aula2 padroes de biodiversidade e conservacao

Download Aula2 Padroes de Biodiversidade e Conservacao

Post on 31-Dec-2015

9 views

Category:

Documents

2 download

Embed Size (px)

TRANSCRIPT

  • 1Padres de biodiversidade e conservao

    - Nveis de biodiversidade- Distribuio da biodiversidade: pases megadiversos, hotspots.- Importncia da biodiversidade: valores econmicos e ticos

    Importante: biodiversidade, bens e servios distribudos de maneiras distintas nos Pases, o que significa recursos estratgicos conservao.

    Costanza et al., 1997. The value of the worlds ecosystem services and natural capital. Nature, 387:253-260.

    Valores do comrcio de animais silvestres

    CPI-2003: Comisso Parlamentar de Inqurito destinada a Investigar o Trfico Ilegal de Animais e Plantas Silvestres da Fauna e da Flora Brasileira - CPITRAFI

    Rede Nacional de Combate ao Trfico de Animais Silvestres - RENCTAS

    - veneno da jararaca (Bothrops spp.): US$ 433/g-veneno da coral verdadeira (Micrurus spp.): US$ 31.300/g-3 meses de procura pela internet: 4892 anncios de venda de animais silvestres-trfico de animais silvestres: 3a maior atividade ilcita do mundo (trfico de armas e drogas)- movimento mundial entre US$ 10 e 20 bilhes/ano (15% referente ao Brasil (US$ 1,5 a 3 bilhes/ano)

    Anodorynchus hyacinthinus:US$ 7.300 (6.000-9.000)

    Wright, T.F. et al. 2000. Nest poaching in neotropical parrots. Conservation Biology, 15: 710-720

    Amazona aestiva: US$ 711(350-900)

    Valores do comrcio de animais silvestres

    Ara ararauna: US$ 878(600-1.400)

    www.upload.wikimedia.org

    www.damisela.com

    www.damisela.com

    Biodiversidade: valor

    Valor de uso direto: produtos usados pelas pessoas

    A. valor de consumo: produtos so utilizados diretamente e localmente por pessoas (madeira, frutas, caa e pesca)

    B. valor de produo: h comercializao dos produtos (carne, vegetais, carvo)

    frutos

    www2.ba.sebrae.com.br madeira

    www.clubedasemente.org.br

    pescahttp://peruhotel.com

  • 2Valor de uso indireto: benefcios providos pela natureza no envolvem uma extrao direta.

    Biodiversidade: valor

    qualidade da gua

    qualidade do ar

    proteo do solo

    pesquisa cientficarecreao

    R.A. Mauro

    Biodiversidade: valor

    valor de opo: possveis benefcios para o homem (opo futura)

    novas drogas

    fontes de alimento

    recursos genticos

    M. Krause

    Biodiversidade: valor

    www.juarezsilva.com.br

    Pode ser utilizada como recurso para se implantar reas de conservao

    valor de existncia: a simples presena de uma espcie pode ser um atrativo e as pessoas pagam para ver essa espcie

    www.csz-scz.ca

    Estimativas variam de 2 milhes a 100 milhes, geralmente 10 milhes, das quais aproximadamente 1,8 milho so descritas.

    Quantas espcies existem?

    Primack, R.B. 2002. Essentials of Conservation Biology.

    Brasil

    Biodiversidade conhecidano Brasil: entre 170 e 210 mil espcies.

    Biodiversidade estimadano Brasil: entre 1,4 a 2,4 milhes de espcies.

    Lewinsohn, T.M. & Prado, P.I. 2005. How many species are there in Brazil? Conservation Biology, 19: 619-624.

    Avaliaes de conservao global requerem informaes sobre a distribuio da biodiversidade no planeta.

  • 3www.reef-rainforest.com

    Como e onde essasespcies estodistribudas?

    Diferentes escalasde abordagem

    - espcies- populaes- comunidades-ecossistemas

    www.gonomad.com

    http://www.u.arizona.edu/~elg

    Diversidade gentica nas populaes

    ATTCGAGCTAGGAACCCTAGC

    ATTCGTGCTAGGAACCCTAGA

    ATTCGAGCTAGGAACCCAAGC

    ATCCGAGAGAGGAACCCTAGC

    Nveis de diversidade

    http://www.ramsar.org

    www.gonomad.com

    Nveis de diversidade

    Diversidade de comunidadese ecossistemas vermes terrestres - Europa aves Regio Neotropical

    morcegos - Peru rvores - frica

    Embora a variao biolgica possa ser distinguida em vrias escalas (genes at ecossistemas), a maioria das anlises de variao espacial em relao biodiversidade mensurada atravs da riqueza de espcies (nmero de espcies em dada rea). Gaston, K.J. 2000. Global patterns in biodiversity. Nature, 405:220-227

    riqueza de espcies DiversidadeDiversidade (diversidade alfa): nmero de espcies (riqueza) em uma rea limitada com habitat relativamente uniforme (depende dos limites da comunidade, do esforo amostral). Ex: diversidade de organismos de uma mata de galeria.

    Diversidade (diversidade beta): relacionada diferena ou substituio de espcies de um habitat para outro dentro da mesma regio. Quanto maior a diferena de espcies entre habitats, maior ser a diversidade beta.

    Diversidade (diversidade gama): nmero de espcies observadas em todos os habitats de uma regio (rea geogrfica sem barreiras ntidas de disperso dos organismos; a definio depende dos organismos em questo). Ex: diversidade de organismos do Cerrado.

  • 4CONSERVAO DE ESPCIES E POPULAES

    Por que no grandes reas ou ecossistemas?

    o perigo de extino to acentuado que h a necessidade de uma interveno em nveis mais baixos dessa escala, normalmente espcies e populaes.

    Uma vez que espcies ameaadas podem consistir de poucas populaes ou apenas uma nica populao, a proteo das populaes fundamental para preservar as espcies. Freqentemente so esses remanescentes de pequenas populaes que so alvo de programas de esforos de conservao.

    www.zoologico.sp.gov.br

    qual o tamanho das reas?

    Conservao: quem, onde, como?

    quantos animais devem ser mantidos para uma populao ser vivel ao longo do tempo?

    quais espcies merecem prioridade para se efetuar planos de manejo?

    quais reas devem ser preservadas em uma paisagem?

    espcies com distribuio geogrfica pequena ou que ocorrem em uma regio com forte presso antrpica (ex: Mata Atlntica)

    espcies com apenas uma ou poucas populaes (o que pode estar ligado categoria anterior)

    Bothrops insulariswww.bioterium.com

    www.satelsol.com.br

    www.brazadv.com

    Amazona brasiliensis

    espcies com populao em declnio

    espcies com baixa densidade demogrfica

    espcies que necessitam grandes reas (ex: felinos, gavies: carnvoros; grandes herbvoros que necessitam extensas reas de pastagem)

    www.juarezsilva.com.br

    www.csz-scz.ca

    grande tamanho corpreo

    baixa capacidade de disperso

    www.terraambiente.org

    www.iisgp.org

  • 5pouca variabilidade gentica

    requerimentos especializados (hbitat, alimentao)

    www.mbgenet.mobot.org

    www.kostich.com

    espcies que dependem de contato ou que vivem em bando

    espcies migratrias que necessitam de ambiente favorvel durante a chegada rea reprodutiva

    www.csi.whalesalive.org

    www.farsideafrica.com

    Assim, as espcies que apresentarem algumas dessas caractersticas podem ser

    alvo de estratgias de conservao.

    taxa de recrutamento lenta

    www.zoltantakacs.com

    fatores intrnsecos ou de histria evolutiva

    fatores determinsticos (comrcio ilegal, superexplorao, fragmentao ambiental)

    processo de declnio sem condies de volta:vrtice de extino

    +

    www.cs.brown.edu

    Populaes afetadas por desmatamentos, poluio, caa, animais domsticos, introduo de espcies exticas

    Reduo no tamanho da populao

    Diminui ainda mais o tamanho da

    populao

    Aumento do risco de extino

    Uma vez estabelecido o tamanho da populao, estima-se o tamanho mnimo da rea necessria para abrigar a populao.

    Quantos?

    Populao Mnima Vivel (PMV; ou Minimum ViablePopulation: MVP):menor populao, isolada, tendo a probabilidade de 95%a 99% de sobrevivncia pelos prximos 100 a 1000 anos, independentemente de fatores intrnsecos ou extrnsecos.

    Nota-se para isso que h grande necessidade de conhecimento de aspectos demogrficos e de rea de vida: HISTRIA NATURAL.

  • 6www.wildthingsphotography.com

    Anlise de Viabilidade Populacional (AVP; ou Population ViabilityAnalysis, PVA):requerimentos das espcies em seu hbitat a fim de identificar pontos vulnerveis ao longo do tempo

    Exemplo: Orcinus orca (Orca)

    Taylor, M. & Plater, B. 2001. Population viability analysis for the southern resident population of the Killer Whale (Orcinusorca). Center for Biological Diversity Tucson, Arizona.

    www.bay13.net

    www.seaworld.org

    Problemas prticos: muitas vezes impossvel abrigar os animais simplesmente porque h poucas reas ou as reas disponveis no tm tamanho suficiente

    Oliveira, T.G. 1994. Neotropical cats: ecology andconservation. EDUFMA

    quanto mais: melhorQuantos?

    quanto mais indivduos maior o tempo de persistncia da populao

    Ovis canadensis

    www.museum.utep.edu

    Quase todas as populaes com mais de 100 indivduos persistem por mais tempo enquanto populaes < 50 animais tendem a desaparecer

    quanto mais indivduos, maior a variabilidade gentica da populao.

    maior a probabilidade de adaptao.

    www.csus.edu

    Kohlmann, S.G., Schmidt, G.A. & Garcelon, D.K. 2005. A population viability analysis for the IslandFox on Santa Catalina Island, California. EcologicalModelling, 183:77-94.

    Urocyon littoralis

    populao pequena aumento das taxas de endocruzamento (inbreeding)

    diminui a variabilidade genticadiminui chance de sobrevivncia ao longo do tempo

    A

    B

    Kruuk, L.E.B., Sheldon, B.C. &Merila, J. 2002. Severe inbreedingdepression in collared fycatchers (Ficedula albicollis). Proc. R. Soc. Lond. B 269:1581-1589.

    Efeito do inbreeding sobre aspectos adaptativos de tirandeo. A: taxa de ecloso; B: taxa de sobrevivncia de animais jovens.f = 0 (no-inbreeding); 0 < f < 0,25 (inbreedingmoderado); f = 0,25 (inbreeding entre parentes prximos). n = nmero de ninhadas

    www.hlasek.com

    Ficedula albicollis

  • 7Isso tudo pode ocasionar o VRTICE DE EXTINO

    Reduo no tamanho da populao

    Diminui ainda mais o tamanho da

    populao