Caracterização morfológica e molecular de fungos ... ?· Caracterização morfológica e molecular…

Download Caracterização morfológica e molecular de fungos ... ?· Caracterização morfológica e molecular…

Post on 01-Dec-2018

213 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

<ul><li><p>Hoehnea 41(3): 393-400, 2 tab., 2 fig., 2014</p><p>Caracterizao morfolgica e molecular de fungos micorrzicos arbusculares isolados de reas de minerao de gesso, </p><p>Araripina, PE, Brasil</p><p>Adlia Cavalcanti do Esprito Santo Mergulho1,4, Mrcia Vanusa da Silva2, Maria do Carmo Catanho Pereira de Lyra1, Mrcia do Vale Barreto Figueiredo3, </p><p>Maria Luiza Ribeiro Bastos da Silva1 e Leonor Costa Maia2</p><p>Recebido: 11.10.2013; aceito: 10.02.2014</p><p>ABSTRACT - (Morphological and molecular characterization of arbuscular mycorrhizal fungi isolated from gypsum mining areas, Araripina, Pernambuco State, Brazil). The occurrence of arbuscular mycorrhizal fungi (AMF) in native (AN) and gypsum mining impacted (AI) areas in Araripina, Pernambuco State, Brazil, was determined using as trap cultures sorghum and peanut. The spores were morphologically characterized for identification at species level. DNA was extracted from spores and sequences of the ITS region used for molecular characterization. The molecular study confirmed the identification of three genera and four species (Funneliformis mosseae, Glomus sp., Glomus hoi, Claroideoglomus claroideum) that show ability to support stress conditions. Field work should be carried out to better understand the dynamics and functionality of these AMF species which could be selected for management programs in similar degraded areas.Keywords: diversity, DNA analysis, Mycorrhiza, trap cultures</p><p>RESUMO - (Caracterizao morfolgica e molecular de fungos micorrzicos arbusculares isolados de reas de minerao de gesso, Araripina, PE, Brasil). Foi determinada a ocorrncia de espcies de fungos micorrzicos arbusculares (FMA) em reas nativa (AN) e impactada (AI) pela minerao de gesso em Araripina, PE, Brasil, utilizando como culturas-armadilha: sorgo e amendoim. Os esporos de FMA foram caracterizados morfologicamente para identificao ao nvel de espcie. DNA foi extrado de esporos para caracterizao molecular a partir de sequencias da regio ITS. No estudo molecular foram identificados trs gneros e quatro espcies (Funneliformis mosseae, Glomus sp., Glomus hoi, Claroideoglomus claroideum), que mostram capacidade para tolerar as condies de estresse da rea minerada. Trabalhos em campo devem ser realizados para compreender melhor a dinmica e funcionalidade dessas espcies de FMA que poderiam ser selecionadas para uso em programas de manejo, na recuperao de reas similares.Palavras-chave: anlises de DNA, culturas-armadilha, diversidade, Micorrizas</p><p>1. Instituto Agronmico de Pernambuco, Laboratrio de Genoma, Avenida General San Martin, 1371 Bongi, 50761-000 Recife, PE,Brasil</p><p>2. Universidade Federal de Pernambuco, Departamentos de Bioqumica e Micologia, Avenida Professor Moraes Rego, s/n, CidadeUniversitria, 50670-420 Recife, PE, Brasil</p><p>3. Instituto de Inovao para o Desenvolvimento Rural Sustentvel/Secretaria da Agricultura e Desenvolvimento Agrrio de Alagoas,Rua Cincinato Pinto, 348, 2 andar, Centro, 57.020-050 Macei, AL, Brasil</p><p>4. Autor para correspondncia: adalia.mergulhao@ipa.br</p><p>Introduo</p><p> A regio do Araripe, localizada no serto do Estado de Pernambuco, ocupa rea total de 1.914,4 km2 e tem como principal atividade econmica a indstria do gesso. O chamado polo gesseiro do Araripe possui 40% das reservas de gipsita do mundo e atende a 95% da demanda de gesso do </p><p>mercado nacional. A minerao de gipsita destaca-se pela importncia econmica e social, absorvendo, sobretudo, trabalhadores da regio. Entretanto, esta atividade envolve a retirada da cobertura vegetal, com remoo da camada orgnica do solo, causando grave impacto ambiental (Siqueira et al. 2007), com efeitos negativos sobre os fungos micorrzicos arbusculares (FMA), importantes constituintes da microbiota do solo </p><p>41_3 T06_01_09_2014.indd 393 16/09/2014 10:23:00</p></li><li><p>394 Hoehnea 41(3): 393-400, 2014</p><p>(Melloni et al. 2003). Os FMAs apresentam potencial biotecnolgico na agricultura e sua utilizao na recuperao de reas degradadas fundamental, pois esses fungos tm papel significante em aumentar o estabelecimento e a produtividade de espcies arbreas em regies ridas e semiridas, onde a produtividade da planta limitada devido baixa fertilidade do solo (Rao &amp; Tarafdar 1998). recomendvel tambm empregar isolados de FMAs nativos que possam assegurar o desempenho da associao e com ela o melhor desenvolvimento das espcies vegetais; isso implica em conhecimento bsico das espcies de FMAs presentes na rea de interesse. O estabelecimento, desenvolvimento e manu-teno dos ecossistemas naturais so dependentes da associao micorrzica que propicia, aos vegetais, estratgia nutricional superior de plantas no micorrizadas, favorecendo a sobrevivncia em condies de estresse. Assim, as plantas tambm podem ser beneficiadas em reas degradadas, sendo os FMA recomendados para recuperao de ambientes severamente perturbados (Souza &amp; Silva 1996, Cavalcante et al. 2009). A contribuio dos FMA deve-se principalmente melhoria nutricional da planta hospedeira, em particular os nutrientes de baixa mobilidade na soluo do solo. Assim, a presena de FMA facilita a reciclagem de nutrientes, diminui os efeitos negativos da compactao do solo, promovendo a formao e a estabilidade de agregados (Rillig 2004), melhorando o ambiente, a capacidade invasora, a formao de comunidades vegetais em reas degradadas e a tolerncia ao dficit hdrico, geralmente comum nestas condies (Klauberg-Filho et al. 2005). A identificao de FMA geralmente baseada em caractersticas morfolgicas. Entretanto, os descritores das espcies so baseados na anlise de um nmero limitado de isolados, que apresentam alta similaridade; assim, muitas vezes a anlise de caractersticas morfolgicas ineficiente para a caracterizao ao nvel de espcie (Novais et al. 2010). Estudos moleculares envolvendo o sequenciamento do rDNA (DNA ribossomal) para a pesquisa com FMA tm facilitado a identificao desses fungos e contribudo para expandir o conhecimento sobre a diversidade e distinguir diferenas entre isolados de uma mesma espcie (Avio et al. 2009). Devido importncia ecolgica e econmica dos FMA, imprescindvel a distino entre as espcies para aplicabilidade do seu potencial na agricultura. A utilizao de tcnicas moleculares pode ser til para esclarecer a identidade e variabilidade de FMA em ambientes nativos e degradados.</p><p> Trabalhos sobre a ocorrncia de FMA em ecossistemas impactados no Brasil so escassos, no existindo relatos sobre espcies ocorrentes em reas de minerao de gesso. Conhecer FMA que ocorrem em regies impactadas importante para fornecer informaes sobre espcies tolerantes a essa condio de estresse, as quais podero ser teis em programas de revegetao. Assim, este estudo teve como objetivo determinar a ocorrncia de espcies de FMA em rea impactada por minerao de gesso.</p><p>Material e mtodos</p><p> Foram selecionadas reas de caatinga nativa preservada (AN: considerada como controle) e impactada (AI: rea de interface entre os arredores da mina e o depsito de rejeito) por minerao de gipsita no municpio de Araripina, Estado de Pernambuco (729'00"S e 4036'00"W). A regio apresenta clima semirido mesotrmico, a vegetao predominante caatinga hiperxerfila e o solo do tipo Latossolo vermelho amarelo distrfico (Cavalcanti &amp; Lopes 1994). Para a coleta do solo foi definida uma rea de 1.000 m2, sendo obtidas amostras a cada 10 m, em zig-zag. Em cada rea, 10 amostras compostas de trs subamostras foram obtidas da rizosfera, entre 5 a 20 cm de profundidade. Parte do solo foi encaminhada para o Instituto Agronmico de Pernambuco para anlises fsica, qumica e de fertilidade, e o restante foi usado para as demais anlises (tabela 1). Foram preparadas culturas-armadilha para FMA, com o solo coletado das reas estudadas. O solo foi diludo em areia autoclavada (2:1) e colocado em potes plsticos com capacidade de 1 litro, tendo como plantas hospedeiras o amendoim (Arachis hypogaea L.) e o sorgo granfero (Sorghum bicolor (L.) Moench) cultivar IPA-7301011. Essas duas plantas hospedeiras so micotrficas facultativas, ou seja, necessitam em diferentes graus da associao micorrzica, dependendo da fertilidade do solo. Alm do mais, a utilizao desses hospedeiros favorece a esporulao de espcies com germinao tardia; e o sorgo, alm de suportar condies adversas do solo, apresenta ciclo de vida mais longo que o amendoim (Sieverding 1991). Foram mantidos trs ciclos dessas culturas em casa de vegetao, cada um por cerca de trs meses; durante este perodo, as plantas foram regadas em dias alternados. A temperatura e a umidade relativa do ar foram medidas diariamente, variando de 21 a 35 C e de 31% a 88%, respectivamente. Aps este perodo, esporos de FMA foram extrados do solo por peneiramento mido (Gerdemann &amp; Nicolson 1963) </p><p>41_3 T06_01_09_2014.indd 394 16/09/2014 10:23:00</p></li><li><p>Mergulho et al.: Fungos micorrzicos arbusculares de reas de minerao de gesso 395</p><p>e centrifugao em gua e sacarose a 50% (Jenkins 1964), e selecionados em microscpio estereoscpico. Para caracterizao taxonmica das espcies de FMA foram utilizadas duas abordagens: morfolgica e molecular. Para caracterizao morfolgica, esporos similares foram agrupados, montados em lminas com PVLG ou reagente de Melzer + PVLG (1:1) e observados ao microscpio para identificao ao nvel de espcie (Schenck &amp; Prez 1990, http:/invam.caf.wvu.edu) (figura 1). Para caracterizao molecular, o DNA foi extrado a partir de esporos dos FMA segundo a metodologia de Lanfranco et al. (2001) com algumas modificaes. Cerca de 150 a 200 esporos de cada espcie de FMA foram sonicados (3 a 4 ciclos por 30 segundos), quebrados com ajuda de um micropistilo em 50 L de 1X tampo de reao (LABTRAD do Brasil LTDA) contendo 10 mM Tris-HCl pH 8,3, 50 mM KCl, 1,1 mM MgCl2, incubados a 95 </p><p>OC por 15 minutos e centrifugados a 10.000 g por 5 minutos. O sobrenadante foi estocado a -20 OC. A reao de PCR consistiu em 3 L (20 ng) de DNA de esporos adicionados ao mix para um volume final de 25 L, contendo 10 mM Tris-HCl, pH 8,3, 50 mM KCl, 1,1 mM MgCl2, 10 mM de cada dNTP, 25 nmoles de cada primer ITS1 (5TCCGTAGGTGAACCTGCGG3) e ITS4 (5TCCTCCGCTTATTGATATGC3) (White et al. 1990), e 2 unidades de Taq DNA polimerase (Invitrogen do Brasil) e gua ultrapura para completar o volume da reao. As reaes de amplificao foram efetuadas em termociclador M.J. Research, Inc. (USA) PCR, modelo PTC 100, sob as seguintes condies trmicas: 95 oC por 3 min, 40 ciclos de 95 oC por 45 s, 50 oC por 45 s, 72 oC por 1 min e 72 oC por 5 min. Ao final da reao, o produto foi mantido a -4 oC. Um controle negativo sem DNA foi includo nas amplificaes via PCR. Os fragmentos amplificados e o controle foram separados por eletroforese em gel de agarose 1,5%, em tampo TBE 1X, e corado com </p><p>Sybr Gold (Invitrogen do Brasil), visualizados sob luz ultravioleta e fotografados em fotodocumentador sob luz UV. A reao da PCR para o DNA de cada isolado foi realizada 10 vezes nas mesmas condies para obter a reprodutividade dos dados. Os produtos obtidos por PCR foram purificados e clonados em vetor T/A pCR2.1 TOPO (Invitrogen do Brasil) de acordo com as instrues do fabricante e foram transformados em clulas de Escherichia coli DH5a. As colnias transformadas foram inoculadas em placas de Petri em meio de cultura LB acrescido de 50 mg/L de Kanamicina. Para extrao de DNA plasmidial foi utilizado o mtodo de lise alcalina descrito por Sambrook et al. (1989). As sequncias de nucleotdeos foram determinadas em sequenciador automtico de DNA (ABI PRISM 377 Applied Biosystems, Foster City, Califrnia), utilizando o kit Big Dye Terminator (Applied Biosystems), pelo laboratrio de sequenciamento de DNA do CENARGEN/Braslia, Brasil. As sequncias obtidas foram comparadas no Banco de Dados Genbank (http://www.ncbi.nlm.nih.gov) e RDP (Ribossomal Data Base Project) - Seqmath (http://rdp.cme.msu.edu/). As sequncias da regio ITS foram alinhadas com outras provenientes do NCBI com auxlio do programa ClustalW (Thompson et al. 1999) e, em seguida, construda uma rvore filogentica pelo mtodo Neighbor-Joining (Saitou &amp; Nei 1987) com MEGA 4 (Tamura et al. 2004). A confiabilidade da rvore foi mensurada por anlise de bootstrap com 1.000 replicaes. A classificao adotada segue o Index Fungorum (http://www.indexfungorum.org/), sendo consultados tambm Oehl et al. 2011 e Redecker et al. 2013.</p><p>Resultados e Discusso De acordo com a anlise morfolgica, os isolados de FMA foram identificados como: AM9 - </p><p>reas pH P C Ca Mg K SO4* CO3 HCO3</p><p>Textura (%) MO Fe Dap Dr UR PMP Classe </p><p>textural**H20 mg.dm-3g.Kg-1 cmolc.dm-3 meq.L-1</p><p>Areia Argila Silte (%) mg/dm3 g</p><p>/cm3 (%) 15 AtmNA 6,4 8 1,2 6,20 1,1 0,4 Presena 0,8 5,6 74 8 18 2,1 13,7 1,3 2,6 0,4 4,7 F.A.AI 5,7 14 1,3 36,25 11,2 0,6 FP 0,2 0,8 14 59 27 2,2 79,8 1,1 2,4 8,6 30,6 Argiloso</p><p>Tabela 1. Caractersticas qumicas e fsicas do solo coletado em duas reas de mineradora de gipsita, em Araripina, PE, Brasil. AN: Caatinga nativa preservada; AI: rea de interface entre os arredores da mina e o depsito de rejeito; *FP: Forte presena; **F.A.: Franco arenoso.Table 1. Chemical and physical characteristics of soil collected in two gypsum mining areas in Araripina, Pernambuco State, Brazil. AN: preserved Caatinga; AI: interface between the mine surroundings and the waste deposit; FP: strong presence; **F.A.: Sandy loam soil.</p><p>41_3 T06_01_09_2014.indd 395 16/09/2014 10:23:00</p></li><li><p>396 Hoehnea 41(3): 393-400, 2014</p><p>(figura 1 e tabela 2). Alguns txons de Acaulospora, Gigaspora, Scutellospora e Glomus no foram identificados ao nvel especfico e, provavelmente, constituem espcies ainda no descritas; mais estudos nas reas avaliadas podem propiciar, inclusive, o registro de espcies ainda no conhecidas para a cincia. Aparentemente no existem trabalhos sobre FMAs em reas impactadas por minerao de gesso no Nordeste do Brasil. Vrios autores tm registrado a ocorrncia de espcies de Glomus em reas impactadas (Caproni et al. 2003, Yano-Melo et al. 2003, Silva et al. 2005). Segundo Allen et al. (1995), mesmo em regies consideradas pouco propcias ao crescimento dos FMAs, com altas temperaturas e baixa precipitao, algumas espcies de Acaulospora, Entrophospora, Glomus e Scutellospora possuem ampla distribuio geogrfica. Na rea impactada foi registrada a ocorrncia de Funneliformis mosseae, Rhizophagus intraradices, Claroideoglomus etunicatum e Claroideoglomus claroideum. As espcies de FMAs presentes na rea degradada, cuja estrutura do solo est comprometida pela atividade gesseira, provavelmente utilizaram estratgias de sobrevivncia (persistncia), aumentando o nmero de propgulos no solo, como mecanismo de defesa s condies adversas. Hart et al. (2001) sugeriram que os FMAs utilizam duas estratgias (colonizao e persistncia) para sobreviver em um ambiente. No primeiro caso enquadram-se as espcies mais hbeis em colonizar novos hospedeiros e no segundo, as que conseguem permanecer no sistema (solo/raiz) mesmo em condies adversas. A presena de espcies de FMA no esporulantes pode ser a razo dos baixos registros na rea nativa (AN). difcil separar os fatores mais importantes na interao micorrzica, embora esteja definido que, em campo, as concentraes de propgulos de FMAs so correlacionadas principalmente com as condies de solo (pH, textura, concentrao de nutrientes) e cobertura vegetal (Sieverding 1991). Maia &amp; Trufem (1990) referiram a presena constante de Funneliformis mosseae em coletas no municpio de Araripina, PE. Marinho et al. (2004) registraram a presena de Rhizophagus intraradices e Paraglomus occultum em reas de minerao de bauxita e em floresta primria na Amaznia. A maioria das pesquisas tem demonstrado que a adaptao do fungo ao tipo de solo e s condies edafoclimticas mais determinante do que a especificidade entre fungo e a espcie vegetal (Sieverding 1991). Solos de regies semiridas tm grande diversidade de FMA, mas a identificao de espcies </p><p>Figura 1. Fotomicrografias de fungos micorrzicos arbusculares presentes em reas nativa e impactada por minerao de gesso, Araripina, PE, Brasil. 1. Rhizophagus intraradices, esporos em raiz de amendoim. 2. Rhizophagus intraradices, aspecto geral do esporo. 3. Claroideoglomus etunicatum, aspecto geral do esporo.</p><p>Figure 1. Photomicrographs of arbuscular mycorrhizal fungi found in native and gypsum mining impacted areas, Araripina, Pernambuco State, Brazil. 1. Rhizophagus intraradices, spores in peanut roots. 2. Rhizophagus intraradices, general aspect of a spore. 3. Claroideoglomus etunicatum, general aspect of a spore.</p><p>Funneliformis mosseae (N.C. Schenck &amp; G.S. Sm.) C. Walker &amp; A. Schler, AM11 - Rhizophagus (= Glomus) intraradices (N.C. Schenck &amp; G.S. Sm.) C. Walker &amp; A. Schler, AM23 - Claroideoglomus etunicatum (W.N. Becker &amp; Gerd.) C. Walker &amp; A. Schler e AM25 - Claroideoglomus claroideum (N.C. Schenck &amp; G.S. Sm.) C. Walker &amp; A. Schler </p><p>41_3 T06_01_09_2014.indd 396 16/09/2014 10:23:01</p></li><li><p>Mergulho et al.: Fungos micorrzicos arbusculares de reas de minerao de gesso 397</p><p>obtidas de amostras de campo difcil quando o nmero de esporos baixo, como ocorre em reas impactadas da regio do Araripe. Da a importncia do uso de culturas-armadilha que fornece viso mais ampla da diversidade de espcies em ambientes com alta proporo de FMAs no esporulantes, alm de possibilitar melhor avaliao das espcies indgenas, principalmente em solos de zonas ridas e semiridas (Stutz e Morton 1996). O pH da rea impactada (AI) provavelmente favoreceu o estabelecimento das espcies de FMA nativas da caatinga que normalmente ocorrem em pH mais baixo (5,7) (tabela 1). Souza et al. (2003) verificaram, em rea de caatinga, que a maioria das espcies de Glomeraceae e Acaulosporaceae foi registrada em solos com baixo pH ( 5,8). O aumento do nvel de fsforo (14 mg dm-3) observado na rea impactada (AI) quando comparado ao da rea nativa (AN) (8 mg dm-3) provavelmente influenciou espcies de FMA hbeis em colonizar as razes das plantas hospedeiras. Atributos qumicos como pH, fsforo disponvel e matria orgnica na rea impactada podem ter contribudo para a presena de FMA nesse solo. As caractersticas qumicas </p><p>e fsicas dos solos influenciam a densidade de esporos, a composio de espcies e a distribuio dos FMA, afetando diferentemente o crescimento das plantas (Day et al. 1987). O conhecimento da eficincia e distribuio dos FMA em relao ao pH, em conjunto com outros fatores do solo como nveis de fsforo e alumnio pode contribuir para o sucesso no manejo de solos degradados, onde prevalece a compactao e acidez (Hayman &amp; Tavares 1985). A regio ITS foi sequenciada para melhor anlise da diversidade entre os grupos de isolados de FMA com elevada afinidade filogentica, para que pudessem ser identificados, permitindo assim diferenciar inter e intraespecificamente os isolados de FMA oriundos das reas estudadas (tabela 2 e figura 2). Na tabela 2 encontramos a identificao por anlise morfolgica e molecular a partir da anlise com o Blastn, onde se observa que a identidade dos isolados de FMA em alguns casos no foi confirmada pelas sequncias do GenBank (&lt; 96%), como no caso dos isolados AM11 e AM15. Alm disso, o sequenciamento da regio ITS forneceu subsdio para complementar a identificao por anlise morfolgica. A partir de anlises moleculares, por meio do sequenciamento do </p><p>Figura 2. rvore filogentica baseada em sequncias da regio ITS alinhadas pelo programa ClustalW e modelo de nucleotdeo Tamura-Nei no programa MEGA v.4 dos isolados de FMA (AM6 a AM10 e AM18 a AM20: Funneliformis mosseae, AM11 e AM15: Glomus custos, AM23 e AM26: Glomus hoi, AM25: Claroideoglomus claroideum) obtidos de reas nativa e impactada por minerao de gesso, Araripina, PE, Brasil.</p><p>Figure 2. Phylogenetic tree bas

Recommended

View more >