………………………………………………………………………………….13
1. Abstract……………………………………………………………………………………………14
2. Introduction………………………………………………………………………………………..15
3. Material and Methods…………………………………………………………………………….17
3.1. Sampling populations and DNA extraction………………………………………….17
3.2. Plastid DNA sequencing………………………………………………………………17
3.3. Data analysis…………………………………………………………………………...18
4. Results……………………………………………………………………………………………..19
4.1. Genetic diversity………………………………………………………………………..19
4.2. Phylogeographic structure ……………………………………………………………20
5. Discussion…………………………………………………………………………………………21
6. Literature Cited……………………………………………………………………………………25
7. Acknowledgements……………………………………………………………………………….30
CAPÍTULO II - Similar phylogeographical structure of two vicariant neotropical tree species
(Hymenaea) from savanna and forest that share common life history traits……….…..……..38
1. Summary……………………………………………………………………………………..……39
2. Introduction……………………………………………………………………………………..…40
viii
3. Materials and Methods……………………………………………………………………….…..42
3.1. Sampling populations and DNA extraction……………………………………….....42
3.2. Chloroplast DNA sequencing…………………………………………………….…...42
3.3. Data analysis………………………………………………………………………..….43
4. Results…………………………………………………………………………………………..…44
4.1. Genetic diversity in Hymenaea courbaril………………………………………..…..44
4.2. Phylogeographic structure of cpDNA haplotypes and geographical differentiation
in H. courbaril………………………………………………………………………………………...45
4.3. Comparison with Hymenaea stigonocarpa………………………………………….46
5. Discussion…………………………………………………………………………………………47
6. Acknowledgements……………………………………………………………………………….50
7. References………………………………………………………………………………………...50
CAPÍTULO III - Isolation and characterization of microsatellite loci for Hymenaea courbaril and
transferability to Hymenaea stigonocarpa, two tropical timber species…………………..……64
1. Abstract...............................................................................................................................65
2. Artigo..................................................................................................................................66
3. Acknowledgements.............................................................................................................68
4. References.........................................................................................................................68
CONCLUSÕES ..........................................................................................................................71
REFERÊNCIAS BIBLIOGRÁFICAS.................................................................................................73
ix
LISTA DE FIGURAS
CAPÍTULO I
FIG. 1 Map of Brazil and distribution of cerrado vegetation in grey (a). Approximate
geographic location and plastid DNA haplotype frequencies of studied populations of H.
stigonocarpa. Circle size is proportional to sample size and colours represent the different
haplotypes as shown in the key (b)……………………………………………………………..…32
FIG. 2 MJ network analysis of the relationships between haplotypes of the psbC/trnS3 (524
pb) plastid DNA region from 175 H. stigonocarpa individuals and two outgroups (HA and
HR). Circle area is proportional to haplotype frequency and colours are as Fig.1. Lines drawn
between haplotypes represent mutation events identified by the numbers corresponding to
the positions at which the mutations were observed. Black points represent hypothetical
haplotypes (median vector)…………………………………………………………………………33
CAPÍTULO II
FIG. 1 Geographic location and cpDNA haplotype frequencies of H. courbaril populations.
Circle size is proportional to sample size and colours represent the different haplotypes, as
shown in the key……………………………………………………………………………..………57
FIG. 2 Median-joining network analysis of the relationships among haplotypes of psbC/trnS3
non-coding sequence of cpDNA from 149 individuals of H. courbaril. Circle area is
proportional to haplotype frequency. Lines drawn between haplotypes represent mutation
events identified by the numbers corresponding to the positions where the mutations were
observed..…………………………………………………………………………………………….58
FIG. 3 Median-joining network analysis of the relationships among haplotypes of psbC/trnS3
non-coding sequence of cpDNA from 149 individuals of H. courbaril (black), 175 individuals
of H. stigonocarpa (white) and two outgroup species (gray). Circle area is proportional to
haplotype frequency. Lines drawn between haplotypes represent mutation events identified
by the numbers corresponding to the positions where the mutations were observed. The
point “mv” represents a hypothetical haplotype (median vector)……………………………….59
FIG. 4 Mismatch distribution histogram for cpDNA haplotypes, indicating observed and
expected numbers of pairwise differences between H. courbaril plants………………………60
x
LISTA DE TABELAS
CAPÍTULO I
TABELA 1 Geographical location of Hymenaea stigonocarpa populations, altitude, number of
individuals sampled per population, number of haplotypes per population and diversity
indices based on the psbC/trnS3 region of plastid DNA………………………………………...34
TABELA 2 Distribution and frequency of plastid DNA haplotypes based in psbC/trnS3 region
in each population of Hymenaea stigonocarpa……………………………………………….….35
TABELA 3 Analysis of molecular variance based on the psbC/trnS3 region of plastid DNA for
17 populations of Hymenaea stigonocarpa……………………………………………………….36
TABELA 4 Pairwise comparisons of FST between populations of Hymenaea stigonocarpa
based on the psbC/trnS3 region of plastid DNA………………………………………………….37
CAPÍTULO II
TABELA 1 Geographical location of Hymenaea courbaril populations, number of individuals
sampled per population, number of haplotypes per population and diversity indices based in
psbC/trnS3 non-coding sequence of cpDNA……………………………………………………..61
TABELA 2 Distribution and frequency of cpDNA haplotypes based in psbC/trnS3 non-coding
sequence in each population of Hymenaea courbaril……………………………………………62
TABELA 3 Analysis of molecular variance based on the sequencing of psbC/trnS3 non-coding
region for 15 populations of Hymenaea courbaril and combined analysis with 17 populations
of Hymenaea stigonocarpa…………………………………………………………………………63
CAPÍTULO III
TABELA 1 Nine microsatellite marker loci for Hymenaea courbaril (41 individuals) and H.
stigonocarpa (40 individuals), across populations……………………………………………….70
xi
1
RESUMO
Muito tem sido debatido a respeito da origem, evolução e divergências históricas entre os
biomas brasileiros. Certamente, informações relevantes a esse respeito podem ser obtidas a
partir do conhecimento de aspectos evolutivos e ecológicos de espécies congenéricas que
ocorrem em diferentes biomas. Várias dessas espécies congenéricas foram listadas como
sendo vicariantes, próximas filogeneticamente e em muitos casos de difícil distinção em
material herborizado. Neste estudo foram investigadas a diversidade genética e a estrutura
filogeográfica de duas espécies vicariantes provenientes de diferentes biomas, Hymenaea
courbaril da Mata Atlântica e de matas de galeria do bioma Cerrado e Hymenaea
stigonocarpa espécie endêmica do Cerrado, através da análise de uma sequência de DNA
de cloroplasto (cpDNA) não codificante (psbC-trnS). Foram avaliados 175 indivíduos de 17
populações de H. stigonocarpa e 149 indivíduos de 15 populações de H. courbaril
localizadas em seis diferentes estados brasileiros (MG, SP, GO, ES, BA, TO) e no Distrito
Federal. Em H. stigonocarpa, 23 haplótipos foram identificados e o nível de diferenciação
genética entre populações foi relativamente alto (FST = 0.692). As análises filogeográficas
mostraram a divisão dessas populacões em três grupos geograficamente distintos e esses
resultados foram corroborados pelo programa SAMOVA que indicou que a maior parte da
diversidade genética encontrada (58,8%) foi atribuída à divergência entre os três grupos,
com baixa diferenciação entre populações dentro de grupos (FSC = 0.252). Em H. courbaril
foram identificados 18 haplótipos, sendo que os três mais freqüentes em H. stigonocarpa
foram também encontrados em H. courbaril. Esta espécie também mostrou uma
estruturação geográfica em três grupos, embora a diferenciação entre eles fosse menos
marcante do que em H. stigonocarpa. A AMOVA indicou que apenas 10,5% da variação
genética total se deve a diferença entre as espécies, com a maior parte da variação sendo
atribuída à diferenciação entre populações dentro de espécies. A estrutura filogeográfica
similar destas duas espécies de Hymenaea sugere que elas sofreram os mesmos impactos
das mudanças climáticas do Quaternário. As análises filogeográficas sugerem a extinção de
populações de H. courbaril e de H. stigonocarpa na parte sul da área amostrada durante o
último glacial máximo. Depois do restabelecimento do clima, as partes ao sul devem ter sido
re-colonizadas por linhagens de populações situadas ao norte e leste da área amostrada.
Os dados filogeográficos suportam a hipótese de eventos passados de hibridização entre as
duas espécies de Hymenaea ou a presença de polimorfismo ancestral. Para melhor
conhecer a história evolutiva recente dessas espécies e avaliar a hipótese do possível fluxo
genético entre elas foram iniciados estudos com marcadores nucleares do tipo
microssatélites, que apresentam maior taxa de mutação e fornecem informação biparental.
Em colaboração com a EMBRAPA – CENARGEN foram otimizados nove marcadores
2
nucleares do tipo microssatélites para H. courbaril, sendo que sete foram transferidos com
sucesso para H. stigonocarpa. A análise de 41 indivíduos de duas populações de H.
courbaril detectou grande polimorfismo, com sete a treze alelos por loco e heterozigozidade
observada de 0,75 a 0,90. Em 40 indivíduos de duas populações de H. stigonocarpa, o
número de alelos por loco variou de cinco a sete e a heterozigozidade observada de 0,16 a
0,84.
3
ABSTRACT
There has been much discussion about the origin, evolution and historical divergences which
took place in the Brazilian biomes. Relevant information regarding these processes may
certainly be obtained from the knowledge on the evolutionary and ecological aspects of
congeneric species occurring in different biomes. A large number of these congeneric
species have been listed as vicariant, phylogenetically close species, which are frequently
hard to be distinguished from one another by analyzing material kept in herbaria. In this
study, the genetic diversity and the phylogeographic structure of two vicariant species
occurring in different biomes – Hymenaea coubaril from the Brazilian Atlantic Forest and
from gallery forests in the Cerrado biome and H. stigonocarpa, endemic to the Cerrado –
were investigated by the analysis of a non coding chloroplast DNA sequence (psbC-trnS).
175 individuals from 17 H. stigonocarpa populations, and 149 individuals from 15 H. courbaril
populations, collected in six different Brazilian States (MG, SP, GO, ES, BA, TO) and in the
Federal District (DF) were analyzed. In H. stigonocarpa we identified 23 haplotypes and the
level of genetic differentiation between populations was relatively high (FST = 0.692).
Phylogeographic analyses showed the division of these populations into three geographically
distinct groups and these results were corroborated by the software SAMOVA, which showed
that a large amount of the genetic differentiation (58.8%) was caused by differences
partitioned between the three groups, with low levels of differentiation in populations within
groups (FSC = 0.252). In H. courbaril 18 haplotypes were identified, being the three most
frequent for H. stigonocarpa also identified in the H. courbaril individuals. This species also
presented a geographic structure in three groups, even though its structuring wasn’t as
strong as the one detected for H. stigonocarpa. AMOVA indicates that only 10.5% of the total
genetic variation is due to the differences between the two species, being mostly caused by
differences between populations in the two species. The similar phylogeographic structure of
these two Hymenaea species suggests that they went through the same impacts from
climate changes in the Quaternary. The phylogeographic analyses suggest the extinction of
H. courbaril and H. stigonocarpa populations in the Southern region of the sampled area
during the last maximum glacial event. After the reestablishment of climate conditions, these
southern areas might have been re-colonized from lineages of populations from the northern
and eastern regions of the sampled areas. Phylogeographical data support the hypothesis of
ancient hybridisation between the two Hymenaea species or the presence of ancestral
polymorphism. In order to better understand the recent evolutionary history of these species
and to elucidate the possibility of gene flux between H. stigonocarpa and H. courbaril, studies
with microsatellite markers – which present higher mutation rates and provide gentic
information from both parents – were initiated. We optimized nine nuclear microsatellite
4
markers for H. courbaril in collaboration with EMBRAPA – CENARGEN. Seven of these
markers were successfully transferred to H. stigonocarpa. Analyses in 41 individuals from
two H. courbaril populations detected high polymorphism, with a minimum of 7 and a
maximum of 13 alleles per locus and heterozigosity values that ranged from 0.75 to 0.90. In
40 H. stigonocarpa individuals from two populations the number of alleles per locus ranged
from 5 to 7 and heterozigosity values ranged from 0.16 to 0.84.
5
PREFÁCIO
A presente tese de doutorado está dividida em cinco partes:
• Introdução geral que trata de aspectos pertinentes aos objetivos propostos que não
estão presentes nos artigos;
Três capítulos contendo os artigos científicos gerados com os resultados obtidos nesta tese:
• O primeiro capítulo intitulado “Phylogeography of the Tree Hymenaea stigonocarpa
(Fabaceae: Caesalpinioideae) and the Influence of Quaternary Climate Changes in
the Brazilian Cerrado” (Annals of Botany 2007, 100: 1219-1228), trata da
filogeografia da espécie H. stigonocarpa;
• O segundo capítulo intitulado “Similar phylogeographical structure of two vicariant
neotropical tree species (Hymenaea) from savanna and forest that share common life
history traits”, analisa a filogeografia de H. courbaril e a filogeografia comparativa
com a sua espécie vicariante H. stigonocarpa;
• O terceiro capítulo intitulado “Isolation and characterization of microsatellite loci for
Hymenaea courbaril and transferability to Hymenaea stigonocarpa, two tropical
timber species” (Molecular Ecology Notes, in press), trata de um projeto realizado em
cooperação com a pesquisadora Ana Y. Ciampi (EMBRAPA – Cenargen) que
caracterizou os marcadores SSR para H. courbaril, cabendo a nós os testes de
transferibilidade desses marcadores para a espécie H. stigonocarpa e a análise de
diversidade genética em duas populações de cada uma das duas espécies.
Posteriormente, utilizando estes marcadores de microssatélites, analisamos a
diversidade genética e estrutura populacional de oito populações de H. courbaril e
onze populações de H. stigonocarpa e a comparação da divergência genética entre
as duas espécies, entretanto esse artigo esta em fase final de análise e redação do
manuscrito e não compõe essa tese.
• Conclusões.
6
INTRODUÇÃO
A flora neotropical compreende cerca de 90.000 espécies, que totalizam 37% da flora
mundial, apresentando, portanto, uma diversidade maior que a África e a Ásia juntas
(Thomas, 1999). Apesar de muitas teorias tentarem explicar a origem da diversidade
neotropical, nenhuma é conclusiva (Bush, 1994). A exploração inadequada do ambiente
vem provocando a diminuição das populações naturais e, conseqüentemente, levando à
extinção de um grande número de espécies nos diferentes ecossistemas da terra. A
preocupação com o alto índice de espécies em extinção levou organizações internacionais a
considerar alguns biomas como prioritários para preservação. Entre eles se encontram dois
biomas brasileiros, Mata Atlântica e Cerrado, ricos em biodiversidade, com várias espécies
endêmicas que estão extremamente ameaçadas pela exploração inadequada. A
preservação da diversidade genética é fundamental em programas de conservação, já que é
importante para a sobrevivência da espécie, aumentando a sua capacidade de adaptação
às alterações ambientais. Conseqüentemente, o estudo genético das populações tem sido
identificado como prioritário para preservação (Rossetto, 1995).
De acordo com muitos pesquisadores, a distribuição atual de formações florestais e
savânicas é resultado de alterações climáticas durante o Pleistoceno (1,8 milhão a 11.000
anos atrás) e início do Holoceno (11.000 anos atrás). Nessa época, períodos glaciais e
interglaciais se alternavam, promovendo retrações e expansões da floresta tropical úmida.
Durante os períodos glaciais, nos quais predominavam temperaturas baixas e clima seco, a
floresta tropical ocupava somente áreas mais úmidas e quentes, as quais serviram como
refúgio para organismos da floresta tropical (Whitmore e Prance, 1987; Ab’Sáber, 1990).
Nos períodos interglaciais, caracterizados por altas temperaturas e clima mais úmido, a
vegetação da floresta tropical se expandia novamente e populações previamente isoladas
se reuniam, possibilitando uma mistura das populações que se diferenciaram durante o
isolamento, aumentando assim a diversidade na região (Langenheim et al., 1973). Estudos
paleopalinológicos indicam que ocorreram alterações na distribuição do Cerrado, e não
apenas na floresta tropical, durante as glaciações do Pleistoceno (Behling e Lichte, 1997;
Behling, 1998). Esses trabalhos sugerem que a parte sul da distribuição do Cerrado foi
substituida por campo, e que o Cerrado migrou aproximadamente 750 Km em direção ao
norte, refletindo o clima seco e frio mais pronunciado nas altas latitudes durante os períodos
glaciais, seguidos pela re-colonização dessa área com o restabelecimento do clima (Behling
e Hooghiemstra, 2001). Estas mudanças na cobertura vegetal e na distribuição de espécies
de plantas durante as alterações climáticas do Quaternário têm sido consideradas
importantes na especiação de plantas e na estruturação da diversidade genética
(Richardson et al., 2001; Dutech et al., 2000; Caron et al., 2000; Collevatti et al., 2003).
7
Entretanto, poucos são os trabalhos nas regiões neotropicais e especialmente no Cerrado
que respondem com clareza e precisão às perguntas a respeito das alterações na
vegetação dessas regiões durante as alterações climáticas do Quaternário.
O conceito de filogeografia foi introduzido por Avise e colaboradores (1987) para
designar o estudo da distribuição da variabilidade genética num contexto geográfico e
temporal. A filogeografia providencia um meio de detectar a correlação entre análises
filogenéticas de haplótipos e sua distribuição geográfica, nos níveis intra e inter-específicos
(Avise et al., 1987). Na última década, estudos filogeográficos e evolucionários têm sido
realizados utilizando marcadores de genomas citoplasmáticos herdados uniparentalmente,
como o DNA de cloroplasto (cpDNA) em plantas, que é herdado maternalmente na maioria
das angiospermas e normalmente não está sujeito a recombinação (McCauley, 1995;
Newton et al., 1999; Petit et al., 2003). A estrutura genética deste genoma citoplasmático é
influenciada pelo parentesco histórico e fluxo gênico ancestral entre populações, bem como
por eventos históricos como glaciações e mudanças climáticas ao longo do tempo geológico
(Avise, 1994). Considerando a herança uniparental do cpDNA é possível inferir o fluxo
gênico por semente dentro e entre populações através dos haplótipos identificados (Petit et
al., 1997). As moléculas circulares de cpDNA e DNA mitocondrial (mtDNA) são
caracterizadas por uma estrutura altamente conservada (Palmer e Stein, 1986), embora a
taxa de substituições em genes de cloroplasto seja maior que a taxa em genes mitocondriais
em plantas (Wolfe et al., 1987). O fato de o cpDNA ser conservado permitindo a construção
de “primers universais” (Demesure et al., 1995; Dumolin-Lapègue et al., 1997), aliado à
presença de um polimorfismo maior que o encontrado no mtDNA, tornam o cpDNA mais
adequado para estudos envolvendo espécies próximas de plantas.
Entretanto, o genoma citoplasmático geralmente representa apenas a genealogia de
um único genoma, refletindo apenas a história de um dos parentais. Em contraste,
marcadores nucleares são biparentamente herdados e sofrem recombinação, integrando
vários processos genealógicos (Heuertz et al., 2004). Como resultado, a variação genética
nos loci neutros ao longo de todo o genoma nuclear pode agregar informações às análises
realizadas a partir de genomas citoplasmáticos. Além disso, os marcadores de cpDNA
exibem uma taxa evolutiva mais lenta, sendo assim alguns marcadores com uma taxa
evolutiva mais rápida, como os microssatélites, também denominados SSR (Single
Sequence Repeats), poderiam agregar infomações aos resultados com marcadores
citoplasmáticos e ajudar a elucidar a história evolucionária mais recente de espécies
relacionadas. Os microsatélites são especialmente úteis para estudos populacionais devido
à sua alta taxa de mutação, herança codominante, facilidade de detecção pela reação em
cadeia da polimerase, relativa abundância e ampla cobertura do genoma (Powell et al.,
8
1996; Parker et al., 2002). Como resultado, os microssatélites têm sido amplamente
utilizados em plantas e animais para genética de populações, mapeamento, teste de
paternidade e história demográfica (Goldstein e Schlötterer, 1999; Song e Mitchell-Olds
2006; Song et al., 2006) além de mudanças temporais na diversidade genética (Christiansen
et al., 2002; Roussel et al., 2004). Além disso, recentemente comparações entre “pools”
gênicos de diferentes origens geográficas, principalmente na Europa, têm sido realizadas
com esse marcador (Hai et al., 2007; Roussel et al., 2005; Röder et al., 2002; Huang et al.,
2002).
Diversos gêneros de plantas apresentam espécies de mata e espécies de cerrado
muito afins, porém distintas. Esse fenômeno pode ser chamado de vicariância, quando no
curso de sua evolução certas espécies ou variedades morfologicamente muito afins
ocuparam áreas que se excluem mutuamente (Rizzini, 1997). Além da relação estrutural e
da distribuição em áreas próximas, segundo Rizzini (1997) tais formas são descendentes de
um ancestral comum recente. Thompson (1999) conclui que quando a vicariância ocorre, a
relação filogenética entre taxa relacionados vão refletir as relações históricas entre as áreas
ocupadas pelos taxa em questão. Em um estudo da fitogeografia de espécies savânicas
neotropicais, Prance (1992) encontrou oito pares de espécies da família Chrysobalanaceae
que ocorrem em áreas de mata, mata de galeria e de savana. Ele acredita que a ocorrência
de pares de espécies que ocorrem nesses dois ambientes seja comum para muitas famílias
de plantas arbóreas.
Considerando que a origem, evolução e divergências históricas entre os biomas
brasileiros ainda são incertas, estudos da distribuição geográfica de espécies vicariantes e
de sua diversidade molecular intra e inter-específicas permitem fazer inferências não apenas
sobre suas origens, mas também sobre a evolução dos próprios ambientes nos quais
ocorre. Além disso, a comparação molecular de espécies do mesmo gênero tem sido
considerada como uma abordagem importante para determinar quais fatores ecológicos ou
de história de vida contribuíram para a distribuição geográfica da diversidade (Ayres e Ryan,
1999).
Segundo Heringer e colaboradores (1976) as espécies Hymenaea stigonocarpa Mart.
Ex Hayne e H. courbaril Linnaeus são consideradas espécies vicariantes, uma vez que elas
se substituem em áreas adjacentes, são extremamente afins e dificilmente discerníveis no
herbário, porém bem distintas na natureza. O gênero Hymenaea Linnaeus pertence à tribo
Detarieae, família Leguminosae (Caesalpinioideae), uma das quatro maiores famílias
terrestres da flora mundial, importante tanto para a vegetação quanto para a fauna
(Goodland, 1979). O gênero, produtor de resina, tem uma distribuição anfi-atlântica
(Langenheim et al., 1973). Este gênero apresenta uma espécie africana de ocorrência ao
9
longo da costa leste da África (Langenheim et al., 1973) e 15 espécies distribuídas no
México, América Central e em quase todos os países da América do Sul (exceto Uruguai e
Chile) (Lee e Langenheim, 1975; Poinar, 1991; Poinar e Brown, 2002). Segundo
Langenheim e colaboradores (1973), o gênero Hymenaea tem origem na África, com a
colonização das Américas ocorrendo no Terciário recente. As primeiras espécies a se
originarem seriam: H. torrei (endêmica de Cuba) e H. oblongifolia (América do Sul). Ambas
espécies apresentaram sucesso na estabilização no Novo Mundo e posteriormente surgiram
novas espécies que irradiaram para os ecossistemas secos durante as oscilações climáticas
do Pleistoceno (Langenheim et al., 1973). Para estes autores evidências que sustentam a
hipótese da origem Africana antes da distribuição neotropical são: a grande proximidade
com o gênero Guibourtia de distribuição restrita à Africa e o fato de que 67% das espécies
de Caesalpinoideae são endêmicas da África, fato este ainda mais proeminente na tribo
Detarieae (Langenheim et al., 1973). Considerando-se como verdadeira a hipótese da
origem Africana, poderiam ser consideradas duas explicações para a distribuição
Neotropical: a origem ser anterior à separação dos continentes da África e da América do
Sul ou a possível dispersão oceânica através de pequenos mares e de ilhas vulcânicas
distribuídas entre os continentes. Langenheim e colaboradores (1973) descartaram a
primeira explicação devido às evidências geológicas que datam a separação dos
continentes durante os períodos Jurássico-Cretáceo, época esta em que para eles existiam
poucos gêneros de angiospermas.
Em contrapartida, Poinar e Brown (2002) propõem que o gênero Hymenaea surgiu
quando os continentes ainda estavam unidos (aproximadamente 105 milhões de anos).
Embora fósseis de Hymenaea desta data não tenham sido relatados, pólens fósseis de
Sindora (Caesalpinoideae) foram documentados em Maastrichtian (74-65 milhões de anos)
(Collinson et al., 1993 apud Poinar e Brown, 2002), sugerindo a existência das
Caesalpinoideaes nesse período. Dados mostram que os maiores centros geográficos para
diversidade da tribo Detarieae são a África-Madagascar e a América Tropical com uma
longa história evolucionária nestas regiões (Herendeen et al., 1992 apud Poinar e Brown,
2002). O lugar de origem de grupos taxonômicos pode muitas vezes ser determinado pela
localização de suas espécies existentes. Para Poinar e Brown (2002) o fato do gênero
Hymenaea ter mais espécies na América do Sul (Langenheim et al., 1973) pode sugerir que
a sua origem seria Neotropical, caso não fosse anterior à separação dos continentes.
Uma vez que a revisão do gênero feita por Lee e Langenheim (1975) foi baseada,
sobretudo, em caracteres morfológicos, Rocha (1988) analisou as proteínas de reserva das
sementes de algumas espécies de Hymenaea com a finalidade de auxiliar na taxonomia do
grupo. Entretanto, concluiu que não é possível a separação de taxa através de padrões
10
proteicos encontrados. Semelhantes resultados foram encontrados por Bruneau e
colaboradores (2000) em um estudo das relações filogenéticas das Caesalpinoideaes em
que foram incluídas três espécies do gênero Hymenaea. Neste trabalho as três espécies
não se diferenciaram geneticamente, mas formaram um grupo monofilético.
Como apresentado, existem controvérsias a respeito da origem do gênero
Hymenaea e as relações filogenéticas entre as espécies desse gênero não são bem claras.
Seria de grande importância a realização de uma filogenia do gênero para auxiliar na
classificação, facilitanto assim os estudos que tratam da evolução, genética de populações,
entre outros, com essas espécies.
Hymenaea stigonocarpa, conhecida como jatobá-do-cerrado, é uma espécie
endêmica do Cerrado que ocorre desde o Estado do Piauí até Mato Grosso do Sul,
abrangendo os estados de AM, GO, TO, MG, SP, BA, MA e o DF (Almeida, 1998). A árvore
pode atingir até 12 m de altura (Lee e Langenheim, 1975) e acredita-se que ela reúne
qualidades que lhe possibilitem certo sucesso em experimentos de reflorestamento em
áreas de cerrado (Coutinho et al., 1971). Sua madeira muito durável e de alta resistência é
utilizada na construção naval. Esta espécie também exibe notável capacidade de formar
gemas subterrâneas em situações de estresse ambiental, propiciando uma reprodução
vegetativa (Rizzini, 1997; Bulhão e Figueiredo, 2002). Rizzini (1963) destacou que as
diferenças mais importantes entre espécies vicariantes são que em geral as espécies
xeromorfas (cerradão e Cerrado) exibem porte menor, ramos mais abertos, ramificações
mais baixas, flores e frutos maiores, folhas também maiores, mais grossas e mais pilosas.
Todas essas características citadas por Rizzini (1963) foram observadas por nós na espécie
H. stigonocarpa em comparação com a H. courbaril.
Gibbs e colaboradores (1999) realizaram estudos sobre a biologia da polinização e
sistemas de acasalamento com base em cruzamentos controlados em H. stigonocarpa e
seus resultados indicaram que a espécie é basicamente de fecundação cruzada. O grupo
chegou a esta conclusão ao observar que zigotos resultantes da auto-fecundação manual
foram abortados, provavelmente devido a um mecanismo pós-zigótico, já que os óvulos
auto-fecundados abortados após sete a oito dias apresentaram um zigoto com núcleo
endospérmico, da mesma maneira que os zigotos controles, produtos de fecundação
cruzada. Moraes e colaboradores (2007) estudando o sistema de reprodução com
marcadores moleculares confirmaram que a espécie se reproduz preferencialmente por
cruzamento, mas com certa taxa de autofecundação. A polinização é feita principalmente
por morcegos, mas foram observadas mariposas visitando suas flores (Gibbs et al., 1999).
11
Hymenaea courbaril, conhecida popularmente como jatobá-da-mata, tem uma ampla
distribuição na América tropical e nas Antilhas e é considerada a mais diversa das espécies
do gênero, contendo seis variedades (Lee e Langenheim, 1975). A variedade mais comum
na área amostrada para os trabalhos apresentados nesta tese é a H. courbaril var.
stilbocarpa (Hayne) Lee & Lang., que ocorre normalmente na Mata Atlântica e em florestas
de galeria dos estados de São Paulo, Rio de Janeiro, Minas Gerais, Bahia, Goiás e Distrito
Federal (Lee e Langenheim, 1975). A árvore adulta pode atingir até 40 m de altura (Rizzini,
1971), sendo sua madeira pesada empregada na construção civil e na confecção de artigos
de esportes e de ferramentas. Por sua fácil multiplicação, esta espécie pode participar da
composição de reflorestamentos heterogêneos e da arborização de parques e jardins
(Lorenzi, 1992).
Bawa (1974) estudou sistemas de acasalamento em arbóreas tropicais e descreveu
H. courbaril como auto-incompatível, ou seja, alógama, o que foi confirmado por Crestana e
colaboradores (1985) ao estudarem a ecologia e polinização dessa espécie (como H.
stilbocarpa). Esses autores chegaram a esta conclusão por não terem observado a
formação de frutos após auto-polinizações manuais e o isolamento das inflorescências. A
polinização de H. courbaril é feita principalmente por morcegos (Lee e Langenheim, 1975;
Heithaus et al., 1975; Crestana et al., 1985; Carvalho, 1994; Gibbs et al., 1999), mas
visitantes diurnos também foram observados nesta espécie como himenópteros dípteros e
beija-flores (Crestana et al., 1985). Os frutos são procurados por animais silvestres, como
paca, cutia e macacos, que comem a polpa e dispersam as sementes pela floresta
(Carvalho, 1994).
O conhecimento das divergências históricas dessas espécies vicariantes de
Hymenaea, assim como estimativas de sua diversidade molecular fornecem evidências para
o entendimento da origem e evolução dessas espécies, bem como para a importância dos
eventos históricos como glaciações e mudanças climáticas na diversidade, contribuindo
dessa forma para o entendimento da evolução do Cerrado e da Mata Atlântica. Além disso,
o conhecimento da diversidade dentro e entre as populações dessas espécies pode ser
importante para programas de conservação e manejo visando a manutenção em longo
prazo das populações em sua área de ocorrência. Considerando estes aspectos, a presente
tese teve os seguintes objetivos gerais:
1) analisar a diversidade genética e a estrutura filogeográfica das espécies Hymenaea
stigonocarpa e H. courbaril;
12
2) realizar uma análise filogeográfica comparativa com o par de espécies vicariantes de
Hymenaea, contribuindo para a melhor compreensão da divergência e evolução dos biomas
Mata Atlântica e Cerrado;
3) caracterizar marcadores moleculares nucleares do tipo microssatélites para H.
stigonocarpa e H. courbaril, com perspectiva para uma futura análise do fluxo de pólen e
estrutura genética das populações dessas espécies.
Os objetivos especificos foram:
a) Determinar a diversidade e a estrutura filogeográfica de populações de H. stigonocarpa e
H. courbaril;
b) Comparar a filogeografia dessas duas espécies com similares características e história de
vida e associá-las a estudos paleopalinológicos e paleoclimáticos;
c) Transferir para H. stigonocarpa os marcadores do tipo microssatélites caracterizados para
H. courbaril;
d) Determinar a diversidade e estrutura genética em duas populações de H. stigonocarpa e
duas populações de H. courbaril com os marcadores nucleares do tipo microssatélites para
verificar a eficiência desses marcadores para análises genético-populacionais.
13
CAPÍTULO I
Title: Phylogeography of The tree Hymenaea stigonocarpa (Fabaceae: Caesalpinioideae) and the Influence of Quaternary Climate Changes in the Brazilian Cerrado
Ana Carolina Simões Ramos1, José Pires de Lemos-Filho2, Renata Acácio Ribeiro1, Fabrício
Rodrigues Santos1 and Maria Bernadete Lovato1,*
1Departamento de Biologia Geral, Instituto de Ciências Biológicas, Universidade Federal de
Minas Gerais, Caixa Postal 486, 31270-901 Belo Horizonte, MG, Brazil and 2Departamento
de Botânica, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo
Horizonte, MG, Brazil
Running title: Phylogeography of Hymenaea stigonocarpa
*Author for correspondence (e-mail: [email protected])
14
Background and Aims: Hymenaea stigonocarpa (Fabaceae: Caesalpinioideae) is an
endemic tree from the Brazilian Cerrado (savanna vegetation), a biome classified as a
hotspot for conservation priority. This study investigates the phylogeographic structure of H.
stigonocarpa, in order to understand the processes that have led to its current spatial genetic
pattern.
Methods: The polymorphism level and spatial distribution of the plastid non-coding region
between the genes psbC and trnS sequence were investigated in 175 individuals from 17
populations, covering the greater part of the total species distribution. Molecular diversity
indices were calculated and intraspecific relationships were inferred by the construction of
haplotype networks using the median-joining method. Genetic differentiation among
populations and main geographical groups was evaluated using spatial analysis of molecular
variance (SAMOVA).
Key Results: Twenty three different haplotypes were identified. The level of differentiation
among the populations analysed was relatively high (FST = 0.692). Phylogeographic analyses
showed a clear association between the haplotype network and geographic distribution of
populations, revealing three main geographical groups: western, central, and eastern.
SAMOVA corroborated this finding, indicating that most of the variation can be attributed to
differences among these three groups (58.8%), with low difference among populations within
groups (FSC = 0.252).
Conclusion: The subdivision of the geographic distribution of H. stigonocarpa populations
into three genetically differentiated groups can be associated with Quaternary climatic
changes. The data suggest that during glacial times H. stigonocarpa populations were extinct
in the most parts of the southern present-day cerrado area. Milder climatic conditions in the
north and eastern portions of the cerrado resulted in the maintenance of populations in these
regions. Thus it is inferred that the most southern part of the present-day cerrado was re-
colonised by different lineages from northern parts of this biome, after postglacial climate
amelioration.
Key words: Biogeography, cerrado, genetic structure, Quaternary climate changes,
Fabaceae, Leguminosae, Hymenaea stigonocarpa, neotropical savannas, Pleistocene,
phylogeography, psbC-trnS.
15
INTRODUCTION
Cerrado, the savannas of central Brazil, is the second most extensive biome in South
America after the Amazon rain forest (Eiten, 1972). Recently, it was classified as a hotspot
for conservation priority because of its rich biodiversity, with many endemic plants and
animals. It is also extremely endangered by human action. Natural cerrado vegetation now
covers only 20% of its original area (about 1.7 million km2) (Myers et al., 2000). The cerrado
climate is characterized by conspicuous dry season during the southern winter (approx. April
to September) with an average annual precipitation between 800 mm and 2000 mm and an
average annual temperature between 18 ˚C and 28 ˚C (Ratter et al., 2006). The vegetation is
composed of grasses with relatively shallow roots and deeply rooted evergreen and
deciduous woody plants, growing in oligotrophic soils and subject to frequent fires (Bucci et
al., 2005).
Environmental changes in neotropical savannas appear to have been spatially
complex during glacial periods. The present-day areas cerrado in south-eastern and mid-
western Brazil are probably remnants of a large, continuous area that existed in the past
(Behling and Hooghiemstra, 2001) because of markedly dry conditions during the last
glaciation. Palaeopalynological studies have suggested that in the last glacial period, the
vegetation of the southern cerrado was replaced by subtropical grassland (Behling and
Lichte, 1997; Behling, 1998), which apparently expanded more than 750 km northwards,
reflecting a drier and colder climate and the occurrence of heavy frosts (Behling and
Hooghiemstra, 2001).
The changes in the vegetation coverage and in the distribution of plant species during
the Pleistocene, associated with widespread climatic instability, have been considered to be
important factors in the levels of genetic diversity and population differentiation within species
(Richardson et al., 2001; Dutech et al., 2000; Caron et al., 2000; Collevatti et al., 2003;
Hopper and Gioia 2004).
Phylogeographic studies have been used to investigate the effects of past climatic
changes on the genetic structure of animal and plant species. These studies allow one to
make inferences about species evolution within biomes, and these can be used to plan
conservation strategies. Most phylogeographic studies of plants have been based on the
variation found in organellar genomes, mainly the plastid DNA. Plastid DNA is maternally
inherited in most angiosperms. Gene flow of maternally inherited genes occurs via seed
dispersal and is thus more restricted than that of nuclear genes, which are biparentally
inherited and dispersed by pollen and seed (Birky et al., 1983; Ennos, 1994). The genetic
16
structure of organellar genomes can be greatly influenced by their historical relationship of,
and associated gene flow between, populations, as well as by climatic events, such as
glaciations, that occur with in a geological time frame (Avise et al., 1987; Avise, 1994; Schaal
et al., 1998). Studies in which the genetic structure of angiosperm populations was
characterized both by plastid DNA and nuclear DNA markers have shown that plastid DNA
variation is more spatially structured than nuclear DNA variation (Ennos, 1994; El Mousadik
and Petit, 1996; Petit et al., 2005), as expected due to the smaller effective size of
chloroplast genes compared to nuclear genes.
Most phylogeographic studies in plants have been performed on holartic species (e.g.
Dumolin-Lapègue et al., 1997; Clark et al., 2000; Belahbib et al., 2001; Gugerli et al., 2001;
Magni et al., 2005; Schierenbeck et al., 2005; Zhang et al., 2005). These studies have
helped to reconstruct the history of the species distribution and to identify refugia and routes
of postglacial colonization (Ferris et al., 1993; Petit et al., 1993; Dumolin-Lapègue et al.,
1997; Petit et al., 2003). In the neotropical region, phylogeographic data are scarce (Caron et
al., 2000; Dutech et al., 2000; Richardson et al., 2001; Cavers et al., 2003; Salgueiro et al.,
2004; Lorenz-Lemke et al., 2005), especially for plants occurring in the Brazilian cerrado, for
which only one study is known so far (Collevatti et al., 2003).
Hymenaea stigonocarpa Mart. ex Hayne (Fabaceae: Caesalpinioideae), known as
“jatobá-do-cerrado”, is an endemic species of the cerrado, occurring across almost the entire
region occupied by this biome (approximately between 4º-23º S and 41º-55º W). It is among
the dominant woody species in the cerrado flora, occurring in 236 of 316 sites analyzed
(Ratter et al., 2006). It is an economically valuable tree because its wood is long lasting and
durable, and it is thus widely used in naval and civil construction (Rizzini, 1971). Its fruits
have nutritional potential, both for wild fauna and for humans (Silva et al., 2001). Studies of
the pollination biology and breeding system of H. stigonocarpa have shown that the species
is an outcrosser, with pollination mainly by bats (Gibbs et al., 1999), as in H. courbaril
(Crestana et al., 1985). There is no information in the literature about seed dispersal of H.
stigonocarpa. However, it is widely accepted for H. courbaril that mammals are the principal
seed dispersers (Asquith et al., 1999).
This study investigates the phylogeographic structure of H. stigonocarpa, in order to
understand the processes that have resulted in its current spatial genetic pattern. Our survey
involved the analysis of populations of H. stigonocarpa sampled from the greater part of its
range. The sequencing of the non-coding plastid DNA region, psbC-trnS, together with the
available palaeopalynological and palaeoclimatologic information for south-eastern and
17
central Brazil were used to infer the history of past changes leading to the present-day
distribution of the species and also to identify possible colonization routes.
MATERIAL AND METHODS
Sampling populations and DNA extraction
Young leaves were collected from 175 adult individuals of H. stigonocarpa from 17
populations (Table 1), ranging in distribution from 10°-23°S and 41°-50°W, and from a wide
elevational range (270 - 1080 m), together covering the greater part of its distribution (Table
1 and Fig. 1). Leaves were collected and stored in labelled plastic bags at – 20 ºC until DNA
extraction. Voucher specimens from most of the collected populations were deposited in the
Herbarium of the Departamento de Botânica da Universidade Federal de Minas Gerais
(BHCB).
Total DNA was extracted by the protocol originally described by Doyle and Doyle
(1987) with the modifications suggested by Ferreira and Grattapaglia (1995). Quantity and
quality of DNA were assessed by visualization on a 0.8 % agarose gel.
Plastid DNA sequencing
To screen for variation in plastid DNA we investigated nine regions using the nine “universal”
primer combinations: trnK1/trnK2, trnH/trnK, psbC/trnS3 (Demesure et al., 1995); trnQ/trnS2
(Dumolin-Lapègue et al., 1997); ccmp4-L/atpH (Weising and Gardner, 1999); psbB/psbF,
rpl20/rps12 (Hamilton, 1999); and trnL-c/trnL-d, and trnL-e/trnF (Taberlet et al., 1991). Of
these trnH/trnK, psbC/trnS3, trnL-c/trnL-d and trnL-e/trnF produced clear single products, but
only the first two regions showed variation in the samples analyzed. Sequences for trnH/trnK
were of low quality. The psbC/trnS3 region was approximately 1,600 base pairs (bp) long
and was sequenced for all individuals of H. stigonocarpa.
Polymerase chain reactions (PCR) were carried out in 25 μl final volume, containing
10 ng template DNA; 1 x PCR buffer (IC - Phoneutria); 200 μM dNTPs; 0.5 μM each primer;
5 μg of bovine serum albumin (BSA); and 1 U Taq polymerase (Phoneutria). After
amplification, PCR products were visualized on 1% agarose gels stained with ethidium
bromide, and were purified using polyethylene glycol (PEG) 20% / 2.5 M NaCl precipitation.
To sequence the region, psbC (Demesure et al. 1995) and RCS 5’-
18
AAGATATGCCAGATTCCACC-3’ (designed using a sequence alignment for six species of
Fabaceae – H. courbaril, H. stigonocarpa, H. reticulata, H. aurea, Dalbergia nigra,
Plathymenia reticulata) primers were used.
Sequencing was conducted in 10 μl reactions with 3 μl of purified PCR product, 2 μl
of milliQ water, 1 μl of primer (5 μM) and 4 μl of ET-DYE Terminator Kit (Amersham
Biosciences). The thermocycling program was as follows: 35 cycles of 25 s at 95ºC, 15 s at
54ºC and 3 min at 60ºC. Sequencing products were precipitated and cleaned with
ammonium acetate and ethanol, and then dried at room temperature, dissolved in loading
buffer (formamide 70% and 1 mM EDTA) and run on a MegaBACE sequencer (80 s injection
time, 240 min run length).
Data analysis
Consensus sequences were assembled for each individual using at least two forward and
two reverse sequences made from independent PCR products, using the software Phred v.
0.20425 (Ewing and Green, 1998; Ewing et al., 1998), Phrap v. 0.990319
(http://www.phrap.org/) and Consed 12.0 (Gordon et al., 1998). Multiple sequence
alignments were made using Clustal X (Thompson et al., 1997) implemented in MEGA 3.0
(Kumar et al., 2004). Clustal alignments were also checked and edited by hand to minimize
software artefacts.
Molecular diversity indices (π, nucleotide diversity; h, haplotype diversity; k, mean
number of nucleotide substitutions) were calculated using MEGA 3.0 and DNAsp 3.99
(Rozas et al., 2003). The haplotypic richness was estimated by RAREFAC that uses the
technique of rarefaction for correct for sample size (Petit et al., 1998). Typically, rarefaction
is used to standardize allelic richness to the smallest N in a comparison (Petit et al., 1998).
However, the ITC population was not included in this analysis due to its small sample size (N
= 3) and a rarefaction size of N = 6 was used. Intraspecific relationships were inferred by the
construction of haplotype networks using the median-joining algorithm (MJ, Bandelt et al.,
1999) implemented in the NETWORK 4.1 (Forster et al., 2000) software. Hymenaea
reticulata Ducke and H. aurea Lee and Langenheim were designated as outgroups. To test
the influence of geography in population genetic structure, simple linear regressions were
made to correlate geographical distances with genetic distance index (FST values) using the
Barrier 2.2 software (Manni et al., 2004). Estimates of differentiation and F statistics were
calculated taking into account the pairwise distance between plastid DNA haplotypes. The
19
program SAMOVA (spatial analysis of molecular variation, Dupanloup et al., 2002) was used
in order to explore the population structure without a priori hypotheses of the expected
structure. This method uses a simulated annealing procedure to define K groups of
populations that are geographically homogenous and maximally differentiated from each
other. The method requires the a priori definition of the number of groups (K) of populations
that exist, and generates F statistics (FSC, FST and FCT) using an AMOVA approach (Excoffier
et al. 1992). By exploring the behaviour of the indices FCT and FSC for different values of K, it
is possible (Dupanloup et al. 2002) to identify the optimum number of population groups for a
set of sample populations. We used 100 simulated annealing processes for each value of K
from K = 2 to K = 8. Pairwise comparisons of FST between populations were analysed using
an AMOVA implemented in the ARLEQUIN software ver. 3.01 (Excoffier et al., 2005).
RESULTS
Genetic diversity
The amplification of the non-coding plastid DNA region psbC/trnS3 produced a fragment of
~1600 bp, of which 524 bp were sequenced for all individuals. The aligned psbC/trnS3 region
included four indels at positions 14, 30, 402 and 509 (Table 2). There were 507 conserved
positions and 13 variable (excluding the four indels) sites (total number of mutations: 15), 11
potentially parsimony informative sites with two variants and two with three variants each
(Table 2). This region had a high AT content (57.8%), with the presence of several
mononucleotide repeats.
Twenty three haplotypes were found (Fig. 2) defined by the 13 sites and four indels.
Total haplotype diversity (h), nucleotide diversity (π) and the mean number of nucleotide
differences (k) were 0.804, 0.003 and 1.598, respectively. Haplotype diversity for each
population (h) ranged from 0 to 0.771, haplotypic richness (A) from 0 to 2.766, nucleotide
diversity from 0 to 0.00267 and the mean number of nucleotide differences from 0 to 1.393
(Table 1).
The two most diverse populations in terms of haplotype number were MUC and MCC
with six haplotypes (Fig.1 and Table 2). Populations FUC and RPC each only had three
haplotypes, although found in similar frequencies, resulting in h values close to MUC and
MCC (Table 1). The populations MUC, MCC, RPC and FUC also exhibited the highest
indices of haplotypic richness after rarefaction to correct for sample size. Populations SMC
ADC, and DIC only had one haplotype each (diversity indices = 0) (Fig. 1 and Table 2).
20
Phylogeographic structure
The relationships among the 23 observed haplotypes and outgroups H. aurea (HA) and H.
reticulata (HR) are shown in the network in Fig. 2, analyzed using the median-joining
method. The most frequent haplotypes were H1, H2 and H8, occurring in 28, 33 and 11% of
sampled individuals, respectively. Haplotypes H2 and H8 were linked to H1 by a single
nucleotide substitution at positions 77 and 516, respectively (Fig. 2). Most haplotypes (17)
were only found in one population (Table 2). Haplotypes H16, H17, H18 and H19 were only
found in MCC population, H9, H10, H11 and H13 in MUC and haplotypes H14 and H15 in
RPC (Table 2). Other exclusive haplotypes were found in populations ITC, FAC, JTC, TOC,
FBC, PEC, and CHC (Table 2).
The SAMOVA analyses clearly indicated that there were distinct groups of genetically
defined sampling areas. In analyses where K = 2, partitions of the sampling areas were
identified that suggested two groups (groups: FUC, ADC, DIC, FBC, PEC, CHC, MCC, RPC,
MUC vs. SMC, ITC, PIC, FAC, CVC, JTC, TOC, TUC; FCT = 0.476). In analyses where K = 3,
an additional partition was identified that subdivided the first group in two areas, with a FCT
value of 0.588. With K = 4 the FCT decreased to 0. 473 and after K =5 to K = 8 the FCT values
became stable, ranging from 0.579 to 0.617. Thus, our analysis suggested the presence of
three FST geographical groups: a western group comprising the SMC, ITC, PIC, FAC, CVC,
JTC, TOC and TUC, a central group comprising FUC, ADC, DIC, FBC, CHC and PEC and
an eastern group comprising MCC, RPC and MUC. The SAMOVA performed with eastern,
central and western clusters resulted in an FST value of 0.692, indicating that 69.2% of the
variation was due to differences among the populations, and a FSC of 0.252, indicating that
25.2% of the genetic variation was due to differences among populations within of these
groups (Table 3). The analysis using the pairwise FST distances in the Barrier 2.2 software
(Manni et al. 2004) corroborated the SAMOVA analysis, showing the existence of three main
geographical population clusters. The FST values calculated for each pair of populations
ranged from 0 to 1.00 and most values observed were significant (P < 0.05) (Table 4). The
majority of non-significant pairwise FST values were observed among population pairs within
groups (Table 4). The mean of FST within groups (0.258) was much lower than the mean of
FST among groups (0.701), agreeing with the division into three groups.
Haplotypes HA and HR (found only in the outgroups) were closest to H2, the most
frequent haplotype in the western group (Fig. 2). Eastern populations were more diverse, as
indicated by haplotype and nucleotide diversity indices (Table 1), followed by populations
from the western and central groups. The central group includes two monomorphic
populations that present only the H1 haplotype, whereas all populations in the western group
21
exhibited two haplotypes each (except SMC that was monomorphic). Most of the sampled
individuals from the central and western groups presented the haplotype H1 (71.4%) and H2
(76.1%) respectively, evidencing a low degree of variation in these populations. In the
eastern group, all of the haplotypes were directly linked to the H8 haplotype, while all of the
central and western haplotypes were linked to the H1 and H2 haplotypes, respectively (Fig.
2).
DISCUSSION
The psbC-trnS region (Demesure et al., 1995) has been used in PCR-RFLP studies (Caron
et al., 2000; Dutech et al., 2000; Heuertz et al., 2004); in the present study, using sequences
of this region, H. stigonocarpa populations exhibited similar levels of genetic divergence (FST
= 0.692) when compared with the values observed for other species of angiosperms with
plastid DNA (median value of GST = 0.646, Petit et al., 2005). The plastid DNA sequences
showed a subdivision of the geographic distribution of the H. stigonocarpa populations into
three genetically differentiated groups (eastern, central and western), which exhibited high
frequencies of haplotypes H8, H1 and H2, respectively. The high genetic differentiation
between groups (FCT = 0.588) was concordant with the analysis with the Barrier software,
which suggests the existence of barriers to gene flow. According to coalescence theory, H1
might be the more ancestral haplotype, since it is found in the more central position in the
network (Posada and Crandall, 2001). Furthermore, H1 gave rise to H2 and H8 haplotypes
that were found in populations that experienced demographic expansions in the eastern and
western groups, as suggested by the star-shaped network around them. However, the H2
haplotype also could be considered an old haplotype since it is found in high frequency in
western populations and shows a relationships with the outgroups (H. reticulata and H.
aurea), although only one sample of each of these species had been analysed.
In the last taxonomic review of Hymenaea genus, Lee and Langenheim (1975)
described three varieties of H. stigonocarpa: var. stigonocarpa, var. pubescens and var.
brevipetiolata. According to these authors, var. stigonocarpa shares its wide range of
distribution with var. pubescens and the var. brevipetiolata, although collected only in west of
Minas Gerais and Mato Grosso, could have a wider distribution area in cerrado. Due to the
similarity in the geographic distribution of these varieties, the three genetic geographical
groups found in the present study could not be explained by the occurrence of different sub-
specific taxa.
22
The subdivision of the range of H. stigonocarpa populations into three genetically
differentiated areas can be associated with climatic and vegetation changes within the
region. After reviewing palynological records of tropical South America in the Late
Quaternary, Behling and Hooghiemstra (2001) suggested temporal and spatial changes in
the distribution of savanna vegetation. During the last glacial period, savannas, both north
and south of the equator, expanded, reflecting markedly drier conditions (Behling, 2002).
Other records indicated that the southern portion of the present-day cerrado region might
have been reduced in area due to strong cold fronts, which moved across the Brazilian
highlands far to the north during glacial times (Behling and Hooghiemstra, 2001). In the
period approx. 48000 to approx. 18000 radiocarbon years before present (YBP), the
landscape of Catas Altas (20º05'S, 43º22'W) was characterized by subtropical grasslands
with small areas of subtropical gallery forests containing Araucaria (Behling and Lichte,
1997). Increase in rainfall and greatly reduced annual average temperatures in this region
favoured the expansion of Araucaria forests, vegetation typical of southern Brazil today, in
areas presently covered by cerrado vegetation. Subtropical grassland vegetation expanded,
replacing the cerrado regions far to the north in the highlands of southeastern Brazil, from
present-day latitudes of about 28-27°S to about 20°S (Catas Altas). This also suggested that
the temperature in the last glacial maximum was 5-7°C lower than observed today (Behling,
1998). The expansion of the subtropical grassland into the cerrado region may have reduced
typical cerrado vegetation, thus isolating populations and decreasing the gene flow. This
would explain lower haplotype and nucleotide diversity values observed in the populations
from the Western and Central groups.
During glacial times, maritime influences could have determined different climates
between central and eastern Brazil. Several lines of evidence show that the arid climate was
more extreme in the central Brazil region. The milder climate towards the Atlantic Ocean and
the lower latitude allowed cerrado vegetation to spread eastwards to the coast (Behling and
Hooghiemstra, 2001). In addition, the pollen records from the period 10990–10540 YBP of
sand dunes in the middle São Francisco River region (10º24'S, 43º13'W, in northeastern
Brazil) show the presence of taxa that are today found in the Amazon and Atlantic rain
forests, including species found in mountain regions, thus suggesting humid climatic
conditions (De Oliveira et al., 1999). These facts could be a possible cause for the greater
diversity found in the Eastern populations (RPC, MCC and MUC). In these areas, the
relatively higher temperatures and humidity (compared with the central and south areas of
cerrado) could have resulted in the maintenance of larger populations, retaining the genetic
diversity. However, in the eastern group most of the haplotypes are private to one population,
suggesting low gene flow. In this region only three populations were analysed, which are
23
geographically distant. Thus, for a more conclusive interpretation of the evolutionary history
of this species in the eastern region, it would be necessary to analyse more populations.
The present-day distribution of H. stigonocarpa reaches São Paulo State at its
southern limit. Considering that the temperature in the last glacial maximum in southeastern
and central Brazil was 5-7 ºC lower that it is today (Behling, 1998), the occurrence of this
species may have been restricted to regions with a mild climate, closer to the coast or at
lower latitudes. In the glacial period the temperature in the mid-western and southeastern
Brazil region was similar to present day temperatures in the States of southern Brazil, where
the H. stigonocarpa species do not occur. Silberbauer-Gottsberger et al. (1977) showed a
clear relationship between the degree of frost damage of species from cerrado and their
geographical distribution. These authors concluded that frost seems to be one of the
selective factors influencing the floristic composition of the Cerrado at its southern limit. Due
to the colder climatic conditions during the glacial time, the frost-sensitive cerrado vegetation
must have also remained in the northern part of southeastern Brazil, where frosts were rare
or absent (Behling, 1998). After savanna vegetation and climatic conditions have been re-
established (5000-4000 YBP, Behling and Hooghiemstra, 2001), the species returned to the
southern part of the present-day cerrado distribution. The southward re-colonization could
explain the presence of the haplotypes H1, H2 and H8 in the FUC population, suggesting
that this population may have originated from different lineages from eastern, central and
western groups. Similar data have been observed in a Brazilian cerrado tree species,
Caryocar brasiliense (Collevatti et al., 2003). The phylogeographic study of that species
suggested that the population from western São Paulo State, the southwestern limit of the
cerrado geographical distribution, originated from multiple lineages of populations from Goiás
(GO) and Mato Grosso (MT).
We suggest that a large polymorphic population of H. stigonocarpa covered most of
the studied region, and that during the glacial periods it was reduced to small isolated
populations, mainly in the central and western sites. The reduction of population size
(bottleneck) would cause a depletion of genetic diversity due to genetic drift, which is more
pronounced with cpDNA markers, since its effective size is equal to one-half that of nuclear
markers (Birky et al., 1983). The restricted distribution of haplotypes was maintained through
limited seed dispersal during the expansion of the species. According Avise (2000), a
starburst phylogeographic pattern, as observed in this study, particularly considering the
separate geographic groups (Fig. 2), is an expected signature for a species that has
expanded its population and geographic range from a small number of founders. The parallel
radiation from north to south with the maintenance of three distinct longitudinal haplotype
24
groups could also have some relation with geographic barriers that run in a north-south
direction similarly to the observed haplotype groups. The Espinhaço mountain range may
have contributed to the isolation of the eastern from the central groups, and similarly the
Espigão Mestre between the central and western groups. Another important event, the
extinction of megafauna in the Quaternary (approx. 10000 years ago), could have influenced
the genetic structure found in H. stigonocarpa, as also suggested for Caryocar brasiliense
populations (Collevatti et al., 2003). Current dispersion of Hymenaea courbaril seeds is
carried mainly by agoutis (Asquith et al. 1999), but Hallwachs (1986) suggested that this role
was “inherited” from large Pleistocene mammals. It is known that seed dispersal by large
mammals was more effective, since they probably had greater dispersion capacities. It is
possible that, due to the great similarity between the fruits and seeds of H. courbaril and H.
stigonocarpa, seed dispersal in these two species may have been made by the same agents.
With the megafauna extinction, dispersion of seeds and gene flow could have been reduced,
thus favouring the relative isolation and further differentiation between populations. However,
it must be considered that human migration could have led to seed dispersion of H.
stigonocarpa. This could explain some of our results, e.g., the CHC population that exhibited
a haplotype typical of the central group but is geographically nearer to the eastern group.
This study provides information about the natural history of H. stigonocarpa and infers
that climatic changes during the Quaternary helped shape the distribution and genetic
structure of the species. Accompanied by palynological records, the phylogeographic data
suggest that during glacial times the low temperatures resulted in extinction of H.
stigonocarpa populations in most parts of the southern present-day cerrado area. Milder
climatic conditions in the north and eastern portions of the cerrado resulted in the
maintenance of populations. Following the postglacial climate amelioration, most parts of the
present-day southern cerrado was re-colonized from three different lineages from the
northern parts of this biome. Phylogeographic studies using plastid DNA data of species
occurring in the Brazilian cerrado are still very scarce. It is apparent that more
phylogeographic studies with other species from the cerrado are needed to obtain a better
understanding of the influence of Quaternary climatic changes on the evolutionary history of
the flora of this biome.
25
LITERATURE CITED
Asquith NM, Terborgh J, Arnold AE and Riveros CM. 1999. The fruits the agouti ate:
Hymenaea courbaril seed fate when its disperser is absent. Journal of Tropical Ecology
15: 9-235.
Avise JC. 1994. Molecular Markers. Natural History and Evolution. Chapman and Hall, New
York.
Avise JC. 2000. Phylogeography: the history and formation of species. Harvard: Harvard
University Press.
Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC. 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between
population genetics and systematics. Annual Review of Ecology and Systematics 18: 489-
522.
Bandelt H-J, Forster P and Röhl A. 1999. Median-joining networks for inferring intraspecific
phylogenies. Molecular Biology and Evolution 16: 37-48.
Behling H. 1998. Late quaternary vegetational and climatic changes in Brazil. Review of
Paleobotany and Palynology 99: 143-156.
Behling H. 2002. South and southeast Brazilian grasslands during Late Quaternary times: a
synthesis. Palaeogeography, Palaeoclimatology, Palaeoecology 177: 19-27.
Behling H, Lichte M. 1997. Evidence of dry and cold climatic conditions at glacial times in
tropical southeastern Brazil. Quaternary Research 48: 348-358.
Behling H, Hooghiemstra H. 2001. Neotropical Savanna Environments in Space and Time:
Late Quaternary Interhemispheric Comparison. In:.Markraf V, ed. Interhemispheric
Climate Linkages.. New York: Academic Press, 307-323.
Belahbib N, Pemonge MH, Ouassou, Sbay, H. et al. 2001. Frequent cytoplasmic
exchanges between oak species that are not closely related: Quercus suber and Q. ilex in
Morocco. Molecular Ecology 10: 2003-2012.
Birky CW, Maruyama T, Fuerst P. 1983. An approach to population and evolutionary
genetic theory for genes in mitochondria and chloroplasts, and some results. Genetics
103: 513-527.
26
Bucci SJ, Goldstein G, Meinzer FC, Campanello P, Scholz FG. 2005. Mechanisms
contributing to seasonal homeostasis of minimum leaf water potential and predawn
disequilibrium between soil and plant water potential in Neotropical savanna trees. Trees
19: 296–304.
Caron H, Dumas S, Marque G, Messier C, Beou E, Petit RJ, Kremer A. 2000. Spatial and
temporal distribution of chloroplast DNA polymorphism in a tropical tree species.
Molecular Ecology 9: 1089-1098.
Cavers S, Navarro C, Lowe AJ. 2003. Chloroplast DNA phylogeography reveals
colonization history of neotropical tree, Cedrela odorata L., in Mesoamerica. Molecular
Ecology 12: 1451-1460.
Clark CM, Wentworth TR, O’Malley DM. 2000. Genetic discontinuity revealed by
chloroplast microsatellites in eastern North American Abies (Pinaceae). American Journal
of Botany 87: 774-782.
Collevatti RG, Grattapaglia D, Hay JD. 2003. Evidences for multiple maternal lineages of
Caryocar brasiliense populations in the Brazilian cerrado based on the analysis of
chloroplast DNA sequences and microsatellite haplotype variation. Molecular Ecology 12:
105-115.
Crestana CSM, Dias IS, Mariano G. 1985. Ecologia de polinização de Hymenaea
stilbocarpa Hayne, o Jatobá. Silvicultura em São Paulo 17/19: 31-37.
De Oliveira PE, Barreto AMF, Suguio K. 1999. Late Pleistocene/Holocene climatic and
vegetational history of the Brazilian caatinga: the fossil dunes of the middle São Francisco
River. Palaeogeography, Palaeoclimatology, Palaeoecology 152: 319–337
Demesure B, Sodzi N, Petit RJ. 1995. A set of universal primers for amplification of
polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular
Ecology 4: 129-131.
Doyle JJ, Doyle JL. 1987. Isolation of plant DNA from fresh tissue. Focus 12: 13-15.
Dumolin-Lapègue S, Demesure B, Fineschi S, Le Corre V, Petit RJ. 1997. Phylogeographic structure of white oaks throughout the European Continent. Genetics
146: 1475-1487.
27
Dupanloup I, Schneider S, Excoffier, L. 2002. A simulated annealing approach to define
the genetic structure of populations. Molecular Ecology 11: 2571-81.
Dutech C, Maggia L, Joly HI. 2000. Chloroplast diversity in Vouacapoua americana
(Caesalpiniaceae), a neotropical forest tree. Molecular Ecology 9: 1427-1432.
Eiten G. 1972. The cerrado vegetation of central Brazil. Botanical Review 38: 201-341
El Mousadik A, Petit RJ. 1996. Chloroplast DNA Phylogeography of the argan tree of
Morocco. Molecular Ecology 5: 547-555.
Ennos RA. 1994. Estimating the relative rates of pollen and seed migration among plant
populations. Heredity 72: 250-259.
Ewing B, Green P. 1998. Basecalling of automated sequencer traces using Phred II: error
probabilities. Genome Research 8: 186-194.
Ewing B, Hillier L, Wendi M, Green P. 1998. Basecalling of automated sequencer traces
using Phred I: accuracy assessment. Genome Research 8: 175-185.
Excoffier LP, Smouse E, Quattro JM. 1992. Analysis of molecular variance inferred from
metric distances among haplotypes: application to human mitochondrial DNA restriction
data. Genetics 131: 479-491.
Excoffier L, Laval G, Schneider S. 2005. Arlequin ver. 3.0: an integrated software package
for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47-50.
Ferreira ME, Grattapaglia D. 1995. Introdução ao uso de marcadores moleculares em
análise genética. Brasília, EMBRAPA/CENARGEN.
Ferris C, Oliver RP, Davy AJ, Hewitt GM. 1993. Native oak chloroplasts reveal an ancient
divide across Europe. Molecular Ecology 2: 337-344
Forster P, Bandelt HJ, Rohl A et al. 2000. NETWORK 3.1.1.0. Software free available at:
www.fluxus-engineering.com. Fluxus Technology Ltd., Cambridge.
Gibbs PE, Oliveira PE, Bianchi MB. 1999. Postzygotic Control of Selfing in Hymenaea
stigonocarpa (Leguminosae-Caesalpinioideae), a Bat-Pollinated Tree of the Brazilian
Cerrados. International Journal of Plant Sciences 160: 1-7.
Gordon D, Abajian C, Green P. 1998. Consed: a graphical tool for sequence finishing.
Genome Research 8: 195-202.
28
Gugerli F, Senn J, Anzidei M et al. 2001. Chloroplast microsatellites and mitochondrial
nad1 intron 2 sequences indicate congruent phylogenetic relationships among Swiss
stone pine (Pinus cembra), Siberian stone pine (Pinus sibirica), and Siberian dwarf pine
(Pinus pumila). Molecular Ecology 10: 1489-1497.
Hallwachs W. 1986. Agouti (Dasyprocta punctata): the inheritors of guapinol (Hymenaea
coubaril: Leguminosae). In: Estrada A and Fleming TH (eds). Frugivores and seed
dispersal. W. Junk Publishers, Dordrecht, Netherlands 285-304.
Hamilton MB. 1999. Four primer pairs for the amplification of chloroplast intergenic regions
with intraspecific variation. Molecular Ecology 8: 521-523.
Heuertz M, Fineschi S, Anzidei M, Pastorelli R, Salvini D, Paule L et al. 2004. Chloroplast
DNA variation and postglacial recolonization of common ash (Fraxinus excelsior L.) in
Europe. Molecular Ecology 13: 3437-3452
Hopper SD, Gioia P. 2004. The Southwest Australian floristic region: evolution and
conservation of a global hot spot of biodiversity. Annual Review of Ecology, Evolution and
Systematics 35: 623–50.
Kumar S, Tamura K, Nei M. 2004. MEGA3: Integrated software for molecular evolutionary
genetics analysis and sequence alignment. Briefings in Bioinformatics 5: 150-163.
Lee, Y-T, Langenheim JH. 1975. Systematics of the genus Hymenaea L. (Leguminosae,
Caesalpinioidae, Detarieae). University of California Publications in Botany 69: 1-109.
Lorenz-Lemke AP, Muschner VC, Bonatto SL, Cervi AC et al. 2005. Phylogeographic
inferences concerning evolution of Brazilian Passiflora actinia and P. elegans
(Passifloraceae) based on ITS (nrDNA) variation. Annals of Botany 95: 799-806.
Magni CR, Ducousso A, Caron H, Petit RJ, Kremer A. 2005. Chloroplast DNA variation of
Quercus rubra L. in North America and comparison with other Fagaceae. Molecular
Ecology 14: 513-524.
Manni F, Guerard E, Heyer E. 2004. Geographic patterns of (genetic, morphologic,
linguistic) variation: how barriers can be detected by using Monmonier’s algorithm. Human
Biology 76: 173-190.
Myers N, Mittermeier RA, Mittermeier CG, Fonseca GAB, Kent J. 2000. Biodiversity
hotspots for conservation priorites. Nature 403: 853-858.
29
Petit RJ, Latouche-Halle C, Wagner DB. 1993. Geographic structure of chloroplast DNA
polymorphisms in European oaks. Theoretical and Applied Genetics 87: 122-128.
Petit RJ, El Mousadik A, Pons O. 1998 Identifying populations for conservation on the
basis of genetic markers. Conservation Biology 12: 844-855.
Petit RJ, Aguinagalde I, de Beaulieu J-L, Bittkau C, Brewer S, Cheddadi R et al. 2003. Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300: 1563-
1565.
Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG. 2005. Comparative
organization of chloroplast, mitochondrial and nuclear diversity in plant populations.
Molecular Ecology 14: 689-701.
Posada D, Crandall, KA. 2001. Intraspecific gene genealogies: trees grafting into
networks. Trends in Ecology and Evolution 16: 37-45.
Ratter JA, Bridgewater S, Ribeiro JF. 2006. Biodiversity patterns of the woody vegetation
of the Brazilian cerrado. In: Pennington RT, Lewis GP, Ratter JA, eds. Neotropical
savannas and seasonally dry forests: plant diversity, biogeography and conservation.
Florida: CRC Press, 31-66.
Richardson JE, Pennington RT, Pennington TD, Hollingsworth PM. 2001. Rapid
diversification of a species-rich genus of neotropical rain forest trees. Science 293: 2242-
2245.
Rizzini CT. 1971. Árvores e madeiras úteis do Brasil; Manual de dendrologia brasileira.
Edgard Blucher, São Paulo.
Rozas J, Sánches-Delbarrio JC, Messeguer X, Rozas R. 2003. DnaSP, DNA
polymorphism analysis by the coalescent and other methods. Bioinformatics 19: 2496-
2497.
Salgueiro F, Felix D, Caldas JF, Margis-Pinheiro M, Margis R. 2004. Even population
differentiation for maternal and biparental gene markers in Eugenia uniflora, a widely
distributed species from the Brazilian coastal Atlantic rain forest. Diversity Distribution 10:
201–210.
Schaal BA, Hayworth DA, Olsen KM, Rauscher JT, Smith WA. 1998. Phylogeographic
studies in plants: problems and prospects. Molecular Ecology 7: 465-474.
30
Schierenbeck KA, Symonds VV, Gallagher KG, Bell J. 2005. Genetic variation and
phylogeographic analyses of two species of Carpobrotus and their hybrids in California.
Molecular Ecology 14: 539-547.
Silberbauer-Gottsberger I, Morawetz W, Gottsberger G. 1977. Frost damage of cerrado
plants in Botucatu. Biotropica 9: 253-261.
Silva MR, Silva MS, Martins KA, Borges, S. 2001. Studies on the use of jatoba flour in
biscuits as a source of dietary fibre containing no added simple sugars. Ciência e
Tecnologia de Alimentos 21: 176-82.
Taberlet P, Gielly L, Pautou G, Bouvet J. 1991. Universal primers for amplification of three
non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1105-1109.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL
X windows interface: flexible strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Research 24: 4876-4887.
Weising K, Gardner RC. 1999. A set of conserved PCR primers for the analysis of simple
sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms.
Genome 42: 9-19.
Zhang Q, Chiang TY, George M, Liu JQ, Abbott RJ. 2005. Phylogeography of the Qinghai-
Tibetan Plateau endemic Juniperus przewalskii (Cupressaceae) inferred from chloroplast
DNA sequence variation. Molecular Ecology 14: 3513-3524.
ACKNOWLEDGEMENTS
This study was supported by the Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq/Brazil). We also thank the Instituto Brasileiro de Meio Ambiente for
providing facilities, Reinaldo M. Silva, Renan Milagres, Luciana C. Resende and Juliano Leal
for technical assistance in this study, Rodrigo Redondo and Leandro M. Freitas for
computational analyses assistance, Rosangela L. Brandão, Alba L. Fonseca and Elder A.
Paiva for their help in sample collection. A. C. S. Ramos received a PhD fellowship from the
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES/Brazil). J. Lemos-
Filho and F.R. Santos received research fellowships from CNPq/Brazil.
31
FIGURE LEGENDS
FIG. 1 Map of Brazil and distribution of cerrado vegetation in grey (a). Approximate
geographic location and plastid DNA haplotype frequencies of studied populations of H.
stigonocarpa. Circle size is proportional to sample size and colours represent the different
haplotypes as shown in the key (b).
FIG. 2 MJ network analysis of the relationships between haplotypes of the “CS” (524 pb)
plastid DNA region from 175 H. stigonocarpa individuals and two outgroups (HA and HR).
Circle area is proportional to haplotype frequency and colours are as Fig.1. Lines drawn
between haplotypes represent mutation events identified by the numbers corresponding to
the positions at which the mutations were observed. Black points represent hypothetical
haplotypes (median vector).
32
FIG. 1
33
FIG. 2
34
Populations / State Abbr. Latitude / Longitude Altitude (m) n nh A k h πSão Manuel / SP SMC 22º43'18"S / 48º25'49"W 530 6 1 0.000 0 0 0Itu / SP ITC 23º23'44"S / 47º20'00"W 634 3 2 0.667 0.667 0.00127Pirenópolis / GO PIC 15º30'58"S / 49º08'11"W 730 11 2 0.818 0.327 0.327 0.00063Faina / GO FAC 15º32'53"S / 50º17'45"W 400 9 2 0.988 0.500 0.500 0.00096Chapada dos Veadeiros / GO CVC 14º10'39"S / 47º49'04"W 800 15 2 0.400 0.133 0.133 0.00026Tamanduá / DF JTC 15º45'23"S / 47º49'36"W 1000 6 2 1.000 0.533 0.533 0.00102Palmas / TO TOC 10º12'47"S / 48º21'38"W 270 7 2 1.000 0.571 0.571 0.00109Tupaciguara / MG TUC 18º31'32"S / 48º59'29"W 650 10 2 0.600 0.200 0.200 0.00058Furnas / MG FUC 20º51'49"S / 46º23'16"W 880 16 3 1.858 0.958 0.708 0.00115Abadia dos Dourados / MG ADC 18º29'03"S / 47º22'35"W 800 9 1 0.000 0 0 0Dores do Indaia/MG DIC 19º26'48"S / 45º35'35"W 730 7 1 0.000 0 0 0Fazenda Brejão / MG FBC 17º00'00"S / 45º54'00"W 550 10 2 0.967 0.467 0.467 0.00089Vale do Peruaçu National Park / MG PEC 15º07'20"S / 44º14'53"W 700 14 2 0.692 0.264 0.264 0.00051Cachoeira do Pajeú / MG CHC 15°58'00"S / 41°30'00"W 750 10 2 0.600 0.400 0.200 0.00077Montes Claros / MG MCC 16º18'41"S / 42º53'26"W 800 15 6 2.766 1.391 0.771 0.00267Rio Preto State Park / MG RPC 18º00'00"S / 43º23'00"W 900 8 3 1.750 1.393 0.679 0.00267Chapada da Diamantina / BA MUC 13º00'00"S / 41º29'24"W 1080 19 6 2.644 1.392 0.754 0.00267
nh = number of haplotypesA = haplotypic richness
π = nucleotide diversity
n = sample size
k = average number of nucleotide differencesh = haplotype diversity
TABLE 1 Geographical location of Hymenaea stigonocarpa populations ,altitude, number of individuals sampled per population, number of
haplotypes per population and diversity indices based on the psbC/trnS3 region of plastid DNA
35
0 0 0 1 1 2 3 3 3 3 4 4 4 4 4 5 51 3 7 8 9 5 2 3 7 8 0 4 5 6 8 0 1
Haplotype 4 0 7 8 1 7 9 4 1 8 2 2 7 2 5 9 6 SMC ITC PIC FAC CVC JTC TOC TUC FUC ADC DIC FBC PEC CHC MCC RPC MUC FrequencyH1 - A T T G T A T T C - A C C G T G 5 9 7 7 12 9 49H2 - . C . . . . . . . - . . . . . . 6 9 6 14 4 3 9 6 57H3 - . C . . . . . . . A . . . . . . 2 1 3H4 - . C . . . . . . . A . G . . . . 1 1H5 - . C . . . . . . . - T . . . . . 4 4H6 - . . A . . . . . . - . . . . . . 3 3H7 - . . . . . . G . . - . . . . . . 2 2H8 - . . . . . . . . . - . . . . . A 5 1 3 9 18H9 - - . . . . . . . . - . . . C . A 2 2H10 - . . . . A . . . . - . . . . . A 2 2H11 - - . . . A . . . . - . . . . . A 2 2H12 - . . . . . . . . . - . . A . - A 2 1 3H13 - . . . . . . . . . - C . . . . A 3 3H14 - . . . . . G . A . - . . . . . A 4 4H15 - . . . . . . . . . - . . . C . A 1 1H16 - . . . . . . . . G - . . . . . A 2 2H17 - . . . . . . . A . - . . . . . A 2 2H18 - . . . . . . . . . - . G . . . A 1 1H19 - . . . . . . . . . - . . . . - A 7 7H20 - . . . . . G . . . - C . . . . . 1 1H21 T . C . . . . . . . - . . . . . . 2 1 3H22 - . C . A . . . . . - . . . . . . 3 3H23 - . C . . . C . . . - . . . . . . 2 2Total 175
Polymorphic sites
TABLE 2 Distribution and frequency of plastid DNA haplotypes based in psbC/trnS3 region in each population of Hymenaea stigonocarpa.
36
Source of variation d.f. Sum of squares
Variance components
Percentage of variation
Fixation Indices
Among groups 2 71.17 0.594 Va* 58.84 FCT : 0.588Among populations within groups 14 18.76 0.104 Vb* 10.36 FST : 0.692
Within populations 158 49.12 0.311 Vc* 30.81 FSC : 0.252Total 174 139.05 1.009* P < 0,01
TABLE 3. Analysis of molecular variance based on the psbC/trnS3 region of plastid DNA for 17 populations of Hymenaea stigonocarpa.
37
SMC ITC PIC FAC CVC JTC TOC TUC FUC ADC DIC FBC PEC CHC MCC RPC MUCITC 0.848 0.000PIC 0.022 0.735 0.000FAC 0.182 0.674 0.204 0.000CVC -0.077 0.843 -0.269 0.256 0.000JTC 0.200 0.654 0.000 0.227 0.269 0.000TOC 0.472 0.685 0.426 0.411 0.534 0.388 0.000TUC -0.059 0.751 0.062 0.200 0.007 0.198 0.458 0.000FUC 0.361 0.605 0.398 0.399 0.449 0.371 0.462 0.397 0.000ADC 1.000 0.940 0.848 0.812 0.922 0.841 0.841 0.904 0.227 0.000DIC 1.000 0.925 0.831 0.790 0.914 0.816 0.818 0.892 0.197 0.000 0.000FBC 0.778 0.806 0.734 0.704 0.803 0.698 0.727 0.762 0.255 0.205 0.167 0.000PEC 0.840 0.867 0.779 0.756 0.838 0.763 0.784 0.809 0.254 0.033 0.006 0.189 0.000CHC 0.793 0.819 0.738 0.708 0.809 0.700 0.724 0.769 0.209 -0.112 -0.040 0.134 0.039 0.000MCC 0.692 0.713 0.715 0.695 0.757 0.673 0.696 0.718 0.450 0.602 0.575 0.580 0.619 0.574 0.000RPC 0.747 0.731 0.763 0.733 0.817 0.691 0.727 0.772 0.483 0.689 0.654 0.634 0.691 0.617 0.324 0.000MUC 0.649 0.694 0.674 0.658 0.712 0.636 0.655 0.675 0.361 0.522 0.496 0.512 0.543 0.494 0.218 0.263 0.000
Western group Central group Eastern group
TABLE 4. Pairwise comparisons of FST between populations of Hymenaea stigonocarpa based on the psbC/trnS3 region of plastid DNA.
Values given in bold are not significant at P>0.05.
38
CAPÍTULO II
Similar phylogeographical structure of two vicariant neotropical tree species (Hymenaea) from savanna and forest that share common life history traits
Ana Carolina Simões Ramos1, José Pires de Lemos-Filho2, Renata Acácio Ribeiro1, and
Maria Bernadete Lovato1
1Departamento de Biologia Geral and 2Departamento de Botânica, Instituto de Ciências
Biológicas, Universidade Federal de Minas Gerais, CP: 486, Belo Horizonte, MG, 31270-
901, Brazil.
Correspondence: Maria Bernadete Lovato, Tel: +553134992571; Fax: +553134992570; E-
mail: [email protected]
39
Summary
• The phylogeographic structure in two congeneric tree species from different habitats in
Brazil was investigated, Hymenaea courbaril from the Atlantic forest and riverine forest,
and H. stigonocarpa from the savanna (Cerrado).
• The psbC/trnS3 region of chloroplast DNA (cpDNA) was sequenced in 149 individuals
from 15 populations of H. courbaril and the diversity and geographic distribution of
haplotypes were compared to existing cpDNA data from H. stigonocarpa.
• Eighteen haplotypes of H. courbaril were identified. Three of which were shared with H.
stigonocarpa. AMOVA indicated that between-species differences were responsible for
only 10.5% of the genetic variation. Phylogeographic analysis showed that H. courbaril
populations can be structured into three geographic groups, although these are less
spatially distinct than in H. stigonocarpa.
• The similar phylogeographic structure of these two Hymenaea species suggests that they
suffered the same impacts of the Quaternary climatic changes. We surmise that during
the last glacial maximum H. courbaril populations must have only remained in northern
and eastern regions. After the reestablishment of climate conditions, the southern parts of
the region were recolonised by lineages from northern and eastern populations.
Phylogeographical data support the hypothesis of ancient hybridisation between the two
Hymenaea species or the presence of ancestral polymorphism.
Key words: Atlantic forest, Cerrado, cpDNA, Hymenaea courbaril, Hymenaea
stigonocarpa, phylogeography, psbC/trnS sequence, Quaternary climatic changes.
40
Introduction
The Amazon and Atlantic forests are the major rain forests of South American and
encompass the most diverse tropical forests in the world. Between these two forests lies a
corridor of seasonal and open vegetation that includes the Cerrado in central Brazil, the
Caatinga in northeastern Brazil, and the Chaco in Argentina and Paraguay (Prado & Gibbs,
1993). The Cerrado is the second largest biome in Brazil extending over 2 million km2. It is
composed of a mosaic of subunits that vary from grasslands to dry forests, and is mostly
dominated by semi-deciduous arboreal savanna. Along the rivers that dissect this mosaic,
there are strips of mesic riverine forests. This forest provides an important connection
between the flora of Amazonia and the Atlantic Forest (Oliveira Filho & Ratter, 1995).
The Quaternary biogeographical history of south-east and central Brazil is complex
and poorly understood, due to existence of few palinological records for these regions. In
general, pollen data suggest that the last glacial period was cooler and drier than present-
day conditions, resulting in an extension of savanna vegetation and reduction in rain-forest
size (Behling, 2002). At the Last Glacial Maximum (LGM), around 27 500 to c. 14 500 14C
years ago, cold temperatures and hard frosts made the climate too severe to support
Cerrado vegetation or semi-deciduous forests in this region. At this time, large areas of
Atlantic semi-deciduous forest were replaced by subtropical grasslands, and Cerrado
vegetation was displaced further north (Behling & Lichte, 1997; Behling et al., 1998). During
the early Holocene, with climate amelioration, grasslands began to be replaced by different
forms of Cerrado vegetation and by semi-deciduous forests in regions with a short annual dry
season, and by rain forests in regions without significant dry periods. Forest expansion from
existing gallery forests, was recorded between 8800 and 7500 yr B.P. in Lago do Pires
(17°57`S, 42°13`W), and at approximately 5,500 yr B.P. the climate became more humid and
development towards modern forests and a more diverse Cerrado began (Behling, 1995).
Phylogeographic studies have suggested that past fragmentation of the Atlantic forest
(Cardoso et al., 2000; Lira et al., 2003; Salgueiro et al., 2004) and reduction of the southern
Cerrado (Collevatti et al., 2003; Ramos et al., 2007) have influenced the current genetic
structure of tree species that occur in this part of the Neotropics. All of these studies
analysed populations of species occurring just in one of these biomes. Here, we investigate
the phylogeographic structure of two congeneric trees from central and south-east Brazil,
Hymenaea courbaril from forest and H. stigonocarpa from savanna (Cerrado). Recent
studies have investigated the similarity and discrepancy in genetic diversity,
phylogeographical structuring, recolonization and dispersal patterns between closely related
species, as Quercus affinis and Q. laurina (González-Rodríguez et al. 2004), as Carpobrotus
41
chilensis and C. edulis (Schierenbeck et al. 2005), as Passiflora actinia and P. elegans
(Lorenz-Lemke et al. 2005), as Phlomis crinita and P. lychnitis (Albaladejo et al. 2005) and
as Machilus kusanoi and M. Thunbergii (Wu et al. 2006). Studies of the comparative
phylogeography of phylogenetically closely-related species showing particular ecological
attributes and sharing common life history traits can be useful to establish the effects of past
climatic changes across of these biomes.
The genus Hymenaea pertains to tribe Detarieae (family Leguminosae-
Caesalpinioideae), constituting a genus of tropical and subtropical resin-producing trees
reputed to be the main source of fossil amber in the Neotropics (Langenheim et al., 1973).
The genus includes 13 species that are distributed in Mesoamerica, the West Indies, and
most of South America, and one species in East Africa-Madagascar (Lee & Langenheim,
1975). H. courbaril, divided into six varieties, is distributed over a vast geographical area of
tropical America and the Antilles. H. courbaril var. stilbocarpa occurs in the Atlantic forest
and riverine forest of the Cerrado biome. In contrast, H. stigonocarpa is restricted to the
Brazilian Cerrado. H. stigonocarpa and H. courbaril var. stilbocarpa are considered vicariant
species (Heringer et al., 1976). Considering the geographic distribution and morphology (Lee
& Langenheim, 1975) of H. courbaril samples analysed in our study, they probably are H.
courbaril var. stilbocarpa.
Hymenaea trees are exploited for their good-quality timber, used for ship building,
furniture, etc (Lee & Langenheim, 1975). H. courbaril is also on the official list of Brazilian
endangered medicinal species (IBAMA, 1992). H. courbaril and H. stigonocarpa exhibit
similar life history traits, such as pollination biology, mating system, and seed dispersion.
They are predominantly outcrossers, mainly pollinated by bat species (Lee & Langenheim,
1975; Crestana et al., 1985; Gibbs et al., 1999, Dumphy et al., 2004). Seeds of H. courbaril
are today mainly dispersed by agoutis (Asquith et al., 1999) and this is probably also true for
those of H. stigonocarpa.
Analyses of chloroplast DNA (cpDNA) variation is a useful tool to reconstruct
historical events such as population expansions and contractions, migration and colonisation
(McCauley, 1995; Ennos et al., 1999), and can provide insight into ancient and contemporary
hybridisation (Rieseberg & Soltis, 1991; Rieseberg et al., 1996). In the present study, we
used cpDNA sequences from the psbC/trnS3 to analyse the phylogeographic structure of H.
courbaril. Data previously obtained from the same sequence in H. stigonocarpa (Ramos et
al., 2007) were used for comparative phylogeographic analysis. In particular, we test the
following hypotheses: 1) the genetic structure of H. courbaril should reflect the shift in
vegetation patterns across central and south-east Brazil brought about by climatic change
42
during the Quaternary; 2) since most of the geographical range of H. courbaril overlaps with
that of H. stigonocarpa, although in distinct habitats, forest and savanna, and that they have
similar life-history attributes, they could exhibit similar general phylogeographic patterns. This
prediction is based on paleopalinogical evidence suggesting that both forest and savanna of
the studied region were constricted and displaced during the Quaternary. Alternatively, if the
distinct habitats suffered differential impacts of the climatic changes, H.courbaril and H.
stigonocarpa could show significant differences in their phylogeographic structure.
Materials and Methods
Sampling populations and DNA extraction
Young leaves were collected from 149 adult individuals from 15 populations of H. courbaril,
ranging in distribution between 12°-23°S and 40°-54°W (Table 1 and Fig.1). Populations
were sampled in the States of Minas Gerais (MG) - PTM, CPM, FBM, FBMII, FUM, RPM and
MOM -, Espirito Santo (ES) - RLM and SEM -, São Paulo (SP) – SPM -, Goiás (GO) - ARM
and NIM -, Mato Grosso do Sul (MS) - MSM, Bahia (BA) – PAM - and in the Federal District
(DF) – PNM -. Leaves were collected and stored in labelled plastic bags at – 20 ºC until DNA
extraction. Populations of H. stigonocarpa used for comparative analyses were from the
same region as H. courbaril, ranging in distribution between 10°-23°S and 41°-50°W (Ramos
et al., 2007). In four of the sampled sites, populations of H. courbaril co-occur with those of
H. stigonocarpa.
Total DNA was extracted following the protocol of Doyle & Doyle (1987) using the
modifications suggested by Ferreira & Grattapaglia (1995). The protocol uses 2% of cationic
detergent CTAB (cationic hexadecyl trimetyl ammonium bromide), 100 mM Tris-HCl pH 8.0,
1.4 M NaCl, 20 mM EDTA (ethylenediaminetetraacetate), 1 % PVP (polyvinylpyrrolidone)
and 2 % β-mercaptoetanol. Quantity and quality of DNA were assessed by visualisation on a
0.8 % agarose gel.
Chloroplast DNA sequencing
Screening for variation in the cpDNA of H. courbaril used PCR amplification with the same
nine universal primers and results were similar to those found for H. stigonocarpa (Ramos et
43
al., 2007). Thus, the same sequence used in H. stigonocarpa, psbC/trnS3 (CS) (Demesure
et al., 1995), was amplified for all individuals of H. courbaril.
Polymerase chain reactions (PCR) were carried out on a 25-μl final volume,
containing 10 ng template DNA; 1 x PCR buffer (IC - Phoneutria); 200 μM dNTPs; 0.5 μM
each primer; 5 μg of bovine serum albumin (BSA); and 1 U Taq polymerase (Phoneutria).
After amplification, PCR products were visualised on 1% agarose gels stained with ethidium
bromide, and purified using polyethylene glycol (PEG) 20% / 2.5 M NaCl precipitation. To
sequence the CS region, psbC (Demesure et al., 1995) and RCS 5’-
AAGATATGCCAGATTCCACC-3’ (Ramos et al., 2007) primers were used.
The sequencing reaction was conducted in a 10-μl reaction containing 3 μl of purified
PCR product, 2 μl of milliQ water, 1 μl of primer (5 μM) and 4 μl of ET-DYE Terminator Kit
(Amersham Biosciences). The thermocycling program was as follows: 35 cycles of 25 s at
95ºC, 15 s at 54ºC and 3 min at 60ºC. Sequencing products were precipitated and cleaned
with ammonium acetate and ethanol, and then dried at room temperature, dissolved in
loading buffer (formamide 70% and 1 mM EDTA) and run on MegaBACE sequencer (80 s
injection time, 240 min run length).
Data analysis
Consensus sequences were assembled for each individual using at least two forward and
two reverse sequences made from independent PCR products, using the softwares Phred v.
0.20425 (Ewing & Green, 1998; Ewing et al., 1998), Phrap v. 0.990319
(http://www.phrap.org/) and Consed 12.0 (Gordon et al., 1998). Multiple sequence
alignments were made using Clustal X (Thompson et al., 1997) implemented in MEGA 3.0
(Kumar et al., 2004). Clustal alignments were also checked and edited by hand to minimise
software artefacts.
Molecular diversity indices (π, nucleotide diversity; h, haplotype diversity; and k,
mean number of nucleotide substitutions) were calculated using MEGA 3.0 and ARLEQUIN
software ver. 3.01 (Excoffier et al., 2005). The haplotype was construed using the program
DNAsp 3.99 (Rozas et al., 2003). The haplotypic richness was estimated by RAREFAC, that
uses the technique of rarefaction to correct for sample size (Petit et al., 1998). Typically,
rarefaction is used to standardise allelic richness to the smallest N in a comparison (Petit et
al., 1998). However, the MSM population was not included in this analysis due to its small
sample size (N = 2) and a rarefaction size of N = 4 was used.
44
To perform the comparative analysis with H. stigonocarpa, we used sequences of 175
individuals from different populations of this species and two outgroups taxa, H. aurea and H.
reticulata, as described in a previous study (Ramos et al. 2007). Intraspecific and
interspecific relationships were inferred by the construction of haplotype networks using the
median-joining algorithm (MJ, Bandelt et al., 1999) implemented in the NETWORK 4.1
(Forster et al., 2000) software.
Estimates of differentiation and FST statistics were calculated taking into account the
pairwise distance between cpDNA haplotypes. The program SAMOVA (spatial analysis of
molecular variation, Dupanloup et al., 2002) was used to analyse the population structure.
This method defines groups of populations that are geographically homogenous and
maximally differentiated from each other, through a priori definition of the number of groups
(K) of populations, and generates F statistics (FSC, FST and FCT) using an AMOVA (Excoffier
et al., 1992). By exploring the behaviour of the indices FCT and FSC for different values of K, it
is possible to identify the optimum number of population groups (Dupanloup et al. 2002). For
each value of K 100 simulated annealing processes were used, ranging from K = 2 to K = 8.
Pairwise comparisons of FST between populations, the genetic differentiation among
species, populations and groups were analysed using an AMOVA implemented in the
ARLEQUIN software ver. 3.01 (Excoffier et al., 2005). Tests of neutrality were performed
using Tajima’s D (Tajima, 1989), Fu’s Fs (Fu, 1997) tests with 10,000 simulation steps using
ARLEQUIN software ver. 3.01 (Excoffier et al., 2005). The demographic history of the H.
courbaril was investigated by plotting a mismatch distribution analysis. This distribution is
usually multimodal in samples drawn from populations of relatively stable size over time, and
unimodal in populations that experienced a recent demographic expansion (Rogers &
Harpending, 1992).
Results
Genetic diversity in Hymenaea courbaril
Amplification of the non-coding cpDNA region CS produced a fragment of ~1600 bp, of which
535 bp were sequenced for all individuals. The aligned CS region presented nine indels in
the positions 11, 12, 13, 158, 415, 416, 434, 438 and 504 (Table 2). There were 516
conserved positions and (excluding nine indels) 10 variable sites (9 parsimony informative
sites) in the positions 80, 261, 297, 322, 359, 433, 465, 470, 492 and 525 (Table 2). This
45
region exhibited a high AT content (58.9%), with the presence of several mononucleotide
repeats, as is generally found in non-coding cpDNA regions.
Eighteen haplotypes were found (Fig. 1 and Table 2) defined by the 10 sites and nine
indels. Diversity was high, with total haplotype diversity (Hd), nucleotide diversity (π) and the
mean number of nucleotide differences (k) equal to 0.80, 0.003 and 1.48, respectively.
Haplotype diversity for each population (h) ranged from 0 to 0.83, haplotypic richness (A)
from 0 to 2.183, nucleotide diversity from 0 to 0.00279, and the mean number of nucleotide
differences from 0 to 1.47 (Table 1). The two most diverse populations were the CPM and
RPM for all diversity indices. Conversely, populations SPM, MSM and RLM exhibited only
one haplotype each (diversity indices = 0) (Table 1).
Phylogeographic structure of cpDNA haplotypes and geographical differentiation in H.
courbaril
The phylogenetic relationships among the 18 haplotypes can be observed in the network in
Fig. 2, analysed by the median-joining method. The most frequent haplotypes were H2, H34,
H26, H32 and H1, occurring in 38%, 20%, 13%, 8% and 6% of all sampled individuals,
respectively. H34, H26, H32 and H1 were linked to H2 by a single nucleotide substitution in
positions 525, 434, 492 and 80, respectively (Fig. 2). Most haplotypes (13) were exclusive of
only one population (Table 2). This is the case of haplotypes H29, H30 and H31, found only
in the CPM population and haplotypes H35, H36 and H37 found exclusively in the PAM
population (Table 2).
The SAMOVA analyses of H. courbaril data indicated that there were distinct
genetically defined groups of sampling areas. In analyses, K = 2 suggested a partition of
sampling areas into two groups (groups: ARM, NIM, PNM, PTM, SPM, MSM, FBM, FBMII,
FUM, CPM and RPM vs. PAM, RLM, SEM, MOM; FCT = 0.464 and FSC = 0.347). If K = 3, an
additional partition was identified that subdivided the first group in two areas, separating
CPM and RPM from the remaining populations (FCT value remained 0.464 and FSC = 0.262).
Between K = 4 and K = 8 the FCT maintained similar values, ranging from 0.437 to 0.516, but
resulted in groups containing only one population. Thus, our SAMOVA analysis indicated the
same FCT values for both configurations, with two or three groups. The configuration with K=3
gave a lower value of FSC than with that with K=2, indicating more-similar populations within
groups. So we selected this configuration with three groups to explain the genetic structure in
H. courbaril. Thus, the three geographical groups are: Group “W” composed of ARM, NIM,
PNM, PTM, SPM, MSM, FBM, FBMII, and FUM; group “C” composed of CPM and RPM
46
populations; and group “E” composed of PAM, RLM, SEM, and MOM populations. The
haplotype H2 is found in the western and central distribution, in groups W and C, and the
haplotype H1 is restricted to group C. Haplotype H34 is found in group E, but also in FUM
population (group W). The SAMOVA performed with eastern, central and western clusters
gave a FST value of 0.604, indicating that 60.4% of the variation was due to differences
among populations (Table 3). The fixation indices (FST) calculated for each pair of
populations ranged from 0.11 to 1.00 and most values were significant (P < 0.05).
Sequence variation demonstrated significant deviation from expectations of neutrality
by Fu’s test (Fs = - 9.40, P < 0.001), but was non-significant in Tajima’s test (D = - 0.95, P >
0.17) for the total sample. A unimodal histogram of the genetic differences between pairs of
individuals in a mismatch distribution considering all the analysed individuals (with a peak at
about one difference) (Fig. 4), suggested a recent population expansion.
Comparison with Hymenaea stigonocarpa
Forty haplotypes (19 variable sites) were identified; defined by the 175 individuals of H.
stigonocarpa, 149 of H. courbaril, one of H. aurea and one of H. reticulata. The phylogenetic
relationship among the 40 observed haplotypes is shown by the network in Fig. 3, analysed
by the median-joining method. The results revealed that H. courbaril and H. stigonocarpa
shared three haplotypes, H1, H2 and H8, the most frequent of which in both species being
H2. Both haplotypes of outgroups, H24 (H. aurea) and H25 (H. reticulata), were associated
directly with haplotype H2. The H2 haplotype is present in about 38% of all H. courbaril
individuals sampled and is most frequent in group W (59.8% of the individuals). In H.
stigonocarpa, this haplotype occurs in 76.1% of western group and in 33% of all individuals
sampled. In H. courbaril group E, the most frequent haplotype is H34 (76.3%), which is
directly related to the other haplotypes found in this group (H35, H36, H37, H39 and H40).
The H8 haplotype, most frequent in the “eastern group” of H. stigonocarpa, is only present in
one individual from the RPM population of H. courbaril (group C). However, H34 and its
associated haplotypes from H. courbaril are directly related to H8 and its associated
haplotypes from H. stigonocarpa. H1 is most frequent haplotype in the “central group” of H.
stigonocarpa (Ramos et al., 2007), and is present in the CPM and RPM populations of group
C of H. courbaril. Only the H34 haplotype is shared between groups, being found in one
individual from the population FUM (group W) and one from the population RPM (group C).
The two species are very similar according to the AMOVA considering the pairwise
distance between haplotypes. This indicated that only 10.5% of the genetic variation found is
47
due to differences between the species, 51.7% of it was due to differences among
populations belonging to the same species and 37.8% within populations (Table 3).
Discussion
Hymenaea courbaril exhibited high diversity in the 535 bp sequence of the region psbc/trnS3.
It gave 18 haplotypes and values of diversity indices h, pi, k equal to 0.80, 0.003 and 1.48,
respectively. These values are very similar to those found in its congeneric H. stigonocarpa,
for the same cpDNA sequence, that exhibited 23 haplotypes and diversity indices equal to
0.804, 0.003 and 1.598 (Ramos et al., 2007). H. courbaril exhibited equivalent genetic
divergence among populations (FST = 0.650), to the typical values for angiosperm tree
species (mean GST = 0.646, Petit et al., 2005). Similar among-population differentiation was
reported for H. stigonocarpa (FST = 0.692) (Ramos et al., 2007). There were further
similarities in the grouping of H. courbaril and H. stigonocarpa populations by
phylogeographic analysis. Populations of both species fell into three groups. For H.
stigonocarpa these were geographical well-defined into western, central and eastern groups,
while for H. courbaril, although genetically and geographically similar those of H.
stigonocarpa, they were less well-defined and not entirely spatially coincident (W, C, and E).
Thus, we conclude that the phylogeographic structure of the two congeneric species is
similar.
The H. courbaril populations sampled mainly originated from semi-deciduous Atlantic
forest (also referred to as seasonally dry forest, by Pennington et al., 2006) and riverine
forest. Paleo-palinological studies suggest that large areas of the southern and south-eastern
Brazilian highlands were covered with subtropical grasslands during the last glacial,
reflecting a cold dry climate (Behling & Hooghiemstra, 2001). This region was 5 to 7°C cooler
during the Last Glacial Maximum (LGM) than today, with hard frosts which precluded the
survival of Cerrado vegetation and semi-deciduous forests (Behling, 1998). More frequent
frosts have been suggested as an important factor limiting the development of Cerrado
vegetation (Eiten, 1972; Silberbauer-Gottsberger et al., 1977). During the LGM, tropical
gallery forests and semi-deciduous forests may only have existed where frosts were not
frequent, probably in the north part of south-eastern Brazil. With an increase in temperature
at the beginning of Holocene in south-east Brazil, grasslands were replaced by Cerrado
vegetation in regions with long annual dry periods (5-6 months), by semi-deciduous forests in
regions with a short annual dry season (3-5 months) and by rain forests in regions without
48
significant dry periods. Initial expansion probably originated from gallery forests and forest
remnants in regions free of hard frosts and strong drought stress (Behling, 1998).
Our cpDNA data suggest that during LGM H. courbaril populations must have
persisted only in the most northerly regions and in sites at low elevation. This may explain
the higher diversity exhibited by the most north-easterly populations, PAM and MOM. The
RPM and CPM populations besides exhibiting high diversity showed divergent haplotypes
suggesting that in these regions a large population of H. courbaril survived maintaining
refugia for the species during the glacial periods. The geographic characteristics of the Rio
Doce and Jequitinhonha valleys, regions where the CPM and RPM populations occur, allow
typical lowland rain-forest species to expand their distribution toward the interior (Oliveira-
Filho & Fontes, 2000). In these regions, the most favourable climatic conditions during the
last glaciation could have allowed the persistence of Atlantic forest refugia harbouring
populations of H. courbaril.
The expansion of H. courbaril populations southward into the Cerrado biome after
reestablishment of climate conditions from the northernmost areas may have initially
occurred through riverine forests. Many rain forest species, both Amazonian and Atlantic, are
known to expand their distribution into areas with strongly seasonal climates via riverine
forests (Oliveira-Filho & Ratter 1995). The population FUM, located in Furnas south of Minas
Gerais state, contained the most common haplotype of the three phylogeographic groups
(H2, H32 and H34). One population of the savanna species, H. stigonocarpa, was also
present in Furnas, and contained haplotypes from the three groups of this species,
haplotypes H1, H2 and H8 (Ramos et al., 2007). This pattern, common to both species,
reinforces the suggestion that the region was recolonised by different lineages from the more
northern and eastern populations (Ramos et al., 2007). This fact and the same overall
diversity of the two species, suggest that, although they occupy different habitats (savanna
and forest) both must have experienced the same impacts of the Quaternary climatic
changes. This reinforces evidence of large vegetation changes suggested by
paleopalinological studies.
The existence of three haplotype groups in H. courbaril may result from barriers to
gene flow. Edaphic limitations and geographic barriers could explain the differentiation in
distribution of haplotypes between the groups. H. courbaril occurs in riverine forests in the
Cerrado biome and thus its populations could have been isolated into hydrographic basins by
mountains chains. For example, group W corresponds to populations located mainly in the
Paraná river basin, and the C and E groups occur in east-facing hydrographic basins,
separated from the Paraná basin by the Espinhaço mountain range. Outro fator que poderia
49
explicar a limitação do fluxo genico entre as populações está ligado ao agente dispersor.
Dispersion of H. courbaril seeds is mainly carried out by agoutis (Asquith et al., 1999), but
Hallwachs (1986) suggested that (extinct) giant mammals performed this function in the past.
Giant mammals probably had greater dispersion capacities than agoutis, and as such are
thought to have been more effective seed dispersers. The maximum recorded dispersal
distance of H. courbaril live seeds in Peruvian Amazonian is 12.1 m (median 3.1 m), and
acouchies (most likely Myoprocta pratti) and agoutis (Dasyprocta fuliginosa) were apparently
the main dispersal agents (Gorchov et al., 2004). With megafaunal extinction, dispersion of
seeds and gene flow were reduced, thus favouring the relative isolation and further
differentiation between populations.
The central position and high occurrence of H2 in the H. courbaril network, would
suggest that it is the most ancestral haplotype according to coalescence theory (Posada &
Crandall, 2001). This premise is supported by the relationships of H2 with outgroups (H.
reticulata and H. aurea) and with the haplotypes of H. stigonocarpa. Further evidence that H2
may be the oldest haplotype is given by the geographic proximity of the Amazon rain forest
to both group W in H. courbaril and the western group in H. stigonocarpa, since the Amazon
rain forest is the habitat of most Hymenaea species and its putative center of origin (Poinar &
Brown, 2002). According Langenheim et al. (1973), Hymenaea species of the Amazon rain
forest provided the stock for related species that radiated into other regions.
As described above, the two congeneric species, H. courbaril and H. stigonocarpa,
share three haplotypes H1, H2 and H8. In both species these haplotypes are found in
approximately the same geographic areas. The AMOVA comparing the two Hymenaea
species indicated that they are very similar. Only 10.5% of genetic variation was due to
differences between these species and 51.7% was due to differences among populations
belonging to the same species. This demonstrates that there is more divergence among
populations of the same species than divergence between species. Maternally-inherited
markers are frequently shared among holoarctic tree species (Rajora & Dancik, 1992; Petit et
al., 2002; Palmé et al., 2004; Lexer et al., 2005; Heuertz et al., 2006). The sharing of
haplotypes among species can be due to recent origin associated with the presence of
ancestral polymorphisms or hybridisation and introgression. It has been suggested that
differentiation of these Hymenaea species is recent (Langenheim et al., 1973, Lee &
Langenheim, 1975). H. stigonocarpa and H. courbaril var. stilbocarpa are considered to be
vicariant species by botanists, i.e, closely-related species that occur in adjacent areas but
are ecologically distinct (Heringer et al., 1976). The two species co-occur in some regions,
have similar flower anatomy (Lee & Langenheim, 1975) and probably share the same
50
pollinator species (Gibbs et al., 1999). Phenological data show that their flowering times
overlap: H. courbaril flowers between November and January, and H. stigonocarpa from
December to March in the regions we sampled (Lee & Langenheim, 1975; and analysis of
BHCB herbarium collection). Although Lee & Langenheim (1975) considered occurrence of
hybridization and introgression in the genus Hymenaea to be possible, we are not aware of
hybridisation between these species Thus, the available evidences does not allow us to rule
out none the two hypothesis, ancestral polymorphism (incomplete lineage sorting) or
hybridization to explain the sharing of haplotypes between H. stigonocarpa and H. courbaril.
Given that cpDNA markers only exhibit a slow evolution rate, evidence from other markers
with a faster rate of evolution such as single sequence repeat (SSR), would help to elucidate
the evolutionary history of these related species.
Acknowledgements
This study was supported by the Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq/Brazil). We also thank the Instituto Brasileiro de Meio Ambiente for
providing facilities, Reinaldo M. Silva, Renan Milagres, Luciana C. Resende and Juliano Leal
for technical assistance in this study, Fabrício dos Santos Rodrigues for suggestions and
sequencing facilities, Ana Y. Ciampi, Rosangela L. Brandão and Maíra F. Goulart for their
help in sample collection. A. C. S. Ramos received a PhD fellowship from the Coordenação
de Aperfeiçoamento de Pessoal de Nível Superior (CAPES/Brazil). J. Lemos-Filho received
research fellowship from CNPq/Brazil.
References
Albaladejo RG, Fuertes Aguilar J, Aparicio A, Nieto Feliner G. 2005. Contrasting
nuclear–plastidial phylogenetic patterns in the recently diverged Iberian Phlomis crinita
and P. lychnitis lineages (Lamiaceae). Taxon 54: 987-998.
Asquith NM, Terborgh J, Arnold AE, Riveros CM. 1999. The fruits the agouti ate:
Hymenaea courbaril seed fate when its disperser is absent. Journal of Tropical Ecology
15: 9-235.
Bandelt H-J, Forster P, Röhl A. 1999. Median-joining networks for inferring intraspecific
phylogenies. Molecular Biology and Evolution 16: 37-48.
51
Behling H. 1995. A high resolution Holocene pollen record from Lago do Pires, SE Brazil:
Vegetation, climate and fire history. Journal of Paleolimnology 14: 253-268.
Behling H. 1998. Late quaternary vegetational and climatic changes in Brazil. Review of
Paleobotany and Palynology 99: 143-156.
Behling H. 2002. South and southeast Brazilian grasslands during Late Quaternary times: a
synthesis. Palaeogeography, Palaeoclimatology, Palaeoecology 177: 19-27.
Behling H, Hooghiemstra H. 2001. Neotropical Savanna Environments in Space and Time:
Late Quaternary Interhemispheric Comparison. In: Markraf V, ed. Interhemispheric
Climate Linkages. New York, USA: Academic Press, 307-323.
Behling H, Lichte M. 1997. Evidence of dry and cold climatic conditions at glacial times in
tropical southeastern Brazil. Quaternary Research 48: 348-358.
Cardoso SRS, Eloy NG, Provan J, Cardoso MA, Ferreira PCG. 2000. Genetic
differentiation of Euterpe edulis Mart. populations estimated by AFLP analysis. Molecular
Ecology 9: 1753-1760.
Collevatti RG, Grattapaglia D, Hay JD. 2003. Evidences for multiple maternal lineages of
Caryocar brasiliense populations in the Brazilian cerrado based on the analysis of
chloroplast DNA sequences and microsatellite haplotype variation. Molecular Ecology 12:
105-115.
Crestana CSM, Dias IS, Mariano G. 1985. Ecologia de polinização de Hymenaea
stilbocarpa Hayne, o Jatobá. Silvicultura em São Paulo 17/19: 31-37.
Demesure B, Sodzi N, Petit RJ. 1995. A set of universal primers for amplification of
polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular
Ecology 4: 129-131.
Doyle JJ, Doyle JL. 1987. Isolation of plant DNA from fresh tissue. Focus 12: 13-15.
Dumphy BK, Hamrick JL, Schwagerl J. 2004. A comparison of direct and indirect
measures of gene flow in the Bat-pollinated tree Hymenaea courbaril in the dry forest Life
zone of southwestern Puerto Rico. International Journal of Plant Sciences 165: 427–436.
Dupanloup I, Schneider S, Excoffier, L. 2002. A simulated annealing approach to define
the genetic structure of populations. Molecular Ecology 11: 2571-81.
52
Eiten G. 1972. The cerrado vegetation of central Brazil. Botanical Review 38: 201-341.
Ennos RA, Sinclair WT, Hu X-S, Langdon A. 1999. Using organelle markers to elucidate
the history, ecology and evolution of plant populations. In: Hollingsworth PM, Bateman
RM, Gornall RJ, eds. Molecular Systematics and Plant Evolution, London, UK: Taylor &
Francis Ltd, 1–19.
Ewing B, Green P. 1998. Basecalling of automated sequencer traces using Phred II: error
probabilities. Genome Research 8: 186-194.
Ewing B, Hillier L, Wendi M, Green P. 1998. Basecalling of automated sequencer traces
using Phred I: accuracy assessment. Genome Research 8: 175-185.
Excoffier L, Laval G, Schneider S. 2005. Arlequin ver. 3.0: an integrated software package
for population genetics data analysis. Evolutionary Bioinformatics Online 1: 47-50.
Excoffier LP, Smouse E, Quattro JM. 1992. Analysis of molecular variance inferred from
metric distances among haplotypes: application to human mitochondrial DNA restriction
data. Genetics 131: 479-491.
Ferreira ME, Grattapaglia D. 1995. Introdução ao uso de marcadores moleculares em
análise genética. Brasília, Brasil: EMBRAPA/CENARGEN.
Forster P, Bandelt HJ, Rohl A et al. 2000. NETWORK 3.1.1.0. Software free available at:
www.fluxus-engineering.com. Cambridge, UK: Fluxus Technology Ltd.
Fu YX. 1997. Statistical tests of neutrality of mutations against population growth, hitchhiking
and backgroud selection. Genetics 147: 915-925.
Gibbs PE, Oliveira PE, Bianchi MB. 1999. Postzygotic control of selfing in Hymenaea
stigonocarpa (Leguminosae-Caesalpinioideae), a bat-pollinated tree of the Brazilian
Cerrados. International Journal of Plant Sciences 160: 1-7.
González-Rodríguez A, Bain JF, Golden JL, Oyama K. 2004. Chloroplast DNA variation in
the Quercus affinis–Q. laurina complex in Mexico: geographical structure and associations
with nuclear and morphological variation. Molecular Ecology 13: 3467–3476.
Gorchov DL, Palmeirim JM, Jaramillo M, Ascorra CF. 2004. Dispersal of seeds of
Hymenaea courbaril (Fabaceae) in a logged rain forest in the Peruvian Amazonian. Acta
Amazônica 34: 265-273.
53
Gordon D, Abajian C, Green P. 1998. Consed: a graphical tool for sequence finishing.
Genome Research 8: 195-202.
Hallwachs W. 1986. Agouti (Dasyprocta punctata): the inheritors of guapinol (Hymenaea
coubaril: Leguminosae). In: Estrada A, Fleming TH, eds. Frugivores and seed dispersal.
Dordrecht, Netherlands: W. Junk Publishers, 285-304.
Heringer EP, Barroso GM, Rizzo JA, Rizzini CT. 1976. A Flora do Cerrado In: Ferri MG,
coord. IV Simpósio sobre o cerrado. São Paulo, Brasil: 211-231.
Heuertz M, Carnevale S, Fineschi S, Sebastiani F, Hausman JF, Paule L, Vendramin GG. 2006. Chloroplast DNA phylogeography of European ashes, Fraxinus sp. Oleaceae:
roles of hybridization and life history traits. Molecular Ecology 15, 2131–2140.
IBAMA – Instituto Brasileiro do Meio Ambiente e dos Recursos Renováveis 1992. Plantas Medicinais Ameaçadas de Extinção. Available at: http://www.ibama.gov.br/
flora/divs/plantasextincao.pdf. Accessed in May, 5 2007.
Kumar S, Tamura K, Nei M. 2004. MEGA3: Integrated software for molecular evolutionary
genetics analysis and sequence alignment. Briefings in Bioinformatics 5: 150-163.
Langenheim JH, Lee Y-T, Martin SS. 1973. An evolutionary and ecological perspective of
Amazonia Hylaea species of Hymenaea (Leguminosae: Caesalpinioideae). Acta
Amazonica 3: 5-38.
Lee Y-T, Langenheim JH. 1975. Systematics of the genus Hymenaea L. (Leguminosae,
Caesalpinioidae, Detarieae). University of California Publications in Botany 69: 1-109.
Lexer C, Fay MF, Joseph JA, Nica M-S, Heinze B. 2005. Barrier to gene flow between two
ecologically divergent Populus species, P. alba (white poplar) and P. tremula (European
aspen): the role of ecology and life history in gene introgression. Molecular Ecology 14:
1045-1057.
Lira CF, Cardoso SRS, Ferreira PCG, Cardoso MA, Provan H. 2003. Long-term
population isolation in the endangered tropical tree species Caesalpinia echinata Lam.
revealed by chloroplast microsatellites. Molecular Ecology 12: 3219-3225.
Lorenz-Lemke AP, Muschner VC, Bonatto SL, Cervi AC et al. 2005. Phylogeographic
inferences concerning evolution of Brazilian Passiflora actinia and P. elegans
(Passifloraceae) based on ITS (nrDNA) variation. Annals of Botany 95: 799-806.
54
McCauley DE. 1995. The use of chloroplast DNA polymorphism in studies of gene flow in
plants. Trends in Ecology and Evolution 10: 198-202.
Oliveira-Filho AT, Fontes MAL. 2000. Patterns of floristic differentiation among Atlantic
Forests in southeastern Brazil and the influence of climate. Biotropica 32: 793-810.
Oliveira-Filho AT, Ratter JA. 1995. A study of the origin of central Brazilian forests by the
analysis of plant species distribution patterns. Edinburgh Journal of Botany 52: 141-194.
Palmé AE, Su Q, Palsson S, Lascoux M. 2004 Extensive sharing of chloroplast haplotypes
among European birches indicates hybridization among Betula pendula, B. pubescens
and B. nana. Molecular Ecology 13: 167-178.
Pennington RT, Ratter JA, Lewis GP. (2006). An overview of the plant diversity,
biogeography and conservation of neotropical savannas and seasonally dry forests. In
R.T. Pennington, G.P. Lewis, J.A. Ratter, eds. Neotropical savannas and seasonally dry
forests: plant diversity, biogeography and conservation. Florida , USA: CRC Press, 1-29.
Petit RJ, Brewer S, Bordács S et al. 2002. Identification of refuges and post-glacial
colonization routes of European white oaks based on chloroplast DNA and fossil pollen
evidence. Forest Ecology and Management 156: 49–74.
Petit RJ, Duminil J, Fineschi S, Hampe A, Salvini D, Vendramin GG. 2005. Comparative
organization of chloroplast, mitochondrial and nuclear diversity in plant populations.
Molecular Ecology 14: 689-701.
Petit RJ, El Mousadik A, Pons O. 1998. Identifying populations for conservation on the
basis of genetic markers. Conservation Biology 12: 844-855.
Poinar Jr G, Brown AE. 2002. Hymenaea mexicana sp. nov. (Leguminosae:
Caesalpinioideae) from Mexican amber indicates Old World connections. Botanical
Journal of the Linnean Society 139: 125-132.
Posada D, Crandall KA. 2001. Intraspecific phylogenetics: Trees grafting into networks.
Trends in Ecology and Evolution 16: 37-45.
Prado DE, Gibbs PE. 1993. Patterns of species distributions in the dry seasonal forest
South America. Annals of the Missouri Botanic Garden 80: 902-927.
Rajora OP, Dancik BP. 1992. Chloroplast DNA inheritance in Populus. Theoretical and
Applied Genetics 84: 280-285.
55
Ramos ACS, Lemos-Filho JP, Ribeiro RA, Santos FR, Lovato MB. 2007. Phylogeography
of the tree Hymenaea stigonocarpa (Fabaceae: Caesalpinioideae) and the influence of
Quaternary climate changes in the Brazilian Cerrado. Annals of Botany 100: 1219-1228.
Rieseberg LH, Soltis DE. 1991. Phylogenetic consequences of cytoplasmic gene flow in
plants. Evolutionary Trends in Plants 5: 65-84.
Rieseberg LH, Whitton J, Linder CR. 1996. Molecular marker incongruence in plant hybrid
zones and phylogenetic trees. Acta Botanica Neerlandica 45: 243–262.
Rogers AR, Harpending H (1992) Population growth makes waves in the distribution of
pairwise genetic differences. Molecular Biology and Evolution 9: 552-569.
Rozas J, Sánches-Delbarrio JC, Messeguer X, Rozas R. 2003. DnaSP, DNA
polymorphism analysis by the coalescent and other methods. Bioinformatics 19: 2496-
2497.
Salgueiro F, Felix D, Caldas JF, Margis-Pinheiro M, Margis R. 2004. Even population
differentiation for maternal and biparental gene markers in Eugenia uniflora, a widely
distributed species from the Brazilian coastal Atlantic rain forest. Diversity Distribution 10: 201–210.
Schierenbeck KA, Symonds VV, Gallagher KG, Bell J. 2005. Genetic variation and
phylogeographic analyses of two species of Carpobrotus and their hybrids in California.
Molecular Ecology 14: 539-547.
Silberbauer-Gottsberger I, Morawetz W, Gottsberger G. 1977. Frost damage of cerrado
plants in Botucatu. Biotropica 9: 253–261.
Tajima F (1989) The Effect of Change in Population Size on DNA Polymorphism. Genetics
123, 597-601.
Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL
X windows interface: flexible strategies for multiple sequence alignment aided by quality
analysis tools. Nucleic Acids Research 24: 4876-4887.
Wu SH, Hwang CY, Lin TP, Chung JD,Cheng YP, Hwang SY. 2006. Contrasting
phylogeographical patterns of two closely related species, Machilus thunbergii and
Machilus kusanoi (Lauraceae), in Taiwan. Journal of Biogeography 33: 936-947.
56
Figure legends
Fig. 1 Geographic location and cpDNA haplotype frequencies of H. courbaril populations.
Circle size is proportional to sample size and colours represent the different haplotypes, as
shown in the key.
Fig. 2 Median-joining network analysis of the relationships among haplotypes of psbC/trnS3
non-coding sequence of cpDNA from 149 individuals of H. courbaril. Circle area is
proportional to haplotype frequency. Lines drawn between haplotypes represent mutation
events identified by the numbers corresponding to the positions where the mutations were
observed.
Fig. 3 Median-joining network analysis of the relationships among haplotypes of psbC/trnS3
non-coding sequence of cpDNA from 149 individuals of H. courbaril (black), 175 individuals
of H. stigonocarpa (white) and two outgroup species (gray). Circle area is proportional to
haplotype frequency. Lines drawn between haplotypes represent mutation events identified
by the numbers corresponding to the positions where the mutations were observed. The
point “mv” represents a hypothetical haplotype (median vector).
Fig. 4 Mismatch distribution histogram for cpDNA haplotypes, indicating observed and
expected numbers of pairwise differences between H. courbaril plants.
57
Fig. 1
58
Fig. 2
59
Fig. 3
60
Fig 4.
61
Table 1 Geographical location of Hymenaea courbaril populations, number of individuals sampled per population, number of haplotypes per
population and diversity indices based in psbC/trnS3 non-coding sequence of cpDNA
Populations / State Abbr. Latitude / Longitude n nh A(4) k h πAruanã / GO ARM 14º53'36"S 51º05'21"W 10 2 0,924 0.53 0.53 0.00102Niquelândia / GO NIM 14º33'15"S 48º33'19"W 14 2 0,915 0.53 0.53 0.00101Brasília National Park/ DF PNM 15º46'47"S 47º55'47"W 9 2 0,444 0.22 0.22 0.00043Paracatu / MG PTM 17º05'14"S 46º50'47"W 15 2 0,923 0.53 0.53 0.00102Pirajú / SP SPM 23º11'37"S 49º23'02"W 5 1 0 0 0 0Rio Brilhante / MS MSM 21º48'07"S 54º32'47"W 2 1 0 0 0Fazenda Brejão / MG FBM 17º00'00"S 45º54'00"W 9 3 1.365 1.22 0.67 0.00233Fazenda Brejão / MG FBMII 17º00'00"S 45º54'00"W 8 2 0,786 0.43 0.43 0.00082Furnas / MG FUM 20º51'49"S 46º23'16"W 15 3 1.149 0.65 0.59 0.00124Rio Doce State Park / MG CPM 19º42'00"S 42º30'36"W 15 5 1.985 1.47 0.81 0.00279São Gonçalo do Rio Preto / MG RPM 18º00'00"S 43º23'00"W 9 6 2.183 1.28 0.83 0.00244Mocambinho / MG MOM 15º05'36"S 44º01'05"W 7 2 0,971 1.14 0.57 0.00219Chapada da Diamantina National Park / BA PAM 12º31'47"S 41º34'14"W 18 4 1.031 1,00 0.47 0.00192Reserva de Linhares / ES RLM 19º05'21"S 40º01'32"W 9 1 0 0 0 0Paulo Cesar Vinha State Park / ES SEM 20º20'40"S 40º31'37"W 4 2 1.000 0.67 0.67 0.00128
nh = number of haplotypesA = haplotypic richness
pi = nucleotide diversity
n = sample size
k = Average number of nucleotide differencesh = Haplotype diversity
62
Table 2 Distribution and frequency of cpDNA haplotypes based in psbC/trnS3 non-coding sequence in each population of Hymenaea courbaril
0 0 0 0 1 2 2 3 3 4 4 4 4 4 4 4 4 5 51 1 1 8 5 6 9 2 5 1 1 3 3 3 6 7 9 0 2
Haplotype 1 2 3 0 8 1 7 2 9 5 6 3 4 8 5 0 2 4 5 ARM NIM PNM PTM SPM MSM FBM FBMII FUM CPM RPM MOM PAM RLM SEM TotalH_1 - - - T - T T A T - - A - - C C T - G 5 4 9H_2 . . . C . . . . . . . . . . . . . . . 6 8 8 7 5 4 6 8 3 1 56H_8 . . . . . . . . . . . . . . . . . . A 1 1H_26 . . . C . . . . . . . . C . . . . . . 4 6 8 1 19H_27 . . . C . . . . . . . C . . . . . . . 1 1H_28 . . . C . . . . . . . . A . . . C . 2 2H_29 . . . . . . . . . . . . . . . G . . 4 4H_30 . . . C C . . . . . . . . . . . . . 1 1H_31 . . . . . . . . . A T . . . . . . . . 2 2H_32 . . . C . . . . . . . . . . . . G . . 4 2 6 12H_33 C A T C . . . . . . . . . . . . . . . 1 1H_34 . . . C . . . . . . . . . . . . . . A 1 1 3 13 9 2 29H_35 . . . C . A . G G . . . . . . . . . A 2 2H_36 . . . C . A . . G . . . . . . . . . A 2 2H_37 . . . C . A . . . . . . . . . . . . A 1 1H_38 . . . . . . . . . . . . C . . . . . . 1 1H_39 . . . C . . G . . . . . . . . . . . A 2 2H_40 . . . C . . . . . . . . . . G A . . A 4 4Total 10 14 9 15 5 2 9 8 15 15 9 7 18 9 4 149
Polymorphic sites
63
Table 3 Analysis of molecular variance based on the sequencing of psbC/trnS3 non-coding region for 15 populations of Hymenaea courbaril
and combined analysis with 17 populations of Hymenaea stigonocarpa
Source of variation d.f. Sum of
squaresVariance components
Percentage of variation
Fixation Indices
Among groups 2 40.77 0.43 Va* 46.4 FCT: 0.46Among populations within groups 12 19.24 0.13 Vb* 14.1 FST: 0.60
Within populations 134 49.68 0.37 Vc* 39.6 FSC: 0.26Total 148 109.69 0.94
Among species 1 21.05 0.09 Va** 10.5 FCT: 0.10Among populations within species 31 149.94 0.46 Vb* 51.7 FST: 0.62
Within populations 291 98.80 0.34 Vc* 37.8 FSC: 0.58Total 323 269.79 0.90* P < 0.01** P = 0.016
64
CAPÍTULO III
Isolation and characterization of microsatellite loci for Hymenaea courbaril and transferability to Hymenaea stigonocarpa, two tropical timber species.
Ciampi, A.Y. , Azevedo, V.C.R. , Gaiotto, F.A. §, Ramos, A.C.S.*, Lovato, M.B*.
Embrapa Recursos Genéticos e Biotecnologia, Parque Estação Biológica (PqEB) Av.
W5 Norte (final), CP 02372, CEP 70770-900, Brasília DF, Brazil.
§ Universidade Estadual de Santa Cruz UESC, Ilhéus, BA, Brazil.
*Departamento de Biologia Geral, Instituto de Ciências Biológicas, Universidade
Federal de Minas Gerais UFMG, Caixa Postal 486, 31270-901, Belo Horizonte, MG,
Brazil.
Keywords: microsatellite, genetic diversity, conservation, Hymenaea, transferability.
Correspondence: Dra. Ana Y. Ciampi e-mail: [email protected]
Present address: Embrapa Recursos Genéticos e Biotecnologia, PqEB Av. W5 Norte
(final), Brasília DF, CEP 70770-900, CP 02372. Fax: 55 61 33403624
Running title: Isolation and characterization of microsatellite loci for Hymenaea
courbaril and transferability.
65
Abstract
Hymenaea courbaril is a tropical timber species, intensely exploited and
found in the Amazon, Atlantic Forest and Brazilian Cerrado Biome. Nine
highly polymorphic microsatellite loci were developed from a genomic library
enriched for AG/TC repeats. In a total of 41 individuals, from two natural
populations, seven to 13 alleles per locus were detected and expected
heterozygosity ranged from 0.75 to 0.90. Seven loci were effectively
transferred to Hymenaea stigonocarpa. High levels of polymorphism make
the present primers useful for population genetic studies and are a powerful
tool to investigate mating system, gene flow and spatial genetic structure.
66
Hymenaea courbaril (Leguminosae, Caesalpinoideae) commonly known as
jatobá is a timber and medicinal species that can be found in the Amazon, Atlantic
Forest and Brazilian Cerrado Biome. This species is listed in the official list of Brazilian
endangered medicinal species (IBAMA, 1992) due to intense anthropogenic activities.
H. stignocarpa, an important congeneric vicariant species, occurs in the Cerrado
Biome. The conservation of genetic resources in tropical biomes is of great importance,
since they have been degraded on a large scale in recent decades. Microsatellite
markers are important tools for generating detailed pictures of genetic diversity,
population genetic structure and to address biogeographical questions. These data, in
turn, are useful for the development of strategies for sustainable forest conservation
and management practices. We report the development and transferability of highly
polymorphic microsatellite loci in the genus Hymenaea.
A microsatellite enriched library was constructed as described by Rafalsky
(1996) adapted by Buso et al. (2003). Total genomic DNA was extracted from
expanded leaves of a single individual of Hymenaea courbaril using a CTAB protocol
(Doyle & Doyle, 1987). DNA was digested with Sau3A I and fragments were separated
on a 2% agarose gel. DNA between 200 to 800 bp was recovered using the Qiaquick
Gel Extraction kit of QIAGEN, linked to adaptors, amplified and used to construct the
enriched genomic library. The fragments were ligated into the pGEM-T Easy vector
(Promega, Madison, WI) and transformed into E. coli XL1-Blue. Positive clones were
selected by hybridization with a poly AG/TC probe and sequenced on an ABI 377
Applied Biosystem (Perkin Elmer, CA) automatic fragment analyzer. Primers to the
flanking regions were designed using Primer 3 Output software (Rozen & Skaletsky,
2000).
Microsatellite loci were amplified by PCR in 13 μl containing: DNA (3 ng), 1x
PCR reaction buffer (10mM Tris-HCl, pH 8.3, 50 mM KCl), forward primer (0.3 μM),
and reverse primer (0.3 μM), MgCl2 (1.5mM), BSA (0.25 mg/ml), dNTP (0.25 mM), Taq
polymerase (1 U) and ultrapure water. PCR conditions were: denaturation at 94oC for 5
minutes; 30 cycles of denaturation at 94 oC for 1 min, annealing at Ta (Table 1) for 1
min, and extension at 72 oC for 1 min, and a final extension at 72oC for 7 min.
Amplifications were performed with a PTC-200 Peltier Thermal Cycler (MJ Research).
For the polymorphism evaluation, reaction products from 12 adult individuals
were separated on 4% polyacrylamide gel and visualized by silver staining. The
67
forward primers of the polymorphic loci were fluorescence labeled and used to analyze
41 adult trees from two natural populations, located at Furnas (21 trees), a protected
area, and at the Parque Estadual do Rio Doce (20 trees) both in the state of Minas
Gerais, Brazil. The number of alleles per locus, mean observed and expected
heterozygosities, intrapopulation fixation index and Theta-p estimates were calculated
using GDA – Genetic Data Analysis version 1.0 (Lewis & Zaykin, 2001). Probabilities of
paternity exclusion (Slate, 2000) were estimated using Cervus version 3.0, (Kalinowski,
2007) based on the same sampled trees (Table 1). We also checked for the presence
of null alleles using the program Micro-Checker (Oosterhout et al., 2004).
For transferability to H. stigonocarpa, polymorphic loci were amplified by PCR
using the same conditions as described above. Polymorphism was evaluated using a
total of 40 individuals from two natural populations: twenty individuals from Parque
Nacional da Chapada Diamantina – BA, Brazil and twenty from Parque Nacional da
Serra do Cipó – MG, Brazil.
Fifty one clones contained both microsatellite and appropriate flanking regions
for primer design. Thirty primer pairs were successfully used to amplify SSR loci. Nine
were polymorphic for H. courbaril and of those, seven were transferable to H.
stigonocarpa. For H. courbaril the number of alleles per locus varied from seven to 13
and expected heterozygosity ranged from 0.75 to 0.90 (Table 1). Eight loci, except
Hc06, showed departure from Hardy-Weinberg expectations (P<0.005) and no pairwise
disequilibrium was detected. At the population level, two loci (Hc25 and Hc34) and four
loci (Hc12, Hc14, Hc25 and Hc42) showed departure from HW for Parque Estadual do
Rio Doce and Furnas populations respectively. The first estimate of paternity exclusion
probability Pr(Ex1), when the offspring is sampled but the mother is not was 0.998 for
the combined loci. The second estimate, Pr(Ex2), when both the mother and the
offspring are sampled was 0.99996 (Table 1).
The fixation index of the H. courbaril populations was 0.100 (Furnas) and 0.201
(Parque Estadual do Rio Doce). The departure from the Hardy-Weinberg Equilibrium
detected in both populations is likely to be due to the presence of null alleles in both
populations. In fact, the null allele test (Micro Checker, Oosterhout et al., 2004)
detected that three loci show a significant rate of null alleles, one (Hc 34) for Furnas
population and two (Hc25 and Hc42) for Parque Estadual do Rio Doce. This result
indicates that the presence of null alleles may not be a characteristic of the loci but the
68
population. The population analysis also detected, for both species, low but significant
(C.I. 99%) difference between populations. The Theta-p value between H. coubaril
populations was 0.08 and between H. stignocarpa populations was 0.04.
In H. stigonocarpa, a total of seven of the obtained loci were amplifiable and
showed high levels of polymorphisms. The mean values for Ho and He were 0.389 and
0.601, respectively. The paternity exclusion probability (Pr(Ex2)), for the combined set
of seven loci yielded an estimate of 0.982.
This study shows that these SSR loci allow very precise individual
discrimination. The nine microsatellite markers developed exhibited a large number of
alleles per locus and high heterozygosity. This suggests that these loci are useful for
population genetic studies. We are currently using these markers to investigate
questions on genetic diversity, spatial genetic structure, mating system and
biogeography in natural populations of H. courbaril and H. stigonocarpa with the aim of
applying scientific knowledge to promote conservation and sustainable management.
Acknowledgements
The authors thank José P. Lemos-Filho and Rosângela L. Brandão, Dr. Bruno M. T.
Walter and Aécio Amaral for collecting samples and GEF Project for their financial
support.
References
Buso GSC, Ciampi AY, Moretzsohn MC, Souza ZP (2003) Protocolo para
desenvolvimento de marcadores microssatélites. Circular Técnica 20, Embrapa
Cenargen, Brasília DF, 11p.
Doyle JJ, Doyle JL (1987) Isolation of plant DNA from fresh tissue. Focus 12:13-15.
IBAMA – Instituto Brasileiro do Meio Ambiente e dos Recursos Renováveis (1992)
Plantas Medicinais Ameaçadas de Extinção. Available at: http://www.ibama.gov.br/
flora/divs/plantasextincao.pdf. Accessed in May, 5 2007.
69
Kalinowski ST, Taper ML, Marshall TC. (2007) Revising how the computer program
CERVUS accommodates genotyping error increases success in paternity
assignment. Molecular Ecology, 16:1099-1106.
Lewis PO, Zaykin D (2001) Genetic Data Analysis: Computer program for the analysis
of allelic data. Version 1.0 (d16c). Available at: http://hydrodictyon.eeb.uconn.edu/
people/plewis/software.php. Accessed in May, 15 2007.
Oosterhout CV, Hutchinson WF, Wills DPM, Shipley P (2004) MICRO - CHECKER:
software for identifying and correcting genotyping errors in microsatellite data.
Molecular Ecology Notes 4:535-538.
Rafalski JA, Morgante M, Powell W, Vogel JM, Tingey SV (1996) Generating and using
DNA markers in plants. In: Birren, B. & Lai, E. (edes.) Analysis of non mammalian
genomes - a practical guide. Academic Press, New York, pp 75-134.
Rozen S, Skaletsky HJ (2000) Primer3 (v. 0.3.0), Pick primers from a DNA sequence
software. Available at: http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi for
general users and for biologist programmers. In: Bioinformatics Methods and
Protocols: Methods in Molecular Biology (eds Krawetz S, Misener S), Humana Press,
Totowa, NJ, p 365-386.
Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: laboratory manual. 2nd
edition CSHL, Cold Spring Harbor, NY.
Slate J, Marshall T, Pemberton J (2000) A retrospective assessment of the accuracy
of the paternity inference program CERVUS. Molecular Ecology 9: 801–808.
70
Table 1. Nine microsatellite marker loci for Hymenaea courbaril (41 individuals) and H. stigonocarpa (40 individuals), across populations.
Allele size range (bp), annealing temperature (Ta
oC), total number of alleles per locus (A), expected heterozygosity (He), observed heterozygosity (Ho), intrapopulation
fixation index (FIS), paternity exclusion probabilities (Pr(Ex1) and Pr(Ex2)).
H. courbaril H. stigonocarpa Locus
Repeat
Array Primer Sequence (5’ – 3’)
Allele size
range Ta oC
A He Ho FIS Pr(Ex1) Pr(Ex2) A He Ho FIS Pr(Ex1) Pr(Ex2)
Accession
no.
Hc06 (CT)28 F: AACCGAGTCTCCCTCCATCT
R: TGTCACAAGAATAGCAAGGGAG 54-124 60 12 0.85 0.93 -0.095 0.521 0.688 7 0.51 0.26 0.491 0.147 0.317 EU244701
Hc12 (TC)21 F: TGTTCCAATTTATGTCCATGGTT
R: TGGATGGTTGTGAAGAAAAGG 146-214 60 10 0.83 0.67 0.203 0.487 0.659 7 0.69 0.48 0.319 0.264 0.427 EU244702
Hc14 (TC)17 F: CATTCTGCCATCGGTAGGTT
R: TCACCCAAACAGGAGTGAA 121-153 58 8 0.83 0.73 0.121 0.474 0.647 5 0.16 0.15 0.105 0.014 0.088 EU244703
Hc17 (TC)13 F: TGATTTCATTCCCCTCTTGC
R: GGTCAAAGAAAATGCTGGCT 108-130 58 7 0.78 0.48 0.398 0.374 0.608 - - - - - - EU244704
Hc25 (TC)26 F: TGCAATTCGACTTCTTGGTT
R: AAACACCGATTGACATTGTTTT 110-192 58 13 0.90 0.54 0.410 0.229 0.374 - - - - - - EU244705
Hc33 (AG)16 F: GAACAAATCAACTTTCTTTGAAGC
R: TTGACGCTTATTTTGCACCA 108-160 58 8 0.75 0.70 0.055 0.368 0.556 7 0.73 0.50 0.319 0.312 0.486 EU244706
Hc34 (TG)9(AG)12 F: CCAGCCCATGACGAAGT
R: GGTGTCGTGTTGTGTATGGC 186-220 58 13 0.88 0.73 0.170 0.583 0.738 7 0.84 0.42 0.498 0.491 0.663 EU244707
Hc40 (AG)26 F: CCTCTCTCCCAAATTCACGA
R: TGCAATAGAATTTCCGAGGC 155-209 60 13 0.81 0.68 0.162 0.450 0.626 7 0.80 0.48 0.393 0.425 0.606 EU244708
Hc42 (CA)5T(AG)19 F: TGGCTAAAAGTTGGGAGGGT
R: TTCCCCCTTTTCATGTTGTC 115-171 60 13 0.88 0.72 0.183 0.603 0.753 5 0.46 0.42 0.074 0.112 0.270 EU244709
Mean 10.77 0.836 0.687 0.180 0.998 0.99996 6.43 0.601 0.389 0.355 0.889 0.982
71
CONCLUSÕES
1. A seleção e padronização do sequenciamento da região psbC/trnS3 do cpDNA
mostraram-se muito eficientes para os estudos filogeograficos nas espécies H. courbaril e
H. stigonocarpa. A sequência utilizada apresentou altos níveis de polimorfismo intra-
específico, comparados com outras regiões dessa mesma organela, mesmo sendo
analisada apenas pouco mais de 500 pb..
2. A análise filogeográfica de H. stigonocarpa realizada a partir do seqüenciamento da
região intergênica psbC/trnS3 do cpDNA analisada em 175 indivíduos de 17 populações
amostradas no Cerrado mostrou uma subdivisão da distribuição geográfica de suas
populações dentro de três grupos geneticamente diferenciados (leste, central e oeste). Essa
subdivisão pode estar associada com mudanças climáticas e vegetacionais ocorridas dentro
da região durante o Quaternário.
3. Em H. stigonocarpa foram identificados 23 haplótipos, e o nível de diferenciação genética
entre populações foi relativamente alto (FST = 0,692). Os grupos identificados são divididos
longitudinalmente, sendo que o grupo leste é o mais diverso. Os grupos oeste e central têm
haplótipos diretamente ligados aos haplótipos H1 e H2, que ocorrem em grandes
freqüências, indicando um baixo grau de variação nestas populações. O grupo leste exibe
todos haplótipos diretamente ligados ao haplótipo H8.
4. A expansão dos campos subtropicais dentro da região do cerrado pode ter reduzido a
vegetação típica de cerrado, isolando populações e diminuindo o fluxo gênico. Isto pode
explicar a menor diversidade observada nas populações dos grupos oeste e central de H.
stigonocarpa. Por outro lado, as condições climáticas mais amenas (com relativamente altas
temperaturas e umidade) nas porções do norte e leste do cerrado podem ter mantido
grandes populações, retendo uma alta diversidade genética, como observado nas
populações do grupo leste de H. stigonocarpa.
5. A análise de 15 populações de H. courbaril (totalizando 149 indivíduos), utilizando a
mesma seqüência de cpDNA analisada em H. stigonocarpa, identificou 18 haplótipos, três
dos quais são compartilhados com H. stigonocarpa (os mais freqüentes nesta espécie, H1,
H2 e H8). H. courbaril apresenta uma estrutura filogeográfica similar à H. stigonocarpa,
exibindo um agrupamento espacial similar à H. stigonocarpa, embora os três grupos
evidenciados em H. courbaril (nomeados grupos W, C, E) sejam menos distintos
geneticamente que os de H. stigonocarpa.
72
6. A existência dos três grupos espaciais nas duas espécies foi associada com restrição ao
fluxo gênico por sementes e à presença de barreiras geográficas, como a Serra do
Espinhaço e o Espigão Mestre.
7. A AMOVA indicou que as diferenças genéticas entre as duas espécies são responsáveis
por apenas 10,5% da variação genética. A similar estrutura filogeográfica destas duas
espécies de Hymenaea sugere que elas sofreram os mesmos impactos das mudanças
climáticas do Quaternário. As análises filogeográficas sugerem a extinção de populações de
H. courbaril e de H. stigonocarpa na parte sul da área amostrada durante o último glacial
máximo. Depois do re-estabelecimento do clima, as partes ao sul devem ter sido re-
colonizadas por linhagens de populações situadas ao norte e leste da área amostrada.
8. A estutura filogeográfica similar e a pequena divergência genética em relação aos
marcadores de cloraplasto analisados das duas espécies de Hymenaea.sugerem tanto a
hipótese de hibridização ancestral entre elas, quanto a presença de polimorfismo ancestral.
Essas hipóteses poderão ser testadas através da análise comparativa da diversidade e
estrutura genética com outros marcadores, incluindo os de herança biparental e com maior
taxa de mutação do que os de cpDNA.
9. Foram caracterizados nove marcadores de microsatélites para H. courbaril e desses, sete
foram transferidos com sucesso para H. stigonocarpa. Estes marcadores exibem uma maior
taxa de mutação com relação ao cpDNA e herança biparental, o que permitirá determinar a
possível ocorrência de fluxo gênico entre as duas espécies. As análises utilizando esses
marcadores microsatélites vêm sendo realizadas por nosso grupo de trabalho e permitirão
em breve conclusões mais detalhadas e fornecerão maiores informações para a
conservação destas espécies.
73
REFERÊNCIAS BIBLIOGRÁFICAS
Ab’Sáber AN. 1990. Paleoclimas quaternaries e pré-história da América Tropical I. Revista
Brasileira de Biologia 50: 805-820.
Almeida SP, Proença CEB, Sano SM. 1998. Cerrado: Espécies Vegetais Úteis.
EMBRAPA-CPAC, Planaltina.
Avise JC. 1994. Molecular Markers. Natural History and Evolution. Chapman and Hall,
New York.
Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, Neigel JE, Reeb CA, Saunders NC. 1987. Intraspecific phylogeography: the mitochondrial DNA bridge between
population genetics and systematics. Annual Review of Ecology and Systematics 18: 489-
522.
Ayres DR, Ryan, FJ. 1999. Genetic diversity e structure of the narrow endemic Wyethia
reticulata and its congener W. boleeri (Asteraceae) using RAPD and allozyme techiques.
American Journal of botany 86(3): 344-353.
Bawa KS. 1974. Breeding systems of tree species of a lowle tropical community. Evolution
28: 85-92.
Behling H. 1998. Late quaternary vegetational and climatic changes in Brazil. Review of
Paleobotany and Palynology 99: 143-156.
Behling H, Lichte M. 1997. Evidence of dry and cold climatic conditions at glacial times in
tropical southeastern Brazil. Quaternary Research 48: 348-358.
Behling H, Hooghiemstra H. 2001. Neotropical Savanna Environments in Space and Time:
Late Quaternary Interhemispheric Comparison. In: Markraf V. (ed). Interhemispheric
Climate Linkages. Academic Press, New York: 307-323.
Bruneau A, Breteler FJ, Wieringa JJ, Gervais GYF, Forest F. 2000. Phylogenetic
relationships in tribes Macrolobieae and Detarieae as inferred from chloroplast trnL intron
sequences. In: Herendeen PS, Bruneau A. (eds). Advances in Legume Systematics 9:
121–149. Royal Botanic Gardens, Kew.
74
Bulhão CF, Figueiredo PS. 2002. Fenologia de leguminosas arbóreas em uma área de
cerrado marginal no nordeste do Maranhão. Revista Brasileira de Botanica 25, 3: 361-
369.
Bush MB. 1994. Amazonian speciation: a necessarily complex model. Journal of
Biogeography 21: 5-17.
Caron H, Dumas S, Marque G, Messier C, Beou E, Petit RJ, Kremer A. 2000. Spatial and
temporal distribution of chloroplast DNA polymorphism in a tropical tree species.
Molecular Ecology 9: 1089-1098.
Carvalho PER. 1994. Espécies Florestais Brasileiras: Recomendações Silviculturais,
Potencialidades e Uso da Madeira. EMBRAPA-CNPF/SPI, Brasília.
Christiansen MJ, Andersen SB, Oritiz R. 2002. Diversity changes in an intensively bread
wheat germplasm during the 20th century. Molecular Breeding 9: 1-11
Collevatti RG, Grattapaglia D, Hay JD. 2003. Evidences for multiple maternal lineages of
Caryocar brasiliense populations in the Brazilian cerrado based on the analysis of
chloroplast DNA sequences and microsatellite haplotype variation. Molecular Ecology 12:
105-115.
Collinson ME, Bouter MC, Holmes PL. 1993. Magnoliophyta (Angiospermae). In: Benton
MJ. (ed). The fóssil Record, 2. Chapman & Hall, London: 809-841.
Coutinho LM, Pita SM. 1971. Estudo comparativo do teor de alguns nutrientes minerais em
sementes de duas espécies vicariantes de jatobá (Hymenaea stigonocarpa Mart e H.
stibolcarpa Hayne). Revista Brasileira de Biologia 31(3): 357-360.
Crestana CSM, Dias IS, Mariano G. 1985. Ecologia de polinização de Hymenaea
stilbocarpa Hayne, o Jatobá. Silvicultura em São Paulo 17/19: 31-37.
Demesure B, Sodzi N, Petit RJ. 1995. A set of universal primers for amplification of
polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular
Ecology 4: 129-131.
Dumolin-Lapègue S, Demesure B, Fineschi S, Le Corre V, Petit RJ. 1997. Phylogeographic structure of white oaks throughout the European Continent. Genetics
146: 1475-1487.
75
Dutech C, Maggia L, Joly HI. 2000. Chloroplast diversity in Vouacapoua americana
(Caesalpiniaceae), a neotropical forest tree. Molecular Ecology 9: 1427-1432.
Gibbs PE, Oliveira PE, Bianchi MB. 1999. Postzygotic control of selfing in Hymenaea
stigonocarpa (Leguminosae-Caesalpinioideae), a bat-pollinated tree of the Brazilian
Cerrados. International Journal of Plant Sciences 160: 1-7.
Goldstein DB, Schlötterer C. 1999. Microsatellites: Evolution and Application. Oxford
University Press, Oxford.
Goodland RJA. 1979. Análise Ecológica da Vegetação do Cerrado. Ecologia do Cerrado:
61-62.
Hai L, Wagner C, Friedt W. 2007. Quantitative structure analysis of genetic diversity among
spring bread wheats (Triticum aestivum L.) from different geographical regions. Genetica
130: 213-225.
Heithaus E R, Fleming T H, Opler PA 1975. Foraging patterns and resource utilization in
seven species of bats in a seasonal tropical forest. Ecology 56: 841-854.
Herendeen PS, Crepet WL, Dilcher DL. 1992. The fossil history of the Leguminosae:
ohylogenetics and biogeographical implications. In: Herendeen PS, Dilcher DL. (eds).
Advances in legume systematics: part 4, the fossil record. The Royal Botanical Gardens,
Kew: 303-326.
Heringer EP, Barroso GM, Rizzo JA, Rizzini CT. 1976. A Flora do Cerrado In: Ferri MG
(coord.) IV Simpósio sobre o cerrado. São Paulo, Brasil: 211-231.
Heuertz M, Hausman JF, Hardy OJ et al. 2004. Nuclear microsatellites reveal contrasting
patterns of genetic structure between western and southeastern European populations of
the common ash (Fraxinus excelsior L.). Evolution 58: 976–988.
Huang XQ, Börner A, Röder MS, Ganal MW 2002. Assessing genetic diversity of wheat
(Triticum aestivum L.) germplasm using microsatellite markers. Theoretical and Applied
Genetics 105: 699-707
Langenheim JH, Lee Y-T, Martin SS. 1973. An evolutionary and ecological perspective of
Amazonia Hylaea species of Hymenaea (Leguminosae: Caesalpinioideae). Acta
Amazonica 3: 5-38.
76
Lee, Y-T, Langenheim JH. 1975. Systematics of the genus Hymenaea L. (Leguminosae,
Caesalpinioidae, Detarieae). University of California Publications in Botany 69: 1-109.
Lorenzi H. 1992. Árvores Brasileiras. Manual de Identificação e Cultivo de Plantas Arbóreas
Nativas do Brasil. Plantarum Ltda, Nova Udessa, São Paulo.
McCauley DE. 1995. The use of chloroplast DNA polymorphism in studies of gene flow in
plants. Trends in Ecology and Evolution 10: 198-202.
Moraes MLT, Kageyama PY, Sebbenn AM. 2007. Sistema de reprodução em pequenas
populaces fragmentadas e em árvores isoladas de Hymenaea stigonocarpa. Scientia
Forestalis 74: 75-86.
Newton AC, Allnut TR, Gillies ACM, Lowe AJ, Ennos RA. 1999. Molecular
phylogeography, intraspecific variation and the conservation of tree species. Trends
Ecology & Evolution 14: 140-145.
Palmer JD, Stein DB. 1986. Conservation of chloroplast genome structure among vascular
plants. Current Genetics, 10: 823-833.
Parker GD, Fox PN, Langridge P, Chalmers K, Whan B, Ganter PF. 2002. Genetic
diversity within Australian Wheat breeding programs based on molecular and pedigree
data. Euphytica 124: 293–306.
Petit RJ, Pineau E, Demesure B, Bacilieri R, Ducousso A. et al. 1997. Chloroplast DNA
footprints of postglacial recolonization by oaks. Proceedings National Academy of
Sciences 94: 9996–10001.
Petit RJ, Aguinagalde I, de Beaulieu J-L, Bittkau C, Brewer S, Cheddadi R et al. 2003. Glacial refugia: hotspots but not melting pots of genetic diversity. Science 300: 1563-
1565.
Poinar JrGO. 1991. Hymenaea protera sp. N. (Leguminoseae, Caesalpinioideae) from
Dominican amber has African affinities. Experientia 47: 1075-1082.
Poinar JrGO, Brown AE. 2002. Hymenaea mexicana sp. nov. (Leguminosae:
Caesalpinioideae) from Mexican amber indicates Old World connections. Botanical
Journal of the Linnean Society 139: 125-132.
Powell W, Machray G, Provan J. 1996. Polymorphism revealed by simple sequence
repeats. Trends in Plant Science, 1: 215–222.
77
Prance GT. 1992. The phytogeography of savanna species of neotropical
Chrysobalanaceae. In: Furley, P.A., Proctor, J. e Ratter, J.A. (eds), Nature and dynamics
of forest-savanna boundaries. London: Chapman & Hall, 616.
Richardson JE, Pennington RT, Pennington TD, Hollingsworth PM. 2001. Rapid
diversification of a species-rich genus of neotropical rain forest trees. Science 293: 2242-
2245.
Rizzini CT. 1963. A Flora do cerrado In. Simpósio sobre o cerrado. M.G. Ferri (coord.). São
Paulo: 125-177.
Rizzini CT. 1971. Árvores e madeiras úteis do Brasil; Manual de dendrologia brasileira.
Edgard Blucher, São Paulo.
Rizzini CT. 1997. Tratado de Fitogeografia do Brasil: aspecto ecológicos, sociológicos e
florísticos. 2ª Ed. Âmbito Cultural Edições Ltda, Rio de Janeiro.
Rocha DMS. 1988. Estudos filogenéticos de Hymenaea L. baseado em proteínas de
semente. Tese de mestrado. Instituto de Biologia, UNICAMP, Campinas.
Röder MS, Wendehake K, Korzun V, Bredemeijer G, Laborie D, et al. 2002. Construction
and analysis of a microsatellite-based database of European wheat varieties. Theoretical
and Applied Genetics 106: 67–73
Rosseto M, Weaver PK, Dixon KW. 1995. Use of RAPD analysis in devising conservation
strategies for the rare and endangered Grevillea scapigera (Proteceae). Molecular
Ecology, 4: 321-329.
Roussel V, Koenig J, Beckert M, Balfourier F. 2004. Molecular diversity in French bread
wheat accessions related to temporal trends and breeding programmes. Theoretical and
Applied Genetics 108: 920–930.
Roussel V, Leisova L, Exbrayat F, Stehno Z. 2005. SSR allelic diversity changes in 480
European bread wheat varieties released from 1840 to 2000. Theoretical and Applied
Genetics 111: 162–170.
Song B-H, Mitchell-Olds T. 2006. High genetic diversity and population differentiation in
Boechera fecunda, a rare relative of Arabidopsis. Molecular Ecology, 15: 357–369.
78
Song B-H, Clauss M J, Pepper A, Mitchell-Olds T. 2006. Geographic patterns of
microsatellite variation in Boechera stricta, a close relative of Arabidopsis. Molecular
Ecology 15: 357–369
Thomas WW. 1999. Conservation and monographic research on the flora of tropical
America. Biodiversity and Conservation 8: 1007-1015.
Thompson JD. 1999. Population differentiation in Mediterranean plants: insights into
colonization history and the evolution and conservation of endemic species. Heredity 82:
229-236.
Whitmore TC, Prance GT. 1987. Biogeography and Quaternary History in Tropical America.
Clarendon Press, Oxford: 175–196.
Wolfe KH, Li WH, Sharp PM. 1987. Rates of nucleotide substitution vary greatly among
plant mitochondrial, chloroplast and nuclear DNAs. Proceedings of the National Academy
of Science of the USA 84: 9054-9058.
Livros Grátis( http://www.livrosgratis.com.br )
Milhares de Livros para Download: Baixar livros de AdministraçãoBaixar livros de AgronomiaBaixar livros de ArquiteturaBaixar livros de ArtesBaixar livros de AstronomiaBaixar livros de Biologia GeralBaixar livros de Ciência da ComputaçãoBaixar livros de Ciência da InformaçãoBaixar livros de Ciência PolíticaBaixar livros de Ciências da SaúdeBaixar livros de ComunicaçãoBaixar livros do Conselho Nacional de Educação - CNEBaixar livros de Defesa civilBaixar livros de DireitoBaixar livros de Direitos humanosBaixar livros de EconomiaBaixar livros de Economia DomésticaBaixar livros de EducaçãoBaixar livros de Educação - TrânsitoBaixar livros de Educação FísicaBaixar livros de Engenharia AeroespacialBaixar livros de FarmáciaBaixar livros de FilosofiaBaixar livros de FísicaBaixar livros de GeociênciasBaixar livros de GeografiaBaixar livros de HistóriaBaixar livros de Línguas
Baixar livros de LiteraturaBaixar livros de Literatura de CordelBaixar livros de Literatura InfantilBaixar livros de MatemáticaBaixar livros de MedicinaBaixar livros de Medicina VeterináriaBaixar livros de Meio AmbienteBaixar livros de MeteorologiaBaixar Monografias e TCCBaixar livros MultidisciplinarBaixar livros de MúsicaBaixar livros de PsicologiaBaixar livros de QuímicaBaixar livros de Saúde ColetivaBaixar livros de Serviço SocialBaixar livros de SociologiaBaixar livros de TeologiaBaixar livros de TrabalhoBaixar livros de Turismo