TEXTO 6 O CÓDIGO GENÉTICO Biologia Molecular ?· CAT CAG TCA TAC TAT CAT CAT CAT C... Biologia Molecular…

Download TEXTO 6 O CÓDIGO GENÉTICO Biologia Molecular ?· CAT CAG TCA TAC TAT CAT CAT CAT C... Biologia Molecular…

Post on 23-Aug-2018

212 views

Category:

Documents

0 download

TRANSCRIPT

  • TEXTO 6 O CDIGO GENTICO

    Biol

    ogia

    Mol

    ecul

    ar

    O Cdigo GenticoO Sistema de Codificao Gentica

    A Natureza Trplice do CdigoA Decifrao dos Cdons

    Colinearidade entre DNA e PolipeptdeoOs Cdons de PontuaoO Cdigo Gentico Quase UniversalAs Consequncias das Mutaes

    As consequncias das mutaes em microorganismosAs consequncias das mutaes nos organismos pluricelulares

    ExercciosParte A: Revendo Conceitos BsicosParte B: Ligando Conceitos e FatosParte C: Aplicando ConceitosParte D: Resolvendo Problemas

  • 2Biologia Molecular Texto 6 O Cdigo Gentico

    Apresentao

    Se um gene uma sequncia de nucleotdeos no DNA, como essa sequncia pode determinar a ordem dos aminocidos nas protenas? At a dcada de 60, isso foi um mistrio. Nessa poca, no entanto, os bilogos conseguiram a incrvel proeza de decifrar a linguagem da vida, um dos maiores feitos da Biologia do sculo XX. So as principais etapas do trabalho cientfico que culminou com a decifrao do cdigo gentico que estudaremos nesse texto.

    Essa apostila foi organizada pelos docentes do Instituto de Biocincias da USP que ministraram e ministram as disciplinas Biologia Molecular e de Microrganismos, Biologia Molecular e Fundamentos de Biologia Molecular para os cursos de Bacharelado e Licenciatura em Cincias Biolgicas. O texto foi adaptado e compilado de diversos livros didticos e materiais instrucionais.

    O Cdigo Gentico

    O Sistema de Codificao Gentica

    Cdigo gentico o conjunto de regras que governa a relao entre a sequncia de nucleotdeos no DNA e a ordem dos aminocidos nas protenas. nessa relao que reside a essncia da expresso gnica e a decifrao do cdigo gentico foi realmente um importante marco na histria da Biologia.

    Cdigo definido como um sistema de smbolos (letras, nmeros ou palavras) usado para representar um certo significado pr-estabelecido, s vezes secreto. Por exemplo, o cdigo Morse internacional constitudo por pontos, barras e espaos. Para quem no conhece o cdigo, os pontos e barras no tm o menor significado, mas conhecendo-se as regras do cdigo, os pontos e barras podem ser facilmente convertidos em frases.

    O cdigo gentico permite clula converter sequncias de bases do DNA em cadeias polipeptdicas.Existem 20 diferentes aminocidos que devem ser especificados durante o processo de sntese de protenas por

    algum tipo de combinao das quatro diferentes bases existentes no DNA. Quantas bases devem ser utilizadas para construir um cdigo que permita que os 20 aminocidos diferentes sejam especificados?

    Se as palavras desse cdigo tivessem uma base, apenas quatro aminocidos seriam especificados. Um cdigo baseado em conjuntos de duas bases permitiria 16 combinaes diferentes. J um cdigo baseado em trincas de bases permitiria 64 combinaes distintas de bases, o que seria suficiente para determinar os 20 aminocidos. Como os sistemas celulares so geralmente econmicos, um cdigo baseado em quatro letras seria muito improvvel, pois permitiria 256 combinaes diferentes. Assim, um cdigo baseado em trincas seria a situao mais razovel. De fato, atribui-se ao fsico russo George Gamow, por volta de 1954, a proposio de que um cdigo baseado em trs bases seria o mais provvel.

    Contudo, ainda fica a seguinte pergunta: Como so lidas essas trincas? Uma aps a outra ou uma mesma base pode fazer parte de trs trincas adjacentes? Nesta segunda opo diramos que o cdigo sobreposto. (Fig.1)

    Em um cdigo sobreposto, cada base do DNA participaria da codificao de dois ou trs aminocidos. Este tipo de cdigo imporia severas restries sobre as sequncias de aminocidos das protenas. Assim, por exemplo, um aminocido cujo cdigo fosse CAG no poderia ser seguido por um outro cujo cdigo tivesse como primeira base um T ou um C porque, por definio, a primeira base do prximo aminocido teria que ser A ou G, dependendo da extenso da sobreposio.

    Brenner foi o primeiro a propor que o cdigo no era sobreposto, isto , que cada base participaria na codi-ficao de um nico aminocido.

    Tambm devemos considerar que se o cdigo fosse sobreposto, toda vez que uma base fosse alterada na mol-cula do DNA, um, dois ou trs aminocidos seriam alterados na protena mutada. A evidncia gentica, contudo, no falava a favor dessa hiptese. Em estudos sobre mutaes no vrus do mosaico do tabaco (TMV), a substituio

  • 3Biologia Molecular Texto 6 O Cdigo Gentico

    de um nico nucleotdeo no genoma viral resultava geralmente na alterao de um nico aminocido na cpsula protica do vrus, e no na alterao simultaneamente de trs aminocidos, como seria esperado se o nucleotdeo alterado fizesse parte de trs cdons ao mesmo tempo.

    A Natureza Trplice do Cdigo

    Embora um cdigo baseado em trincas fosse o mais adequado nos sistemas biolgicos, apresentar uma evidncia experimental de que isso era real no era uma tarefa trivial na dcada de 60. O trabalho de Benzer sobre mapeamento gentico em fagos foi crucial no desenvolvimento desses experimentos. Benzer estudava mutantes chamados rII do fago T4. Mutantes rII eram capazes de lisar E.coli de uma linhagem B, mas eram incapazes de lisar E. coli das linhagens K. Ele verificou que os fagos com mutao de ponto revertiam muito frequentemente para o tipo selvagem. Ele poderia ter pensado que este fato seria devido reverso da mutao original que resultaria novamente na sequncia de bases do tipo selvagem. Isso verdadeiro para a maioria das reverses, no entanto, mutaes reversas no constituem a nica maneira pela qual indivduos com mutaes de ponto no loco rII podem reverter ao tipo selvagem. Foi verificado que, em alguns casos, os revertidos carregavam uma segunda mutao ocorrida nas proximidades da mutao original. As duas mutaes juntas eram responsveis pela produo de um fentipo selvagem, isto , a segunda mutao suprimia o efeito da primeira e foi, por este fato, denominada mutao supressora. Os fagos que apresentavam as duas mutaes juntas foram apelidados de pseudoselvagens. Mas como Benzer deduziu que os pseudoselvagens eram geneticamente diferentes dos selvagens? Foi verificado que, do cruzamento entre fagos selvagens e pseudoselvagens, resultavam, em elevada frequncia, descendentes que exibiam o gentipo caracterstico dos mutantes rII. Observe na figura 2 abaixo como foi possvel obter mutantes rII por permutao, a partir do cruzamento entre linhagens selvagens e pseudoselvagens.

    Crick e Brenner, em 1961, aproveitaram essas mutaes supressoras para provar que o cdigo gentico era realmente composto por trincas, oito anos aps a idia ter sido proposta. Eles foram capazes tambm de demonstrar que a sequncia de bases do DNA era lida a partir de um determinado ponto, trinca por trinca, de maneira no sobreposta. Isto significava que cada mensagem gentica tinha uma estrutura de leitura fixa que poderia ser alterada pela adio ou remoo de uma nica base. O polipeptdio especificado pela mensagem conteria aminocidos incorretos a partir do ponto em que a base foi adicionada ou removida. Um aspecto que deve ser ressaltado o fato destas mutaes terem sido induzidas por corantes do tipo acridina, que causam insero ou deficincia de bases na sequncia de nucleotdeos do DNA.

    Figura 1. Comparao entre cdigos de trs letras sobreposto e no-sobreposto. No cdigo no-sobreposto, a protena traduzida por cdons que no compartilham nenhum nucleotdeo. J no cdigo sobreposto, cada cdon compartilha um ou mais nucleotdeos, dependendo do grau de sobreposio, com os cdons vizinhos.

    Figura 2. Cruzando-se um fago pseudoselvagem com um selvagem foi possvel obter dois mutantes rII com uma nica mutao cada, FCo e FC7.

  • 4Biologia Molecular Texto 6 O Cdigo Gentico

    Crick e Brenner assumiram que se uma mutao fosse uma insero de apenas uma base no DNA da regio rII (representada por um sinal +), a sua supressora deveria ser uma deleo (representada por sinal -). Assim, se a sequncia de bases do DNA estivesse sendo lida trinca por trinca (da esquerda para a direita), comeando de um ponto determinado, a insero de uma base determina que todas as trincas direita da mutao fossem lidas de maneira diferente do original; esta seria, portanto, uma mutao do tipo mudana do quadro de leitura. Geralmente, isto resultaria num polipeptdeo no funcional. Para compreender melhor os efeitos de uma mutao que afeta o quadro de leitura, observe esta frase em ingls constituda por palavras de apenas trs letras:

    THE FAT CAT ATE THE BIG RAT

    Deletando C: C THE FAT ATA TET HEB IGR AT

    Inserindo A: ATHE FAT ATA ATE THE BIG RAT

    A insero suprime o efeito da deleo pois restaura a fase de leitura. Mas sozinha, uma insero tambm perturbaria completamente o sentido da frase:

    Inserindo A: ATHE FAT CAT AAT ETH EBI GRAT

    Assim, a leitura correta das trincas seria interrompida aps uma mutao (+), sendo, entretanto, restabelecida aps uma mutao (). Se a regio alterada entre as duas mutaes no for crtica, o polipeptdeo pode ser funcional.

    Mutaes supressoras devem estar sempre prximas das mutaes que elas suprimem, uma vez que pouco provvel que um polipeptdeo contendo grande nmero de aminocidos alterados permanea funcional. Caso tivssemos uma segunda mutao de sinal (+), ela no teria suprimido a mutao () e no haveria reverso para o tipo selvagem.

    Considere a seguinte sequncia de bases:

    CAT CAT CAT CAT CAT CAT CAT C...

    a. Note como a insero de uma base altera a sequncia:Insero de um G: G

    CAT CAG TCA TCA TCA TCA TCA TC...

    b. Note como a insero de uma segunda base qualquer mantm a sequncia alterada:Insero de um A: A

    CAT CAG TCA TAC ATC ATC ATC ATC...

    A natureza trplice do cdigo somente foi demonstrada quando foram obtidos mutantes contendo trs mutaes do tipo inseres ou trs deficincias, pois esses mutantes triplos tinham o fentipo selvagem. Este resultado s seria possvel se o cdigo fosse lido em trincas, pois somente neste caso a ordem correta da leitura seria restabelecida aps trs alteraes de mesmo sinal.

    c. Note como a insero de uma terceira base qualquer restabelece a fase de leitura da sequncia original:Insero de um T: T

    CAT CAG TCA TAC TAT CAT CAT CAT C...

  • 5Biologia Molecular Texto 6 O Cdigo Gentico

    Os experimentos revelaram tambm a impossibilidade de apenas 20 dos 64 cdons possveis serem usados para especificar aminocidos. Neste caso, 44 cdons no teriam sentido, isto , no corresponderiam a aminocidos. Se isso fosse verdadeiro, um destes cdons sem sentido deveria muito provavelmente aparecer entre uma insero e sua deficincia supressora, determinando a terminao da cadeia polipeptdica antes que a leitura correta fosse restabelecida. Em outras palavras, estes estudos j sugeriam que, como veremos em breve, o cdigo gentico era degenerado ou redundante.

    Dizer que o cdigo gentico degenerado significa que mais de um tipo de trinca de bases pode determinar o mesmo aminocido na cadeia polipeptdica.

    A Decifrao dos Cdons

    Simultaneamente demonstrao da natureza trplice do cdigo gentico, os cientistas iniciaram a tarefa da decifrao dos cdons. Cdon uma trinca de bases no RNA mensageiro que especifica um aminocido.

    Em 1960, a funo do RNA mensageiro na sntese de protenas foi estabelecida, mas parecia que o cdigo s poderia ser decifrado quando fosse tecnicamente vivel sequenciar todos os aminocidos das protenas e sequenciar todos os nucleotdeos de um gene, comparando-os. Entretanto, em 1961, foi dado o passo fundamental para a decifrao do cdigo. Nos quatro anos seguintes, todo o cdigo foi decifrado em um dos maiores avanos da gentica moderna.

    Marshall W. Niremberg e Heinrich Matthaei demonstraram que uma molcula de RNA mensageiro poderia ser traduzida in vitro. Isso foi feito introduzindo-se um RNA sinttico com sequncias de bases conhecidas em um extrato celular que possibilitava a sntese de protenas. Os constituintes essenciais nesse sistema eram ribosso-mos, RNAts, sintetases do aminoacil-RNAts (enzimas que ligam o aminocido ao RNAt ), ATP e aminocidos. Nesse sistema isento de clulas um RNA sinttico reconhecido como um RNA mensageiro e sua sequncia de bases traduzida em um polipeptdeo.

    O experimento era feito colocando-se um mesmo RNA sinttico em vinte frascos contendo o extrato celular, sendo que em cada um deles foi colocado um tipo de aminocido marcado radioativamente. Aps algum tempo verifica-se em quais dos frascos existem polipeptdeos radioativos. Por exemplo, quando o RNA sinttico usado foi um poli-U, ou seja, um RNA em que todos os nucleotdeos tinham a uracila como base, foram detectados polipeptdeos radioativos apenas no frasco onde havia sido colocada fenilanina radioativa. A concluso foi que a trinca UUU codifica para fenilalanina. Essa foi a primeira trinca identificada por Nirenberg e Mathaei.

    A introduo de poli-C e poli-A produziram polipeptdeos constitudos apenas pelos aminocidos prolina e lisina, respectivamente. A sntese de poli G apresentou problemas e no pode ser testada in vitro.

    Nirenberg, Mathaei e Ochoa produziram, em seguida, RNAs contendo sequncias de duas ou mais bases unidas ao acaso. Foi impossvel prever a sequncia na qual as bases se ligariam e a decifrao precisa dos cdons no pde ser completada. Por exemplo, uma sequncia ao acaso de igual nmero de bases uracila e adenina produziria oito trincas possveis: UUU, UUA, UAA, AAA, AAU, AUU, AUA, UAU em frequncias iguais. Ento, polipeptdeos contendo quantidades iguais de oito aminocidos poderiam ser produzidos neste sistema de sntese de protenas. Os autores prosseguiram com este tipo de anlise diminuindo e aumentando a quantidade de cada uma das bases na mistura, tentando observar se a frequncia dos aminocidos se alterava. Embora isto pudesse dar algumas informaes sobre os cdons desses aminocidos, no era possvel relacionar trincas particulares com os aminocidos.

    Um avano significativo na decifrao do cdigo ocorreu quando Khorana desenvolveu um mtodo para sinte-tizar copolmeros com sequncia conhecida. Ele fazia isso produzindo inicialmente dinucleotdeos com ordenao conhecida, por exemplo, dinucleotdeos UG com o U na extremidade 5 e o G, na 3.

    Inicialmente, a traduo de copolmeros alternativos, tais como, UGUGUGUG revelou que poli UG codificava para valina-cistena-valina-cistena. Da, pode-se concluir que os possveis cdons para valina e cistena eram UGU ou GUG, mas no era possvel ainda concluir qual correspondia a qual aminocido.

    Khorana, a seguir, sintetizou polirribonucleotdeos com trinucleotdeos repetidos, tais como: UUGUUGUUGUUG, os quais codificaram para trs tipos de polipeptdeos: polileucina, policistena e polivalina.

    Em 1964, Niremberg e Leder fizeram uma descoberta que possibilitou a decifrao de todos os cdons. Eles descobriram que a adio de um RNA com apenas trs nucleotdeos (um trinucleotdeo) ao sistema de sntese de protenas resultava na ligao de um tRNA (ligado ao seu aminocido especfico) aos ribossomos. Esses complexos ribossomo-aminocil-tRNA podiam ser separados da mistura de reao por meio de filtrao em filtro de nitrocelulose, ao qual os ribossomos aderem. (Fig. 3)

  • 6Biologia Molecular Texto 6 O Cdigo Gentico

    Diferentes trinucleotdeos foram preparados e, a seguir, foram realizados experimentos de ligao. Cada trinu-cleotdeo foi testado e foi verificado qual aminocido radioativo surgia ligado ao complexo ribossomo-RNAt. Dentro de um ano, os aminocidos tinham sido correlacionados com a maioria dos 64 cdons possveis. Somente os cdons UAA, UAG e UGA permaneceram sem identificao. Mais tarde se demonstrou que essas trincas real-mente no codificam aminocido algum, sendo usadas como sinais de parada (cdons pare). A figura 4 mostra as 64 trincas do cdigo gentico com seus aminocidos correspondentes. Relembre que um cdon uma sequncia de bases no mRNA e no no DNA. O anticdon est contido no RNAt que complementar a cada cdon. (Fig. 4)

    Figura 3. Representao esquemtica do experimento de Nirenberg e Leder, em que se testou a reteno de aminoacil-RNAt, na presena de ribossomos e trinucleotdeos com sequncia de bases conhecida. No exemplo, mostrado que apenas a trinca UCU retm o complexo serina-RNAt (b), o que nenhuma outra das trincas testadas (a e c) ou apenas ribossomos (d) faz. Isso pode ser verificado utilizando-se aminocidos radioativos e medindo a radioatividade retida no filtro aps filtragem da mistura; apenas no frasco b o filtro apresentou radioatividade.

    a b c d

    Figura 4. A tabela do cdigo gentico.

  • 7Biologia Molecular Texto 6 O Cdigo Gentico

    As caractersticas fundamentais do cdigo gentico so mencionadas a seguir.1. O cdigo inequvoco, ou seja, no ambguo: cada cdon corresponde a apenas a um aminocido e

    jamais a mais de um aminocido.2. O cdigo degenerado ou redundante: quase todos os aminocidos tm mais de um cdon: trs tm 6

    cdons possveis, 5 tm 4 cdons, 1 tem 3 e nove tm 2 cdons alternativos. Somente dois aminocidos tm apenas 1 cdon: a metionina e o triptofano.

    3. O cdigo contm 3 cdons para os quais no foram encontrados aminocidos; so eles: UAA, UAG e UGA. Esses cdons foram chamados cdons sem sentido (nonsense cdons). Voc ver mais tarde que eles so de fato cdons de pontuao dando a instruo pare.

    4. Cdons alternativos para um aminocido particular, normalmente, tm bases idnticas nas duas primeiras posies. A exceo bvia para isso quando h 6 cdons possveis para um aminocido, nesse caso quatro dos cdons tm as primeiras bases em comum.

    5. Cdons semelhantes costumam especificar aminocidos semelhantes. Por exemplo, os cdons da treonina diferem dos cdons da serina num nico nucleotdeo na posio 5. De modo semelhante, cdons que tm U na segunda posio codificam para aminocido hidrofbico. Quando esses cdons so alterados, tanto na extremidade 3 como 5, um aminocido hidrofbico ainda incorporado na protena. Devido a essa propriedade do cdigo e tambm sua degenerao, as clulas apresentam uma certa tolerncia a substituies de um nico nucleotdeo que nem sempre levam produo de uma protena no funcional.

    Colinearidade entre DNA e Polipeptdeo

    Comparando-se a sequncia de nucleotdeos de um gene em procariontes com a sequncia de aminocidos em um polipeptdeo, ns podemos afirmar que o gene e a protena so colineares, ou seja, a sequncia de bases do gene corresponde exatamente ordem dos aminocidos na protena. Cada gene representa um trecho contnuo da molcula de DNA e o seu comprimento proporcional ao nmero de aminocidos do polipeptdeo que ele codifica. Um peptdeo com N aminocidos deve ser codificado por um gene que apresenta, no mnimo, 3N nucleotdeos.

    A colinearidade entre o gene e a protena foi inicialmente investigada por Yanofsky atravs de diversas mutaes no gene da enzima sintetase A do triptofano de E. coli. A distncia gentica entre as mutaes foi medida atravs da frequncia de recombinao. A distncia na protena foi medida atravs do nmero de aminocidos separando os stios de substituio de nucleotdeos. Como podemos observar na figura 4, a ordem de diversos stios de mutao distintos corresponde exatamente ordem das substituies dos aminocidos no polipeptdeo. Alm disso, as frequncias de recombinao so proporcionais s distncias entre os aminocidos substitudos na protena. (Fig. 5)

    O mapa de recombinao mostrou outros pontos importantes a respeito da organizao do gene. Diferentes mutaes podem fazer com que um mesmo aminocido selvagem seja substitudo por aminocidos diferentes. Se duas dessas mutaes no se recombinam, elas devem corresponder a substituies diferentes no mesmo nucleotdeo do DNA. Se elas se recombinam, mas afetam o mesmo aminocido, elas devem representar mutaes em posies diferentes no cdon que determina o aminocido alterado.

    Em resumo, o trabalho de Yanofsky no s demonstrou a colinearidade entre a sequncia de trincas e a sequncia de aminocidos especificada por ela, mas tambm demonstrou que um cdon que foi alterado por mutao no meio de um polipeptdeo, frequentemente, resulta na substituio de um aminocido. Uma mutao desse tipo chamada mutao missense (sentido errado) e resulta em um polipeptdeo com um nico aminocido substitudo. Este trabalho tambm mostrou, como proposto por Benzer, que pode ocorrer recombinao entre bases adjacentes. At ento, entendia-se a recombinao somente como a troca de alelos inteiros entre sequncias homlogas, pois os genes eram vistos como unidades indivisveis. Trabalhos dessa natureza evidenciaram que a unidade de recombinao gentica era, de fato, o nucleotdeo, e no o gene.

    Figura 5. Colinearidade entre o mapa gentico de mutaes no gene da sintetase A do triptofano e as posies dos aminocidos trocados na protena dos mutantes

  • 8Biologia Molecular Texto 6 O Cdigo Gentico

    Os Cdons de Pontuao

    Ainda na dcada de 1950, Benzer lanou a sua hiptese de que uma classe de mutao observada por ele em fago T4 e denominada ambivalente era uma mutao do tipo sem sentido (nonsense), o que resultaria em um cdon sem sentido no meio do RNAm, levando ao trmino prematuro da cadeia polipeptdica. Esses mutantes, no entanto, se multiplicavam normalmente em uma linhagem de E. coli denominada K permissiva, apresentando o fentipo selvagem. Benzer imaginou que se o mutante ambivalente rIIa era capaz de crescer na linhagem per-missiva de E. coli K porque essas bactrias conseguiam ler os cdons sem sentido, inserindo um aminocido no ponto correspondente do polipeptdeo. Isto , as linhagens K permissivas conteriam supressores dos cdons sem sentido. Ele imaginou ainda que os supressores dos cdons sem sentido poderiam ser RNAts com uma mutao no anticdon que os tornaria capazes de ler cdons que normalmente no codificam para aminocido.

    Brenner aplicou essa idia para outro grupo de mutantes do fago T4 chamados mutantes mbar e foi capaz de provar que realmente existem cdons sem sentido que interrompem a sntese de polipeptdeos.

    Os mutantes mbar tem mutaes em certos pontos do genoma (um ponto diferente em cada tipo de mutante mbar) que os impedem de crescer em linhagens normais de E. coli. No entanto, esses mutantes se comportam como selvagens quando crescem em linhagens K permissivas.

    Brenner tinha vrios mutantes do tipo mbar que afetavam a sntese do polipeptdeo da cabea do fago. Cruzando esses mutantes entre si, ele construiu um mapa gentico fino da estrutura do gene, estabelecendo a ordem e as distncias entre as mutaes mbar.

    A seguir, ele determinou o tamanho do polipeptdeo da cabea do fago produzido por cada um dos mutantes mbar, quando eles infectavam bactrias no-permissivas. Lembre-se que nas bactrias permissivas os mutantes mbar se comportam como selvagens produzindo polipeptdeos completos da cabea do fago.

    Os mutantes produziram polipeptdeos incompletos, cada um deles com um determinado comprimento. Ao ordenar os mutantes de acordo com o tamanho do polipeptdeo da cabea produzido, Brenner verificou a existncia de uma colinearidade entre esses tamanhos e as posies das mutaes no mapa da estrutura fina do gene. (Fig. 6)

    Esses resultados corroboraram a idia de que as mutaes mbar ocasionam cdons sem sentido que determinam a parada da sntese da protena, resultando em fragmentos do polipeptdeo.

    Brenner analisou as sequncias de aminocidos das extremidades das protenas com trmino prematuro sintetizadas pelos diversos mutantes mbar, e comparou-as com a sequncia de aminocidos da protena sintetizada pelos fagos selvagens. Com isso ele pde deduzir qual o aminocido que deixou de ser adicionado na protena de cada um dos mutantes e que provocou o trmino prematuro da sntese; teriam sido esses cdons que mutaram, originando o suposto cdon sem sentido tpico dos mutantes mbar.

    Figura 6. Colinearidade entre o mapa das mutaes mbar no gene que codifica para o polipeptdeo da cabea do fago T4 e o tamanho dos fragmentos de polipeptdeo produzidos pelos mutantes em bactrias no-permissivas. No topo da figura est apresentada a sequncia das mutaes no gene para o polipeptdeo da cabea do fago. Abaixo, os mutantes foram ordenados de acordo com o comprimento do polipeptdeo por eles produzido, o qual est indicado pela linha direita do nome do mutante.

  • 9Biologia Molecular Texto 6 O Cdigo Gentico

    Nos diversos mutantes, os aminocidos que deixaram de ser adicionados nas protenas mutantes foram glutamina, lisina, cido glutmico, tirosina, triptofano e serina. primeira vista, no havia um padro bvio, mas Brenner deduziu que eles tinham algo em comum; pelo menos um dos cdons codificadores desses aminocidos podia ser obtido da trinca UAG pela substituio de uma nica base. Assim, ele postulou que UAG era o cdon de parada originado nas mutaes mbar; por isso, a trinca UAG tornou-se conhecida como cdon mbar. (Fig. 7)

    Garen trabalhando com um sistema semelhante da fosfatase A de E. coli chegou mesma concluso. Em trabalhos posteriores, Brenner e Garen, trabalhando independentemente, mostraram que UAA era outro cdon sem sentido; essa trinca ficou conhecida como cdon ocre. Finalmente Brenner e Crick identificaram UGA como o terceiro cdon sem sentido, que se tornou conhecido como cdon opala.

    A pergunta seguinte era se os cdons sem sentido identificados em bactria seriam usados normalmente pelos demais organismos para terminar seus polipeptdeos. Em outras palavras, seriam esses cdons sem sentido os usados como cdon pare na extremidade de qualquer RNAm? Isso foi demonstrado, bem mais tarde, pela tcnica de sequenciamento de bases. Hoje no se tem mais dvidas de que realmente aqueles trs cdons so o sinal pare para o trmino das cadeias polipeptdicas. Alm disso, comum se encontrar um ou mais cdons sem sentido na extremidade de um RNAm.

    A descoberta dos cdons de trmino gerou a expectativa de que deveriam tambm existir cdons de nicio da sntese das cadeias polipeptdicas, pois j existiam evidncias de que a sntese de uma cadeia polipeptdica iniciava-se com o aminocido metionina.

    Em 1964, Sanger isolou de E. coli um RNAt ligado a um derivado do aminocido metionina, o N-formilmetionina. Isso foi surpreendente, pois esse derivado tinha um grupo formil unido extremidade amino da molcula do aminocido. Em um polipeptdeo, os aminocidos so conectados entre si atravs de uma ligao chamada peptdica que ocorre entre o grupo amina de um aminocido e o grupo carboxila do seguinte.

    O aminocido N-formilmetionina apresenta o grupo amina bloqueado pelo formil, no podendo, portanto, ser usado para formar uma ligao peptdica com o grupo carboxila de um outro aminocido. No caso, aminocidos s poderiam ser acrescentados na extremidade carboxila do N-formilmetionina. Dessa maneira N-formilmetionina no poderia ocorrer no meio de um polipeptdeo, mas apenas em uma de suas extremidades.

    Figura 7. As substituies de aminocidos que acompanham as reverses do mutante mbar para o tipo selvagem. Os cdons correspondentes esto assinalados.

  • 10Biologia Molecular Texto 6 O Cdigo Gentico

    Estudos realizados com lisozima do fago T4 sugeriram que a N-formilmetionina deveria estar no comeo do polipeptdeo, isso porque havia evidncias de que os aminocidos conectavam-se uns aos outros com seus grupos amina voltados para o incio do polipeptdeo e seus grupos carboxila dirigidos para a sua extremidade final.

    O RNAt ao qual o N-formilmetionina estava ligado continha o anticdon 3 UAC 5, o cdon para N-formilmetionina era, ento, 5 AUG 3, o nico cdon que codifica para metionina.

    Verificou-se que em E. coli havia dois tipos de RNAt que poderiam ligar-se metionina. Ambos continham o mesmo anticdon. Entretanto, quando a metionina estava ligada a um determinado tipo de RNAt com anticdon UAC ela era prontamente formilada por uma enzima presente no sistema, resultando em um RNAt carregado com N-formilmetionina.

    Sanger props, ento, que todos os polipeptdeos iniciam com uma N-formilmetionina e que a traduo de um RNAm sempre comea com um cdon AUG. Entretanto, nem todos os polipeptdeos isolados de E. coli comeam com N-formilmetionina. Isso ficou esclarecido quando se descobriu que em um sistema da sntese de protenas in vitro os polipeptdeos recm-formados tinham N-formilmetionina como primeiro aminocido. Sabe-se, atualmente, que a N-formilmetionina removida aps a formao da protena completa.

    Se ocorrer um cdon AUG no meio de um RNAm vai ser acrescentada metionina para o crescimento da cadeia polipeptdica. A N-formilmetionina no pode ser introduzida pois no tem um grupo amina livre para unir-se ao grupo carboxila do aminocido precedente. Alm disso, o RNAt que usualmente carrega a metionina s responde presena de cdons AUG internos e no ao cdon AUG inicial. O RNAt que carrega a N-formilmetionina diferente do RNAt que carrega metionina ao meio dos polipeptdeos, pois somente ele capaz de reconhecer e se ligar ao ribossomo antes dele estar completamente organizado para prosseguir com o alongamento dos peptdeos.

    Em bactrias, os cdons GUG e UUG tambm podem ser cdons de iniciao da traduo dos polipeptdeos. Embora eles normalmente codifiquem outros aminocidos, quando eles ocorrem no incio eles podem ser reconhecidos pelo RNAt carregado com a N-formilmetionina.

    O Cdigo Gentico Quase Universal

    Os detalhes do cdigo que foram demonstrados pelos experimentos in vitro so verdadeiros in vivo? Eles se aplicam aos organismos superiores, j que todos os trabalhos foram realizados com bactrias e fagos?

    Hoje est largamente demonstrado que o cdigo gentico praticamente universal. Na verdade, a universalidade do cdigo pode ser considerada em diversos nveis. Assim, estudos sobre a sequncia de bases do fago R17 mostraram que AUG realmente o cdon inicial desse vrus e que isso tambm verdadeiro para leveduras e mamferos. As observaes sobre substituio de aminocidos em mutantes de organismos to diferentes como vrus do mosaico do tabaco, levedura e homem so compatveis com o cdigo estabelecido para E. coli.

    Em extratos de E. coli contendo todo o material necessrio para a transcrio e traduo, pde ser sintetizada in vitro a protena do vrus da poliomielite. RNA mensageiro para hemoglobina de coelho, foi traduzido em clulas de sapo, originando hemoglobina de coelho.

    A universalidade do cdigo gentico sugere que ele deve ter sido estabelecido muito cedo na evoluo.As excees universalidade do cdigo so raras e geralmente envolvem cdons de parada. Por exemplo,

    em micoplasma, UGA codifica para triptofano e em certas espcies de ciliados UAA e UAG codificam para glutamina. As principais alteraes do cdigo ocorreram nos DNAs mitocondriais. Isto deve ter sido possvel porque a mitocndria um sistema relativamente fechado, ou seja, RNAs transcritos no ncleo no so traduzidos por ribossomos mitocondriais e vice-versa. A maioria das alteraes envolve os cdons de parada, mas trocas no significado de alguns aminocidos so tambm observadas, como podemos observar na tabela a seguir.

    Tabela 1. Excees ao cdigo gentico universal

    Cdigo Gentico de MitocndriasSignificado na mitocndria

    Cdons Significado padro Mamferos Levedura

    UGA PARE Triptofano Triptofano

    AUA Isoleucina Metionina Metionina

    CUA Leucina Leucina Treonina

    AGA Arginina PARE Arginina

  • 11Biologia Molecular Texto 6 O Cdigo Gentico

    As Consequncias das Mutaes

    Muitas mutaes acarretam mudanas na sequncia de nucleotdeos que no afetam o funcionamento do material gentico dos organismos. Isso ocorre porque so mutaes silenciosas que ocorrem na regio de cdigo dos genes, que ocorrem nos componentes no codificantes dos genes ou porque ocorrem fora dos genes, como estudaremos mais tarde. Em outras palavras, a maior parte dos genomas pode sofrer mutaes sem qualquer efeito significativo no seu funcionamento. J as mutaes em regies codificantes dos genes podem ter maior importncia.

    So as possveis consequncias das mutaes de ponto (substituies) que afetam a sequncia nucleotdica de um cdon:

    a. A substituio pode ser sinnima, isto , o novo cdon especifica o mesmo aminocido do cdon no mutado. A mutao sinnima tambm chamada de mutao silenciosa porque o gene mutado codifica para a mesma protena codificada pelo gene no mutado, por causa da degenerao do cdigo gentico.

    b. A mutao pode ser no sinnima, isto , ela gera um novo cdon que especifica um aminocido diferente. A protena codificada pelo gene mutado ter, portanto, um aminocido diferente. Muitas vezes isto no afeta a atividade biolgica da protena porque estas so capazes de tolerar certas mudanas em sua estrutura sem perda de sua funo. Contudo, algumas alteraes de aminocidos, como, por exemplo, as que ocorrem no stio ativo de uma enzima, tm um impacto maior e podem levar perda de funo da protena. Uma alterao no sinnima tambm chamada de mutao de sentido errado (missense).

    c. A mutao pode converter o cdon que especifica um aminocido em um cdon de parada e por isso chamada de mutao nonsense. Essa mutao sem sentido produz uma protena menor porque a traduo do RNA mensageiro interrompe-se no cdon mutado. O efeito desta mutao sobre a protena depender do que foi perdido. Em geral, mutaes desse tipo resultam em uma protena no funcional.

    d. A mutao pode converter um cdon de trmino de traduo em um cdon que especifica um aminocido. Isto resultar em uma protena com aminocidos adicionais. As protenas poderiam tolerar estas mudanas sem o comprometimento de sua atividade biolgica. No entanto, dependendo do nmero de aminocidos adicionais, isto pode afetar a estrutura tridimensional da protena, afetando sua funo.

    Como j estudamos, inseres e delees tambm podem afetar muito a funo dos genes. Se o nmero de nucleotdeos perdidos ou inseridos for trs (ou mltiplo de trs) um (ou mais cdons) perdido ou adicionado, produzindo efeitos variados sobre a estrutura da protena codificada pelo gene. Se o nmero de nucleotdeos perdidos ou inseridos no for trs ou mltiplo de trs, haver mudana no quadro de leitura (frameshift). Isto significa que todos os cdons a jusante (a 3) da mutao tero um quadro de leitura diferente daquele do gene no mutado. Isto resulta em alterao significativa na estrutura da protena, j que parte do polipeptdeo codificado pelo gene mutado ter uma sequncia de aminocidos diferente da do polipeptdeo codificado pelo gene normal.

    Os efeitos de mutaes que ocorrem em regies no codificantes do genoma so mais difceis de serem previstos. Stios no DNA de ligao a protenas so suscetveis a mutaes de ponto, inseres e delees que podem alterar a sequncia de nucleotdeos envolvidos em interaes DNA-protena. Estas mutaes poderiam inativar promotores ou sequncias reguladoras da expresso gnica. Origens de replicao tambm poderiam perder a funo se as mutaes afetassem stios relevantes para a ligao a outras protenas envolvidas em complexos proticos que participam da replicao do DNA.

    Mutaes tambm podem ocorrer em ntrons ou perto dos limites entre ntrons e xons. Nestas regies, mutaes sero importantes se afetarem nucleotdeos envolvidos em interaes RNA-RNA ou RNA-protena que ocorrem no processo de splicing. Um resultado possvel destas mutaes o de que o intron no seja removido do pr-RNA mensageiro. Consequentemente, isto equivaleria insero de novos cdons, modificando o polipeptdeo traduzido.

  • 12Biologia Molecular Texto 6 O Cdigo Gentico

    As consequncias das mutaes em microorganismos

    Muito do conhecimento sobre gentica molecular que temos hoje resultou de experimentos realizados com microrganismos, principalmente as bactrias. Para se realizar experimentos genticos em microrganismos, importante que estejam disponveis linhagens que apresentam mutaes cujos efeitos fenotpicos sejam facilmente reconhecveis experimentalmente. A maioria das mutaes estudadas em microorganismos pode ser descrita com base nas propriedades de crescimento dos mutantes em diferentes meios de cultura. Assim, eles podem ser enquadrados nas seguintes categorias:

    a. Mutantes auxotrficos crescem apenas quando suplementados com um nutriente que no necessrio para a clula no mutada (prototrfica). Por exemplo, E. coli sintetiza normalmente seu prprio triptofano, graas s enzimas codificadas por cinco genes pertencentes ao operon triptofano. Bactrias que apresentem mutaes nestes genes que levem falta do aminocido sero mutantes auxotrficos. Neste caso, o mutante no sobrevive em um meio de cultura no suplementado com triptofano.

    b. Mutantes letais-condicionais so mutantes que no resistem a determinadas condies de crescimento. Quando crescidos em condies normais (permissivas), eles parecem normais. Entretanto, se transferidos a condies restritivas, seu fentipo anormal se manifesta. Mutantes sensveis temperatura so exemplos tpicos de mutantes letais-condicionais. Eles crescem como clulas selvagens sob temperatura normal mas crescem mal, ou no crescem, quando a temperatura sobe acima de um limiar que pode variar para cada mutante.

    c. Mutantes resistentes a inibidores podem resistir aos efeitos txicos de um antibitico ou de outro inibidor. Em alguns casos, a mutao modifica a estrutura da protena que interage com o inibidor. Neste caso, o inibidor perde sua funo porque j no pode interagir com a protena alvo. Em outros casos, a mutao altera a protena responsvel pelo transporte do inibidor ao interior da clula.

    d. Mutantes de regulao possuem promotores ou outras sequncias reguladoras alteradas. Nesta categoria esto os mutantes constitutivos, aqueles que expressam continuamente genes que, normalmente, esto ativos apenas em certas condies. Esses mutantes sero estudados posteriormente.

    As consequncias das mutaes nos organismos pluricelulares

    O primeiro ponto a ser considerado neste caso refere-se distino entre os casos de mutao que ocorre em uma clula somtica e de mutao que est presente em um gameta. Como a clula somtica no transmitir seu material gentico para os indivduos da prxima gerao, mas somente s clulas-filhas, uma mutao em uma clula somtica importante para o organismo no indivduo em que ela ocorre, isto , ela no tem impacto nas demais geraes. Na verdade, a maioria das mutaes somticas no significativa mesmo que elas produzam a morte celular porque haver um nmero enorme de clulas idnticas no mesmo tecido. Uma exceo seria quando uma mutao afeta uma clula de modo a contribuir, por exemplo, formao de um tumor.

    Mutaes nas clulas que originam os gametas so mais importantes para a espcie, pois elas podem ser transmitidas aos organismos da gerao seguinte e, portanto, podem estar presentes em todas as clulas dos organismos que herdaram a mutao. A maioria das mutaes nos gametas, sejam as silenciosas ou as que ocorrem em regies codificantes, no alterar significativamente o fentipo dos organismos portadores. Mas aquelas que o fazem, podem ser divididas em duas categorias, em funo do efeito que produzem sobre a atividade da protena:

    a. Mutaes de perda de funo: so as que reduzem ou anulam a atividade protica: A maioria dessas mutaes que levam perda de funo so recessivas, j que o heterozigoto portar uma verso no mutada do gene que codifica para uma protena funcional. Desta forma, a verso normal do gene disfara o efeito da mutao. Existem, no entanto, excees nas quais a mutao de perda de funo pode agir como dominante se o produto do gene for realmente necessrio em dose dupla.

    b. Mutaes de ganho de funo: so as que levam expresso de um ou mais genes em tecidos onde eles normalmente no se expressam. Alternativamente, a mutao poderia levar expresso exagerada de um gene, ou ainda expresso de um produto gnico com funes distintas do produto original. Elas so menos comuns que as de perda de funo e elas podem residir em regies reguladoras do gene, e no necessariamente em regies codificantes.

  • 13Biologia Molecular Texto 6 O Cdigo Gentico

    EXERCCIOS

    Parte A: Revendo Conceitos BsicosPreencha os espaos em branco nas frases de 1 a 8 usando o termo abaixo mais apropriado:

    (a) cdon(b) cdons sem sentido(c) cdons sinnimos(d) degenerao(e) mudana de quadro de leitura(f) mutao de sentido errado(g) mutao sem sentido(h) mutao supressora

    1. ( ) a caracterstica do cdigo gentico na qual mais de um cdon pode significar um mesmo aminocido.

    2. Trincas de bases no mRNA que codificam para um mesmo aminocido na cadeia polipeptdica so ( ).

    3. O resultado de mutaes do tipo deleo ou insero de bases, que afeta a leitura de todos os cdon a partir do local onde ela ocorre, chamado ( ).

    4. Uma trinca de bases do mRNA que determina um aminocido no polipeptdeo um(a) ( ).

    5. ( ) uma alterao no DNA que introduz um cdon de parada no mRNA, acarretando a produo de um polipeptdeo mais curto.

    6. Uma alterao no DNA que resulta na substituio de um aminocido no polipeptdeo chamada ( ).

    7. Trincas de bases que no codificam para nenhum aminocido e acarretam a parada da sntese do polipeptdeo so chamadas ( ).

    8. Uma alterao no DNA que compensa os efeitos de outra alterao chamada ( ).

    Parte B: Ligando Conceitos e FatosIndique a alternativa mais apropriada para completar as frases de 9 a 12.9. A primeira demonstrao de que realmente o cdigo gentico era baseado em trincas de bases foi realizada

    a. por Niremberg, que demonstrou que a adio de um RNA com apenas 3 nucleotdeos determinava a ligao de um aminocido especfico ao ribossomo.

    b. por Brenner, Crick e Garen, que mostraram serem trs os cdons de parada.c. por Crick e Brenner, com a demonstrao que mutaes triplas do tipo inseres e delees

    restauravam o quadro de leitura dos cdons. d. por Khorana, que demonstrou o papel de copolmeros alternativos na sntese de protenas.

    10. A decifrao de todos os cdons que determinam aminocidos nos peptdeos s foi possvel em experimentos de sntese de proteinas in vitro em que foram usados RNAm contendoa. um nico tipo de nucleotdeos.b. trinucleotdeos repetidos.c. somente trs ribonucleotdeos.d. variaes na concentrao das diversas bases.

  • 14Biologia Molecular Texto 6 O Cdigo Gentico

    11. Brenner identificou a sequncia exata das bases em um cdon de parada por meio dea. cruzamentos entre mutantes com deficincia e mutantes ambivalentes, que indicavam que o

    mutante ambivalente deveria ter uma mutao que pararia a sntese do polipeptdeo.b. evidncias que indicavam que trs dos cdons jamais especificavam aminocidos em um sistema de

    sntese de protenas in vitro.c. anlises da sequncia de aminocidos dos fragmentos polipeptdicos produzidos por diferentes

    mutantes mbar, comparadas com o selvagem.d. anlises da presena de metionina na extremidade inicial de qualquer protena.

    12. A identificao do cdon de incio da sntese dos polipeptdeos pde ser feita pelo fato dea. todos polipeptdeos bacterianos terem sempre uma N-formilmetionina no seu incio.b. o cdon AUG ainda no ter sido decifrado no cdigo.c. as observaes de Sanger terem mostrado que alguns RNAs trasportadores apareciam ligados

    N-formilmetionina, derivada do aminocido metionina, e que ela no poderia ser incorporada jamais no meio de um polipeptdeo.

    d. um mesmo RNAt poder se ligar metionina ou N-formilmetionina indistintamente.

    Parte C: Aplicando Conceitos13. Suponha que a sequncia de nucleotdeos abaixo corresponda a um pequeno gene. (a cadeia

    complementar que est aqui representada a que serve de molde para transcrever o RNAm).

    5AAATTGATGACAAAGAGTCCATCACTTAATCCCGCCAAATAAACACAG 3

    a. Qual a sequncia de bases no RNAm produzido por este gene? Indique sua polaridade.b. Qual a sequncia de aminocidos no peptdeo codificado?c. Se a molcula de DNA sofrer uma substituio de nucleotdeo, como a representada abaixo, como

    fica o polipeptdeo codificado?

    5AAATTGATGACAAAGAGTCCATCACTTAATCCGGCCAAATAAACACAG 3

    d. Se a molcula de DNA sofrer uma substituio de nucleotdeo, como a representada abaixo, como fica o peptdeo codificado?

    5AAATTGATGACAAAGAGGCCATCACTTAATCCCGCCAAATAAACACAG 3

    e. Se ocorrer a deleo de um nucleotdeo, como a representada abaixo, como fica o polipeptdeo?

    5AAATTGATGACAAA_AGTCCATCACTTAATCCCGCCAAATAAACACAG 3

    f. Na sua opinio, dentre os tipos de mutao representados, qual deve ser o mais deletrio para o funcionamento do peptdeo? Por qu?

    g. Suponha que tenha ocorrido, como representado abaixo, uma deleo de mais dois nucleotdeos alm da indicada no item anterior; como fica o polipeptdeo correspondente?

    5AAATTGATGACAAA_AGTC__TCACTTAATCCCGCCAAATAAACACAG 3

    h. Se a molcula de DNA original sofrer uma substituio de nucleotdeo, como a representada abaixo, como fica o peptdeo codificado?

    5AAATTGATGACAAAGAGTCCATCACTTTATCCCGCCAAATAAACACAG 3

  • 15Biologia Molecular Texto 6 O Cdigo Gentico

    14. Discuta a veracidade da seguinte afirmao: A troca de uma base na molcula de DNA leva obrigatoriamente a uma substituio de aminocido na cadeia polipeptdica. Sua resposta deve contemplar as caractersticas do cdigo gentico, as caractersticas dos genes eucariticos e as caractersticas dos genomas dos organismos eucariticos.

    15. A troca de um nico par de bases em um gene estrutural levou a uma alterao de aminocido na cadeia polipeptdica. Essa alterao vai afetar obrigatoriamente a atividade da protena correspondente?

    Parte D: Resolvendo Problemas16. O efeito de uma nica mutao de ponto sobre a sequncia de aminocidos de uma protena pode

    fornecer uma identificao precisa do cdon usado para especificar um aminocido particular. Assumindo mudana de uma nica base em cada passo, deduza o cdon tipo selvagem em cada um dos seguintes casos:a. Gln Arg Trpb. Gln Lys Ile

    c. TrpValSer

    Leu

    17. Um pesquisador determinou a sequncia de aminocidos de uma regio de uma enzima da bactria E. coli, a qual est representada a seguir:

    - Ala - Pro- Trp - Ser - Glu - Lys - Cys - His...

    Ele dispunha de uma srie de mutantes que no mostravam atividade da referida enzima e conseguiu isolar de trs deles a enzima inativa produzida, tendo obtido os seguintes resultados:

    Mutante 1: -Ala - Pro - Trp - Arg - Glu - Lys - Cys - His...Mutante 2: -Ala - Pro (a protena terminava nesse ponto)Mutante 3: -Ala - Pro - Gly - Val - Lys - Asn - Cys - His...

    Com base nessas informaes responda:a. Qual a natureza molecular de cada mutao?b. Qual a sequncia de bases no DNA que especifica esta parte da protena?

    18. A adio de um nucleotdeo na cadeia de DNA e a deleo de outro a uma distncia de 15 nucleotdeos, causa na protena a seguinte alterao:original =

    ... - Lys - Ser - Pro - Ser - Leu - Asn - Ala - Ala - Lys mutante =

    ... -Lys - Val - His - His - Leu - Met - Ala - Ala - Lys a. Determine as sequncias de nucleotdeos dos RNAm que codificaram essas cadeias de aminocidos.b. Que nucleotdeo foi retirado e qual foi adicionado?

    19. Uma cadeia de DNA de dupla-hlice tem a sequncia de bases representada abaixo e produz in vivo uma cadeia polipeptdica com 5 aminocidos.a. Qual fita do DNA a transcrita para originar o RNA mensageiro?b. Marque as extremidades 5 e 3 de cada uma das fitas.

    TAC ATG ATC ATT TCA CGG AAT TTC TAG CAT GTA

    ATG TAC TAG TAA AGT GCC TTA AAG ATC GTA CAT

Recommended

View more >