biologia molecular eduardo rabelo parte 1 correta biologia molecular . eduardo rabelo . parte 1 . 1

Download BIOLOGIA MOLECULAR EDUARDO RABELO PARTE 1 CORRETA BIOLOGIA MOLECULAR . EDUARDO RABELO . PARTE 1 . 1

Post on 16-Feb-2020

0 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

  • 1

    BIOLOGIA MOLECULAR

    EDUARDO RABELO

    PARTE 1

    1. Apesar das diferenças na estrutura das células eucariotas e procariotas, o processo descrito a seguir é semelhante em ambas.

    Em eucariotos, a etapa que ocorre principalmente no núcleo está representada pelo número a) 1. b) 2. c) 3. d) 4. 2. Considere que a base nitrogenada púrica do terceiro códon do RNAm descrito abaixo tenha sido substituída por uma guanina: RNAm AUG UCU AUC GGG UUG= O quadro a seguir mostra alguns códons do RNA mensageiro e os aminoácidos codificados por cada um deles.

    Códon do RNAm Aminoácido AGG arginina AGC serina AUC isoleucina AUG metionina GUC valina GGC glicina

    O novo aminoácido codificado a partir dessa alteração é a) arginina b) metionina c) valina d) serina e) glicina

    3. Observe a figura a seguir:

    Sobre os desenhos no quadro, assinale a alternativa CORRETA. a) O desenho 1 corresponde ao ácido desoxirribonucleico,

    constituído de duas cadeias de nucleotídeos, unidas uma à outra por meio de pontes de hidrogênio.

    b) O desenho 1 corresponde ao ácido ribonucleico, no qual as bolinhas correspondem aos fosfatos, e as linhas internas correspondem às pentoses com suas bases.

    c) O desenho 2 representa a cromatina eucariótica, formada pelo DNA empacotado pelo RNA; esse conjunto de filamentos possui a mesma morfologia para cada elemento.

    d) O desenho 3 mostra uma pentose do tipo desoxirribose, por ter um átomo de hidrogênio a menos em relação à ribose.

    e) O desenho 3 mostra uma base nitrogenada do tipo pirimídica, visto apresentar dois anéis, e irá se ligar à pentose, para formar um nucleotídeo.

    4. Observe o desenho abaixo e assinale a opção INCORRETA:

    a) Os reguladores são sequências de DNA não codificantes,

    que exercem função reguladora da síntese de proteínas, interagindo com os genes ou entre si.

    b) Se o tamanho médio de um gene humano é de 3 mil pares de bases nitrogenadas, o tamanho médio de suas proteínas será de 1 mil aminoácidos.

    c) Os genes A e B são conhecidos como DNA codificantes, pois são responsáveis pela codificação das proteínas de um indivíduo.

    d) O número de tipos de proteínas do corpo de uma pessoa é muito superior ao número de genes que ela possui.

    5. Nos eucariontes, o RNA transcrito a partir de um gene normalmente é chamado de pré-RNAm, pois ele ainda não está pronto para ser traduzido em proteína. O pré-RNAm seria, assim, uma versão ainda não acabada do RNA mensageiro, que precisa ser primeiramente processado no (I) para, em seguida, migrar ao (II). Os íntrons são retirados do pré-RNA por meio de enzimas especiais e, em seguida, os éxons são unidos uns aos outros. O RNAm formado apenas por éxons recém-unidos está pronto para sair do núcleo e ser traduzido pelos (III), resultando na formação de uma proteína.

    SILVA, Jr, Cesar da & SASSON, Sezar. Biologia: volume 3, 8 ed. São Paulo: Saraiva, 2011, p. 58 e 59.

    Considere a sequência de códons a seguir e selecione a alternativa que preenche corretamente (I), (II) e (III) e que

  • 2

    apresenta o número de aminoácidos incorporados à cadeia polipeptídica. CCGAUCUACAUGCGGUCUUCAUCAAAUCGGCCGUAGGUAAAUUCCGUA a) (I) núcleo; (II) citoplasma; (III) polissomos; 13. b) (I) membrana; (II) citoplasma; (III) ribossomos; 16. c) (I) núcleo; (II) citoplasma; (III) retículos endoplasmáticos

    rugosos; 09. d) (I) núcleo; (II) citoplasma; (III) ribossomos; 08. e) (I) citoplasma; (II) núcleo; (III) retículo endoplasmático; 04. 6. Em certa espécie animal a proporção de nucleotídeos Timina na molécula de DNA é igual a t 0.> Então, a proporção de nucleotídeos Citosina nesse mesmo DNA é igual a a) 1 t.− b) t 2. c) 1 t 2.− d) 1 2 t.− 7. Observe a figura abaixo, que ilustra os diferentes modelos propostos para a replicação do DNA.

    O experimento de Meselson e Stahl, realizado em 1957, comprovou que o modelo correto para a replicação do DNA é o a) I, porque a dupla-hélice original não contribui com a nova

    dupla-hélice. b) I, porque, na replicação dispersiva, a densidade do novo

    DNA é a metade da densidade do DNA original. c) II, porque a dupla-hélice original é preservada, e uma

    nova molécula é gerada. d) III, porque cada nova molécula de DNA contém uma fita

    nova e uma antiga completas. e) III, porque, na replicação semiconservativa, uma das fitas

    do DNA original é degradada. 8. “Nasce 1º bebê do mundo com DNA de 3 pais” “Cientistas americanos anunciaram o nascimento do primeiro bebê do mundo por meio de uma técnica de reprodução assistida que usa o DNA de três pessoas: do pai, da mãe e de um terceiro doador. De acordo com um artigo publicado na revista científica New Scientist, a polêmica técnica permite progenitores com mutações genéticas raras a conceberem filhos sãos. Usada para prevenir doenças mitocondriais provocadas por defeitos genéticos transmitidos pela mãe.”

    (Adaptado de Veja, Ciência e Saúde: http://veja.abril.com.br/saude/nasce-1o-bebe-do-mundo-

    com-dna-de-3-pais/) A chamada da notícia acima se refere ao DNA de três pessoas porque: a) Houve recombinação entre o DNA das três pessoas. b) A doadora tinha DNA compatível com a mãe receptora. c) Não há presença de DNA na mitocôndria da doadora,

    apenas no núcleo do ovócito.

    d) Houve fecundação do Ovócito da mãe e depois aproveitamento do RNA.

    e) Há presença de DNA na mitocôndria da doadora. 9. A reação em cadeia da polimerase (PCR, na sigla em inglês) é uma técnica de biologia molecular que permite replicação in vitro do DNA de forma rápida. Essa técnica surgiu na década de 1980 e permitiu avanços científicos em todas as áreas de investigação genômica. A dupla hélice é estabilizada por ligações de hidrogênio, duas entre as bases adenina (A) e timina (T) e três entre as bases guanina (G) e citosina (C). Inicialmente, para que o DNA possa ser replicado, a dupla hélice precisa ser totalmente desnaturada (desenrolada) pelo aumento da temperatura, quando são desfeitas as ligações de hidrogênio entre as diferentes bases nitrogenadas. Qual dos segmentos de DNA será o primeiro a desnaturar totalmente durante o aumento da temperatura na reação de PCR?

    a)

    b)

    c)

    d)

    e) 10. Nas células ocorrem reações químicas para a síntese de moléculas orgânicas necessárias à própria célula e ao organismo. A figura mostra a reação química de formação de uma estrutura molecular maior a partir da união de três outras moléculas menores.

  • 3

    Esta reação química ocorre no interior da célula durante a a) formação dos nucleotídeos. b) tradução do RNA mensageiro. c) formação dos triglicerídeos. d) transcrição do DNA. e) síntese dos polissacarídeos. 11. Em 1950, Erwin Chargaff e colaboradores estudavam a composição química do DNA e observaram que a quantidade de adenina (A) é igual à de timina (T), e a quantidade de guanina (G) é igual à de citosina (C) na grande maioria das duplas fitas de DNA. Em outras palavras, esses cientistas descobriram que o total de purinas (A+G) e o total de pirimidinas (C+T) eram iguais. Um professor trabalhou esses conceitos em sala de aula e apresentou como exemplo uma fita simples de DNA com 20 adeninas, 25 timinas, 30 guaninas e 25 citosinas. Qual a quantidade de cada um dos nucleotídeos, quando considerada a dupla fita de DNA formada pela fita simples exemplificada pelo professor? a) Adenina: 20; Timina: 25; Guanina: 25; Citosina: 30. b) Adenina: 25; Timina: 20; Guanina: 45; Citosina: 45. c) Adenina: 45; Timina: 45; Guanina: 55; Citosina: 55. d) Adenina: 50; Timina: 50; Guanina: 50; Citosina: 50. e) Adenina: 55; Timina: 55; Guanina: 45; Citosina: 45. 12. O ácido desoxirribonucleico (DNA) possui o código da hereditariedade e apresenta a informação para a produção de proteínas. Se um filamento de DNA apresenta a sequência de bases nitrogenadas ATACGCGAT, qual é a sequência do filamento complementar? a) TATGCGCTA b) ATACGCGAT c) UAUGCGCUA d) TUTGCGCTU e) TATGGGCTA 13. O DNA é uma molécula com potencial replicativo semiconservativo e, diante dessa informação, 50 moléculas desse ácido nucleico foram marcadas com timina radioativa e posteriormente transferidas para um meio sem esse isótopo e com condições necessárias para a sua replicação. Após três duplicações consecutivas, o número de DNAs que ainda apresentarão esse marcador radioativo é a) 50 b) 100 c) 150 d) 400 e) nenhum 14. Um trecho de uma das cadeias da molécula de DNA tem a seguinte sequência de bases nitrogenadas:

    ACATAGCCAAAA Abaixo, temos os códons correspondentes a quatro aminoácidos:

    Aminoácido Códons Cisteína UGU, UGC Fenilalanina UUU, UUC Glicina GGU, GGC, CGA, GGG Isoleucina AUU, AUC

    Suponha que, em um caso de mutação, a terceira base daquele trecho de DNA, que se encontra sublinhada (A), seja substituída pela base Guanina. Essa nova situação