assam journal of internal medic ine june, …assam journal of internal medic ine june, 2012 voi. 2...

1ASSAM JOURNAL OF INTERNAL MEDICINE JUNE, 2012 VOI. 2 ISSUE 3

EDITOR : PROF. SANJEEB KAKATI

Editor : Prof. Sanjeeb Kakati

Associate Editors : Prof. Swaroop Baruah, Prof. Anup Kr. Das

Assistant Editors : Prof. Ardhendu Kr. Sen, Dr. Saurabh Buragohain, Dr. Sreemanta Madhab Baruah

Members : Dr. Atul Ch. Saikia, Dr. B. N. Mahanta, Dr. Manash Roy, Dr. Abdul Ahad,Dr. P. K. Baruah, Dr. Anup Kr. Barman, Dr. Dwijen Das, Dr. D. Mili,Dr. Madhab Mishra

Advisors : Prof. D. C. Borkotokey, Prof. P. C. Bhattacharyya, Prof. M. Nath,Prof. R. P. Medhi, Prof. B. Doley, Prof. G. N. Gogoi, Prof. B. P. Chakrabarty,Prof. A. K. Adhikary, Prof. R. K. Kotokey, Prof. D. J. Borah, Prof. G. Kar

Copyright and Photocopying :No part of this publication may be reproduced, ortransmitted in any form or by any means, electronic ormechanical, including photocopy without writtenpermission from the Hon. Editor.

Business Correspondence :Enquiries concerning subscription, advertisement, etc.should be addressed to Prof. Sanjeeb Kakati, Hon. Editor,Assam Journal of Internal Medicine, Department ofMedicine, Assam Medical College, Dibrugarh, Assam,India. PIN-786002 Mobile : 9435030173,E-mail : [email protected]

Edited, printed and published by :Prof. Sanjeeb Kakati, for the Association of Physiciansof India, Assam Chapter.The Editor disclaims any responsibility or liability forstatements made and opinion expressed by authors orclaims made by advertisers.Advertorial Enquiry :Prof. Sanjeeb Kakati, Hon. Editor, Assam Journal ofInternal Medicine, Department of Medicine, AssamMedical College, Dibrugarh, Assam, India. PIN-786002Mobile : 9435030173E-mail : [email protected] at : P. C. Printsoft, Dibrugarh, Assam.

BIANNUAL PUBLICATION – JULY (Next issue- January,2013)

ASSAM JOURNAL OF INTERNAL MEDICINE

EDITORIAL BOARD

Official Journal of Association of Physicians of India, Assam Chapter

ASSAM CHAPTER


DIBRUGARH BRANCH President : Dr. Sanjeeb KakatiHon. Secretary : Dr. Prasanta Dihingia

GUWAHATI BRANCH President : Dr. B. P. ChakrabortyHon. Secretary : Dr. Sangit Dutta

TEZPUR BRANCH President : Dr. H. S. A. BoraHon. Secretary : Dr. Bhabani Bhuyan

SILCHAR BRANCH President : Dr. G. K. ChakrabortyHon. Secretary : Dr. Giridhari Kar

JORHAT BRANCH President : Dr. N. N. GoswamiHon. Secretary : Dr. P. K. Nath

GOLAGHAT BRANCH President : Dr. Kamaleswar NeogHon. Secretary : Dr. Gakul Khandelwal

N. LAKHIMPUR President : Dr. Ananda DehingiaHon. Secretary : Dr. Khagen Das

SIBSAGAR BRANCH President : Dr. Ripun BorpuzariHon. Secretary : Dr. Nitya Gogoi

TINSUKIA BRANCH President : Dr. P. K. BhattacharyaHon. Secretary : Dr. Madhav Misra

NAGAON BRANCH President : Dr. Birinchi Kr. BoraHon. Secretary : Dr. Sarat Keot

Immediate Past President : Dr. Pramatheswar Barooah, TezpurPresident : Dr. G. N. Gogoi, DibrugarhVice-President : Dr. S. Baruah, GuwahatiHon. General Secretary : Dr. Atul Ch. Saikia , TezpurHon. Secretary (Headquarter) : Dr. B. N. Mahanta, DibrugarhHon. Joint Secretary : Dr. Nitya Gogoi, SibsagarHon. Treasurer : Dr. D. C. Borbora, GuwahatiExecutive Body Members : Dr. Madhav Mishra, Tinsukia

Dr. P. K. Saikia, DigboiDr. H. S. A. Bora TezpurDr. Gakul Khandelwal, GolaghatDr. Giridhari Kar, Silchar

OFFICE BEARERS OF THE ASSOCIATION OF PHYSICIANSOF INDIA, ASSAM CHAPTER

ASSOCIATION OF PHYSICIANS OF INDIA, ASSAM CHAPTERDISTRICT BRANCHES


C O N T E N T S

Official Journal of Association of Physicians of India, Assam ChapterEDITOR : PROF. SANJEEB KAKATI

EDITORIALPercutaneous Coronary Intervention inAcute Myocardial InfarctionSanjeeb Kakati

ORIGINAL ARTICLEPrimary Percutaneous CoronaryIntervention in Acute ST-ElevationMyocardial Infarction – A single centreexperienceD K Baruah, N K Panigrahi, D J Raju

Molecular Typing and Evolutionary Analysisof Haemophilus Influenzae Isolated in DelhiK K Saikia, B K Das, N K Arora,P Chandra

A Study of Sputum Culture and Sensitivityin Cases of Community AcquiredPneumonia in BarpetaA Dutta, M Kataki, B Dutta,B Das Pathak

Hypertension the “Iceberg Phenomenon”Accidental Detection of Hypertensionamong the OPD Attendance in AMCHS M Baruah, B S Sangma

ASSAM JOURNAL OF INTERNAL MEDICINE

REVIEW ARTICLEMultivessel Angioplasty Versus CABG Surgeryin CAD – An Evidence Based PerspectiveT Ghose, A Hussain

CASE REPORTAn Unusual Case of Pyoderma GangrenosumFollowing Surgery for AppendicitisK Chakravarty, S O’Rourke, S Parnell

Percutaneous Transcatheter Technique usingSeptal Occluder Device, an AcceptedAlternative to Surgery for Treatment ofOstium Secundum ASD’s, a case report fromour Initial ExperienceP J Bhattacharyya, A K Bhattacharyya

Pulmonary Endometriosis : A Case ReportN B Boruah, A M Boruah, J N Sarmabordoloi

A Case of Tuberous Sclerosis Presenting withChildhood SeizuresP Bhattacharjee, P Das, B K Nath, A Kalwar

CORRESPONDENCEMelioidosisAnirban MahantaMarami DasMunindra GoswamiA K Kayal

5

7

11

15

22

26

30

34

39

41

43


Acute myocardial infarction is the commonest formof coronary heart disease to be one of the leading causeof death worldwide.(1) One third of the myocardialinfarction is associated with ST elevation. If appropriatemedical service is not provided on time 25% of the AMIcases will die. Data from USA depicts excellent outcomein terms of reduction in mortality amongst the patients whoreceived medical care on time, especially with the STelevated myocardial infarction.(2,3) Mortality rate is 5.7%in those cases who received in hospital reperfusion therapy,in comparison to those who were eligible for it, but didnot received it was 14.8%.

Reperfusion therapy is the mainstay of salvasingischemic myocardium. This is of two types--- mechanicaland pharmacological. Patients presenting with acute chestpain consistent with acute myocardial infarction with aduration of 12 hours or less in association with ST segmentelevation greater than 0.1 mV in two or more contiguousECG leads or a new left bundle branch block, are thecandidates from reperfusion therapy.

Fibrinolytic therapy is preferred for those patientswhose medical contact occurs less than 3 hours after theonset symptoms and where facilities for PrimaryPercutaneous Coronary Intervention is not available.(4)

In the presence of skilled interventional cardiologistand well equipped catheterization laboratory PrimaryPercutaneous Coronary Intervention in preferred if thepatients has reported within 90 minutes of the onset of

E d i t o r i a l

Percutaneous Coronary Intervention in AcuteMyocardial Infarction

Sanjeeb Kakati*

* Professor & Head, Department of Medicine, AssamMedical College, Dibrugarh, Assam. PIN-786002

symptoms. In some special situation with contraindicationfor fibrinolytic therapy this procedure can also beconsidered even after 90 minutes too. In a meta analysispublished the Lancet in 2003 comprising of 23 randomizedcontrolled trials the rate of death at 4 to 6 weeks aftertreatment was significantly lower in PCI group then incomparison to fibrinolytic therapy group. Of course thereporting centres were centres of excellence for coronaryintervention.(5) With advancement of technology andavailability of expertise there has been a significant growthof Primary PCI in India too during the last decade.(6,7)

Like any other interventional procedure PrimaryPercutaneous Coronary Intervention also has its owninherent risks. Amongst the 1.5 million patients undergoingPCI in USA per year 5-30 % of them show evidence ofPeriprecedual myocardial injury. Other complications are--- Bleeding, Hematoma, pseudoaneurysm, A-V fistulas,Contrast related severe neuropathy and ventriculartachycardia. Emergency Cardiac surgery and in-hospitaldeath in this procedure are 4.3% to 2.5% respectively.(2,8,9)

However the outcome of Primary PCI in individualcentres varies with expertise and volumes of surgery.

Reference :1. Ellen C. Keeley, L. David Hillis. Primary PCI for

Myocardial Infarction with ST-Segment Elevation;N Eng J Med 2007; 356: 47-54.

2. Abhiram Prasad, Joerg Herrmann. MyocardialInfarction Due to Percutaneous CoronaryIntervention, N Eng J Med 2011; 364:453-464.

3. Rogers WJ, Canto JG, Lambrew CT, et al. Temporal


trends in the treatment of over 1.5 million patientswith myocardial infarction in the U.S. from 1990through 1999 : the National Registry of MyocardialInfarction 1, 2 and 3 J Am Coll Cardiol 2000; 36:2056-63.

4. Furman MI, Dauerman HL, Goldberg RJ, YarzebskiJ, Lessard D, Gore Jm. Twenty-two year (1975 to1997) trends in the incidence, in-hospital and long-term case fatality rates from initial Q-wave and non-Q-wave myocardial infarction: a multi-hospital,community-wide perspective. J Am Coll Cardiol2001; 37 : 1571-80.

5. Zheng ZJ, Croft JB, Giles WH, Mensah GA. Suddencardiac death in the United States, 1989 to 1998.Circulation 2001; 104:2158-63.

6. Keeley EC, Boura JA, Grines CL. Primaryangioplasty versus intravenous thrombolytic therapy

for acute myocardial infarction : a quantitative reviewof 23 randomised trials. Lancet 2003;361:13-20.

7. Piper WD, Malenka DJ, Ryan TJ Jr, et al. Predictionvascular complications in percutaneous coronaryinterventions. Am Heart J 2003; 145:1022-9.

8. Grines CL, Browne KF, Marco J, et al. Acomparison of immediate angioplasty withthrombolytic therapy for acute myocardial infarction.N Eng J Med 1993; 328:673-9.

9. Aversano T, Aversano LT, Passamani E, et al.Thrombolytic therapy vs primary percutaneouscoronary intervention for myocardial infarction inpatients presenting to hospitals without on-sitecardiac surgery : a randomized controlled trial. JAMA2002; 287:1943-51. [Erratum, JAMA 2002;287:3212]


Primary Percutaneous Coronary Intervention in AcuteST-Elevation Myocardial Infarction – A single centre experience

D K Baruah*, N K Panigrahi**, D J Raju***

O r i g i n a l A r t i c l e

AbstractBackground : Primary PCI is considered as most preferred treatment in acute ST-elevation myocardialinfarction and American Heart Association (AHA) American College Cardiology (ACC) recommend it asClass-Ia indication. In India, primary PCI has yet to peak up, and not many data are published in literatures. This study was performed to analyze theimmediate procedural out come of primary percutaneous intervention in a dedicated advanced cardiaccenter.Methods : 283 patients of acute ST-segment elevation MI were analyzed comparing there baseline,angiographic, PCI data, and immediate outcome.Results : 268 patients could be discharged with an immediate success rate of 94.6%. Male patients,hypertension, cardiogenic shock, use of IABP and ventilator were significantly associated with mortality.Majority of our patients had single vessel disease and reestablishment of blood flow in the infarct relatedartery (IRA) could be achieved in a short door to balloon time. Majority of patients who died were incardiogenic shock and had TIMI II or less flow in the IRA.Conclusion : High success rate could be achieved in primary PCI if blood flow can be established rapidlyin the IRA. This can be achieved if primary PCI program is run by a well coordinated and efficient team.

* Director cath. lab. ** Senior Consultant ofCardiology, *** Consultant of Cardiology, ApolloHospitals, Visakhapatnam.

KEY WORDS: primary angioplasty, acute myocardialinfarction, ST-selevation MI

IntroductionPrimary goal of intervention in acute myocardial

infarction is early establishment of blood flow in the infarctrelated artery (IRA), and primary percutaneous coronaryangioplasty (PPCI) has become a standard reperfusionstrategy in this regard 1-3. However, intravenousthrombolysis is still the effective option for centers withoutPCI facilities. Due to technological advancement,availability of PCI facilities and expertise, and increasedawareness PPCI is catching up in India, and there has

been significant growth seen in last 3-4 years in terms ofnumber of cases as well as no of centers performing theprocedure 4. Our center has been performing PPCI since2004, but coordinated, dedicated and effective PPCIprogram was started in the year 2006. This study reviewsour experiences in primary percutaneous intervention inacute ST-elevation MI.

Materials and methodsThis study includes cases performed between March 2006and February 2012. Consecutive patients with STEMIwho underwent primary PCI were retrospectively analyzedfrom our computerized database. Patients with windowperiod of more than 12 hrs, and patients with cardiogenicshock secondary to mechanical complications such asacute mitral regurgitation, ventricular septal rupture andfree wall rupture with tamponade were excluded from thestudy. Relevant physical and laboratory examinations, ECG


were carried out before the procedure. The patients werefollowed up closely until discharge.

Diagnosis of acute myocardial infarction was madeif at least two of the following three parameters werepresent: chest pain persisting for more than 20 minutes;ST-segment elevation of at least 0.1 mV in two contiguouslimb leads or 0.2mV in precordial leads or a new onsetleft bundle branch block; serum creatinine phosphokinase-myocardial band isoenzyme (CPK-MB) elevation abovetwo times the upper limit of normal.

After admission into the emergency room, the patientreceived 600mg of clopidrogrel or 60 mg of prasugrelwith 325 mg of aspirin apart from other drugs like beta-blocker, statin, ACE inhibitors etc. Use of GPIIbIIIa asadjunct was at the discretion of the primary operator andas when indicated during the procedure. However, mostof our cases received the drug. As a mater of policy, PCIwas done only to the culprit lesion and stented if the lesionwas suitable with good distal flow. Mutivessel PCI wasdone only in selected cases with cardiogenicshock if hemodynamics did not improve afteraddressing the culprit lesion. Periproceduralactivated clotting time was maintained ataround 300 seconds.

Successful PCI was defined as aresidual stenosis of <50% and Thrombolysisin Myocardial Infarction (TIMI) 3 flow inthe culprit artery at the end of the procedure.

Retrieval of data andStatistical methods

Data were retrieved by entering thepatient ID no and key words like PTCA,primary, cardiogenic shock. Data werestatistically analyzed using Chi-Square test.

Results283 cases underwent PPCI, out of that

245 were male (86.5%), and 38 were female(13.4%). Mean age of the patients was54+10 years (age range – 24-92 years).Window period was 6.6+5.8 hrs. The meandoor to balloon time was 74+34 min.. Riskfactor analysis revealed diabetes in 94 cases(33.12%), hypertension in 111 (39%),smoking in 40 (14%), tobacco use in 19(6.7%), alcohol intake in 16(5.6%), familyhistory of premature CAD in 9 (3.2%),

obesity in 22(7.7%), and hyperlipaedemia in 17 (6.00%).166 patients presented as acute anterior wall MI (58.6%),and 117 presented as acute inferior + posterior-lateralMI (41.4%).

Angiographic dataMajority of our cases had single vessel disease [200

cases (70.6%)]. Others, 62 (21.9%) had double vesseldisease, 16 (5.65%) had triple vessel disease, and three(1.06%) had left main disease.

PCI dataRight radial artery was the most preferred vascular

access route in majority of our cases [in 205 cases(72.4%)]. Distribution of infarct related artery which wastreated with primary PCI: left anterior descendingcoronary artery (LAD) in 120 cases (42.4%), rightcoronary artery (RCA) in 78 (28%), left circumflex (LCx)in 45(15.5%), and left main in 2 (0.7%). Multivessel PTCAwas carried out when indicated in 38 cases (13.4%).Adjunct GPIIbIIIa was administered in 238 cases

Fig.1. Comparative data of primary PCICharacteristics Discharged Death P ValueAge 55.0 + 10.2 58.2 + 10.2 0.37Male gender (%) 87.7 66.7 0.037*Diabetes (%) 66.4 66.7 0.10Hypertension (%) 59.0 93.3 0.006*Smoking (%) 84.7 93.3 0.83Family History (%) 98.1 93.3 0.28Obesity (%) 94.4 86.7 0.22Dyslipidaemia (%) 93.3 100 0.60AWMI (%) 43.3 33.3 0.59IWMI (%) 56.3 73.3 0.28SVD (%) 28.7 40.0 0.38DVD (%) 78.4 73.1 0.74TVD (%) 94.4 93.3 0.59Ventilator (%) 89.2 53.3 0.001*Shock (%) 88.1 46.7 0.0001*Thrombus Aspiration (%) 45.9 33.3 0.42IABP (%) 89.9 60.0 0.004*GPIIbIIa (%) 83.6 93.3 0.47Drug Eluting Stents (%) 52.6 66.7 0.41*Indicates statically significant


(84.09%). Primary thrombus aspiration using exportcatheter was done in 155 cases (54.7%). Intra aorticballoon counter pulsation as a left ventricular assist devicewas used in 34 cases (12.1%). 36 (12.7%) cases requiredventilator support. 341 stents (1.2 stents/patients) wereused, and out of that 151 (53.3%) were drug eluting stents.Immediate hospital outcome was analyzed. Angiographicsuccess was achieved in 260 cases (91.8%) with TIMIIII flow. 15 (5.57%) cases died, and, out of that 8 cases(53.3%) were in cardiogenic shock, 11 cases (73.3%)presented with anterior wall MI and, 10(66%) had LADdisease.

TIMI flow was analyzed at the end of the procedure.Patients who died with cardiogenic shock had poor distalrunoff (TIMI II or less flow).

Comparative study was carried out with major riskfactors and important variables between the discharged(recovered) group and patients who died. Importantvariables associated with death are shown in table I.

DiscussionCAD is a major global health problem, and acute

myocardial infarction is the major cause of death (sudden)and morbidity. The prognosis of patients after an AMI ismainly determined by the size of the infarct, which isdependent of the area at risk (determined by localizationof coronary occlusion), the duration of ischaemia, theseverity of ischaemia (which is dependent on the degreeof collateral flow and residual ante grade flow), and themode of reperfusion5. Any (ST-segment elevation) AMIshould be reperfused as fast as possible (“time is muscle”).Primary percutaneous coronary intervention is currentlybeing considered as the optimal approach to thereperfusion therapy of ST-segment elevation myocardialinfarction 6,7.

In comparison with conservative management(medical treatment without reperfusion therapy), fibrinolytictherapy leads to improved left ventricular systolic functionand survival in patients with myocardial infarctionassociated with either ST-segment elevation or left bundle-branch block. In a pooled analysis of nine large trials, therate of death at 35 days was 9.6% among patients receivingfibrinolytic therapy, as compared with 11.5% amongcontrol subjects.8 However, fibrinolytic therapy has severallimitations. First, among those presenting with myocardialinfarction with ST-segment elevation, some patients (27%in one report)9 have a contraindication to fibrinolysis.

Second, in approximately 15% of patients given fibrinolytictherapy, thrombolysis does not occur.10,11 Third, about aquarter of those receiving fibrinolytic therapy havereocclusion of the infarct-related artery within 3 monthsafter the myocardial infarction, with a resultantreinfarction.12 These limitations are minimized with the useof primary PCI.

In a meta-analysis of 23 randomized, controlledcomparisons of primary PCI (involving 3872 patients) andfibrinolytic therapy (3867 patients), the rate of death at 4to 6 weeks after treatment was significantly lower amongthose who underwent primary PCI (7% vs. 9%).13 Ratesof nonfatal reinfarction and stroke were also significantlyreduced. Experienced operators with minimal delayperformed most of these trials in high-volume interventionalcenters after the patient’s arrival. If less-experiencedoperators with longer delays between arrival and treatmentperform primary PCI at low-volume centers, suchsuperior outcomes may not be seen 14. In our study, oneof the major reasons of high success rate was rapidestablishment of flow in the infarct related artery (meandoor to balloon time was 74 min). This short door toballoon time could be possible due to the facts that ourhospital delivers care to only cardiac and renal patientsfor which we could develop a compact, efficient, anddedicated PCI cum cath. lab team.

Mortality in cardiogenic shock in acute MI remainshigh in spite of significant technological development inPTCA 9,10 and ranges from 50% to70%. Majority ofour patients who died were in cardiogenic shock. InSHOCK trial and other investigational studies, proceduralsuccess with establishment of TIMI III flow in the infarctrelated artery was the strongest predictor of survival 15-16.In this study, we observed higher mortality associated withpoor distal run off (TIMI II or less), though we did not dosubgroup analysis of cardiogenic shock in this study.

In primary PCI, it has been shown that adjunctivetherapy and usage of stents are associated with improvedinfarct related artery (IRA) patency and TIMI flow 17-18.In our study, GPIIbIIa was used in 84% of cases.However, in comparative study that did not influence theoutcome. Benefit of Ventricular assist device (IABP) hasbeen established in primary PCI, especially in cardiogenicshock 19. Similarly, ventilator support is essential in patientswith severe acute pulmonary edema and cardiogenicshock. In our series, mortality was high in patients on


ventilator and IABP. This is probably due to majority ofdead patients were in cardiogenic shock, and actual benefitof IABP could not be assessed in shock patients, as nosubgroup analysis was done.

This retrospective study of primary PCI in acuteSTEMI has shown high success rate and good immediateoutcome. Most probable explanation for this is the shortwindow period and rapid establishment of blood flow inthe IRA, which is considered as the key factor towardsthe success of any primary PCI program.

Acknowledgement: our thanks to Mrs Nandini, Sec-retary cath. lab., Mr. Verraswamy, Technician, MrSwaroop, IT department, for compiling data.

References1. Keeley EC, Boura JA, Grines CL. Primary angioplasty

versus intravenous thrombolytic therapy for acutemyocardial infarction: a quantitative review of 23randomised trials. Lancet 2003; 361(9351):13-20.

2. Andersen HR, Nielsen TT, Rasmussen K, et al forthe DANAMI-2 investigators. A comparison of coro-nary angioplasty with fibrinolytic therapy in acute myo-cardial infarction. N Engl J Med 2003 Aug 21;349:733-42.

3. de Boer MJ, van Hout BA, Liem AL, et al. A cost-effective analysis of primary coronary angioplastyversus thrombolysis for acute myocardialinfarction. Am J Cardiol 1995 Oct 15; 76:830-833.

4. Data presented in National Interventional Councilmeet, 27-29 April, 2012, Kochi

5. Christian TF, Schwartz RS, Gibbons RJ. Determinantsof infarct size in reperfusion therapy for acute myo-cardial infarction. Circulation 1992;86:81-90.

6. Van de Werf F, Ardissino D, Betriu A, et al.Management of acute myocardial infarction inpatients presenting with ST-segment elevation.The Task Force on the Management of AcuteMyocardial Infarction of the European Society ofCardiology. Eur Heart J 2003;24:28-66.

7. Fibrinolytic Therapy Trialists’ (FTT) CollaborativeGroup. Indications for fibrinolytic therapy in sus-pected acute myocardial infarction: collaborative over-view of early mortality and major morbidity resultsfrom all randomized trials of more than 1000 patients.Lancet 1994; 343:311-742.

8. Juliard J-M, Himbert D, Golmard J-L, et al. Can weprovide reperfusion therapy to all unselected patientsadmitted with acute myocardial infarction? J Am CollCardiol 1997;30:157-64.

9. The GUSTO Angiographic Investigators. The effectsof tissue plasminogen activator, streptokinase, or both

on coronary-artery patency, ventricular function, andsurvival after acute myocardial infarction. N Engl JMed 1993;329:1615-22.

10. Anderson JL, Karagounis LA, Becker LC, SorensenSG, Menlove RL. TIMI perfusion grade 3 but not grade2 results in improved outcome after thrombolysis formyocardial infarction: ventriculographic, enzymatic,and electrocardiographicevidence from the TEAM-3 Study. Circulat ion1993;87:1829-39.

11. Gibson CM, Karha J, Murphy SA, et al. Early andlong-term clinical outcomes associated withreinfarction following fibrinolytic administration in theThrombolysis in Myocardial Infarction trials. J Am CollCardiol 2003;42:7-16.

12. Hochman JS, Sleeper LA, Webb JG et al. Earlyrevascularization in acute myocardial infarction com-plicated by cardiogenic shock. SHOCK investigators.Should we emergently revascularize occluded coro-naries of cardiogenic shock? N Engl J Med1999;341:625-634.

13. Davies CH. Revascularization for cardiogenic shoch.Q J Med 2001;94:57-67.

14. Lee L, Bates ER, Pitt B et al. Percutaneoustransluminal coronary angioplasty improves survivalin acute myocardial infarction complicated bycardiogenic shock. Circulation 1988;78:1345-51.

15. Hibbard MD, Holmes DR Jr, Baily KR et al.Percutaneous transluminal coronary angioplasty inpatients with cardiogenic shock. J Am Coll Cardiol1992;19:907-1

16. Moosvi AR, Khaja F, Villanueva L et al. Earlyrevascularization improves survival in cardiogenicshock complicating acute myocardial infarction. J AmColl Cardiol 1992;19:639-46.

17. TopolEJ, Mark DB, Lincoff AM. Outcomes at 1 yearand economic implications of platelet glycoprotein IIb/IIIa blockade in patients undergoing coronary stenting:results from a multicentre randomisedtrial. Lancet. 1999;354:2019–2024

18. AndersonKM, Califf RM, Stone GW. Long term mor-tality benefit with abciximab in patients undergoingpercutaneous coronary interv intervention. J Am CollCardiol.2001;37:2059-2065.

19. MontalescotG, Barragan P, Wittemberg O. Platelet gly-coprotein IIb/IIIa inhibition with coronary stenting foracute myocardial infarction. N Engl JMed. 2001;344:1895–1903.

20. Mohamed Abdel-Wahab, MD, Mohammed Saad, MD,Joerg Kynast., MD et al,.Comparison ofHospitalMortality With Intra-Aortic Balloon Counter-pulsation Insertion Before Versus AfterPrimaryPercutaneous Coronary Intervention for Car-diogenic ShockComplicating Acute Myocardial Inf-arction. Am J Cardiol 2010;105:967–971.


Molecular Typing and Evolutionary Analysis ofHaemophilus Influenzae Isolated in Delhi

K K Saikia*, B K Das**, N K Arora***, P Chandra****


AbstractHaemophilus influenzae is a leading cause of vaccine preventable disease in the developing countries

with a high case fatality rate. Cost of vaccine is high and is not included in extended program of immunizationin India. Out of the six reported serotypes and non-typable isolates, type b is the leading cause of invasivedisease. Molecular typing methods were used to compare invasive and commensal H. influenzae isolatesfor expression of type b capsule and fimbriae. Evolutionary relatedness of both the groups was analyzedby multi locus sequence typing. Type b serotype was found to be prevalent in high numbers in the community.Expression of fimbriase was more common amongst the commensal isolates. High genetic diversity wasseen amongst the isolates of both the groups. In a dendogram constructed using the MLST gene sequencesit was observed that invasive and commensal isolates made two completely separate clusteres.

KEY WORDS: Haemophilus influenzae, MLST,invasive, commensal

INTRODUCTIONHaemophilus influenzae, a gram-negative bacterialpathogen of children and adults is a causative agent for anumber of invasive diseases including pneumonia andmeningitis(1). The organism is also a common colonizer ofthe nasopharynx. Six capsular serotypes (a-f) as well asnoncapsulated strains are described(2). H. influenzaeserotype b (Hib) accounts for more than 95% of invasivedisease(2). Introduction of conjugate vaccine in theindustrialized countries since 1990 have substantiallyreduced disease burden in these countries(3). However,most of the developing countries are yet to use Hibvaccine. As a result Hib disease still remains a major causeof concern in the developing world(4). In the Indian

subcontinent, reports from Pakistan suggests that H.influenzae is the leading cause (57% of cases) of bacterialmeningitis ahead of Streptococcus pneumoniae andNeisseria meningitidis(5). Hib is a leading cause ofinvasive H. influenzae disease (64%) followed by non-typable isolates (36%)(6). Hib is also the most predominantcause (97%) of bacterial meningitis in Bangladeshichildren(7). In Nepal, 65% of the cases of bacterialmeningitis are due to Hib infection(8). Hib carriage in Nepalis recently reported to be 5% by a population based studyamongst healthy school going children(9). However, inThailand disease burden due to Hib is reported to be lowwith an incidence rate of 3.8(10). But it is also speculatedthat this study may miss cases due to extensive use ofantibiotic prior to hospitalization(11). In India our study andothers have described high disease burden of Hib. Hib isalso found to be significantly prevalent as nasopharyngealcarriage(12,13). In addition case fatality rate of Hib meningitisin India is very high(14). Subcommittee on introduction ofHib vaccine in universal immunization programme, nationaltechnical advisory group on immunization, India stronglyrecommended that Hib vaccine should be urgentlyintroduced in the country in 2009(15). The latest WHO

*Asstt Prof., Dept. of Biotechnology, Guwahati Uni-versity, **Deptt of Microbiology, All India Institute ofMedical Sciences, New Delhi. E-mail:[email protected], ***Executive Director, TheINCLEN Trust International, ****Scientist, Dept. ofBiostatistics, AIIMS


position paper on Hib also says ‘Hib vaccine should beincluded in all routine immunization programmes. Non-typable strains are more often found to be associated withrespiratory tract infections(16).

In developing countries, where the H. influenzaedisease burden is greatest, treatment regimens for bacterialmeningitis are based on low-cost antibiotics because ofthe economic constraints associated with purchasing third-generation cephalosporins. Plasmids conferring ability toproduce Extended Spectrum Beta Lactamase werescreened and compared between two groups of H.influenzae isolates- commensal and invasive. Prevalenceof type b serotype and haemagglutinating fimbriae wasalso examined and differences were evaluated for statisticalsignificance. Multi-locus sequence typing was used todetermine the evolutionary relationship of commensal andinvasive isolates.

MATHODOLOGYH. influenzae isolates collected through

nasopharyngeal swabs from healthy school going childrenin Delhi region during August, 2005 to July, 2007 weredesignated as commensal isolates. Isolates causing invasivedisease were cultured from sterile body fluid like blood,CSF and Pleural fluid and were designated as invasiveisolates. Informed consent was obtained before collectingsamples. The study methodology was approved byinstitutional ethics committee, AIIMS, New Delhi.Specimen was cultured on Muller-Hinton chocolateagar at 37°C in an atmosphere of 5% CO2 for 16-18hours for growth. Isolates were confirmed as H.influenzae through oxidase test, gram stain, satellitismand their growth dependence on factor X and V asdescribed earlier(14). Serotyping was carried out toidentify serotype b H. influenzae (Hib) isolates usingmonospecific antisera (b) (Murex, UK) and PCRbased on type b specific primers bl5’GCGAAAGTGAACTCTTATCTCTC3’and b25’GCTTACGCTTCTATCTCGGTGAA3’ asdescribed earlier(17). Polymerase chain reaction wascarried out for detection of presence ofhaemagglutinating fimbriae based on hifA gene thatencodes for the major subunit of haemagglutinatingfimbirae of H. influenazae. The gene hifA was amplifiedas described previously(18). Qualitative and quantitativevalues were expressed as frequency (percentage) andmean ± SD. Descriptive statistics was used to summarize

all demographic and clinical characteristics. Chi-squaretest was applied to examine an association between thedifferent characteristics of antibiotics and types of isolates.P- value smaller than 0.05 was considered as statisticallysignificant. All Statistical analyses were done usingstatistical packages SPSS 18.0.

To identify evolutionary relationship between invasiveand commensal isolates, DNA sequencing of sevenhousekeeping genes adenylate kinase (adk), ATP synthaseF1 subunit Gamma (atpG), fumerate reductase iron sulfurprotein (frdB), fuculokinae (fucK), malate dehydrogenase(mdh), glucose -6- phosphate isomerase (pgi) and recAprotein (recA) on both strands was done as describedearlier(19).

RESULTS and DISCUSSIONS26/80 (32.5%) commensal isolates were found to

be of serotype b whereas 19/20 (95%) invasive isolateswere found to be of serotype b. Presence of serotype b

amongst invasive isolates were found to be significantlyhigher through statistical analysis (p <0.0001) (Table 1,Figure. 1). This finding is in agreement with previousreports of Haemophilus influenzae serotype b (Hib)being the major cause of invasive disease. However Hibwas also found to be a predominant serotype circulating


in the community. The study showed that type b capsularstrains are present in the oropharynx of healthy youngchildren in significant numbers and can be a source ofinfection to others and self. Therefore vaccination withHib conjugated vaccine is important for the Indian children.

Twenty three out of eighty commensal isolates(28.75%) demonstrated presence of fimbrial gene hifA.On the other hand only two of twenty (10%) invasiveisolates were found to carry fimbrial gene. Difference in

fimbrial carriage was not significant in between the twogroups (p = 0.083) (Table 1, Figure 2). Carriage of fimbriae(pili) was more common in commensal isolates than thatin the invasive isolates. Commensal strains require thefimbrial antigen for colonization. Once these strains invade,there is no need for expression of fimbrial antigen. Sixdifferent Sequence Types were found to be presentamongst the Indian invasive H. influenzae isolates testedin this study, four of which were novel. MLST SequenceTypes prevalent amongst the invasive isolates were, ST24, -118, -570, -571, -572 and 616. On the other hand,amongst the 13 community acquired isolates tested, 9distinct, novel STs were discovered which were notreported from any other country. The sequence typesfound amongst the community acquired isolates were, ST-622 -618, -619, -620, -625, -626, -627, -628 and -629 (Table 2, Figure 4). Invasive and commensalHaemophilus influenzae isolates were found to be distinctfrom each other genotypically when sequences of the mostconserved genes are compared. In a dendogramconstructed using combined sequences of 7 MLSThousekeeping genes, invasive and non-invasive isolateswere shown to cluster separately (Figure. 3). Comparisonof the global data with our further authenticated our findings(Figure 4). This fact may be indicative of these two groupsevolving as two distinct lineages. The results of this


study also demonstrate the ability of molecular typingmethods to define relationships of pathogenic (invasive)and non-pathogenic (commensal nasopharyngeal) isolates.This fact however requires further exploration involvinglarger study that looks at molecular epidemiology ofinvasive and commensal H. influenzae isolates. To ourknowledge, this is the first study from India using MLSTto characterize a collection of H. influenzae isolates fromnasopharynx of healthy children demonstrating anunexpectedly high level of DNA sequence heterogeneityin the community. REFERENCE:1. Funkhouser A, Steinhoff MC, Ward J. Haemophilus

influenzae disease and immunization in developingcountries. Reviews of infectious diseases, (1991);13(Suppl. 6):S542–54.

2. Saikia KK, Bewal R, Bansal D, Kapil A, Sood S, AroraNK, Das BK. Multi locus sequence type comparisonof invasive and commensal Haemophilus influenzaeisolates from Delhi.Indian J Med Microbiol. (2011);29(2):158-60.

3. Feikin DR, Nelson CB, Watt JP, Mohsni E, WengerDJ, Levine OS. Rapid Assessment Tool forHaemophilus influenzae type b Disease in DevelopingCountries. Em Infc Dis. (2004); 10(7) :127-76.

4. Jordens JZ, Slack MP; Haemophilus influenzae thenand now. Eur J Clin Microbiol Infect Dis.(1995);14(11):935-48.

5. Zaidi AK, Khan H, Lasi R, Mahesar W. SindhMeningitis Group, Surveillance of pneumococcalmeningitis among children in Sindh, southern Pakistan.Clin Infect Dis. (2009). Mar 1;48 Suppl 2:S129-35.

6. Weinberg GA, Ghafoor A, Ishaq Z, Nomani NK,Kabeer M, Anwar F, Burney MI, Qureshi AW, MusserJM, Selander RK. Clonal analysis of Hemophilusinfluenzae isolated from children from Pakistan withlower respiratory tract infections. J Infect Dis. (1989);160(4): 634-43.

7. Saha SK, Baqui AH, Darmstadt GL, Ruhulamin M,Hanif M, El Arifeen S, Oishi K, Santosham M,Nagatake T, Black RE. (2005). Invasive Haemophilusinfluenzae type b diseases in Bangladesh, withincreased resistance to antibiotics. J Pediatr. (2005);146(2): 227-33.

8. Sharma PR, Adhikari RK, Joshi MP, Lal M, ChodonT, Pokhrel BM, Shrestha RS, Shrestha IB. Intravenouschloramphenicol plus penicillin versus intramuscularceftriaxone for the treatment of pyogenic meningitisin Nepalese children. Trop Doct. (1996); 26(2): 84-5.

9. Williams EJ, Lewis J, John T, Hoe JC, Yu L, Dongol

S, et al.Haemophilus influenzae type b carriage andnovel bacterial population structure among children inurban Kathmandu, Nepal.J Clin Microbiol.(2011);49(4):1323-30.

10. Rerks-Ngarm S, Treleaven SC, Chunsuttiwat S,Muangchana C, Jolley D, Brooks A, Dejsirilert S,Warintrawat S, Guiver M, Kunasol P, Maynard JE,Biggs BA, Steinhoff M. Prospective population-basedincidence of Haemophilus influenzae type bmeningitis in Thailand. Vaccine. (2004); 22(8):975-83.

11. Helena MP, Nohynek H, Elja H. Prospective population-based incidence of Haemophilus influenzae type bmeningitis in Thailand.Vaccine. (2005);23(21):2687-88.

12. Das BK, Arora NK, Mathur P, Ostwal P, Mandal S,Kabra SK, et al. Nasopharyngeal carriage ofHaemophilus influenzae. Indian J Pediatr (2002); 69:775-77.

13. Sekhar S, Chakraborti A, Kumar R. Haemophilusinfluenzae colonization and its risk factors among lessthan two year old children in Northern India. EpidemiolInfect. (2008) 12: 1-5

14. Invasive Bacterial Infections Surveillance (IBIS)Group of the International Clinical EpidemiologyNetwork. Are Haemophilus influenzae Infections aSignificant Problem in India? A Prospective Study andReview. Clin Infect Dis. (2002); 34: 949–57.

15. Subcommittee on Introduction of Hib Vaccine inUniversal Immunization Program, National TechnicalAdvisory Group on Immunization, India. NTAGIsubcommittee recommendations on Haemophilusinfluenzae type B (Hib) vaccine introduction in India.Indian Pediatr. 2009 Nov;46(11):945-54.

16. Alberta Health and Wellness; Public Health NotifiableDisease Management Guidelines. Haemophilusinfluenzae non-serotype b, Invasive. August 2011.Govt. of Alberta

17. Falla TJ, Crook DWM, Brophy LN, Makell D, KrollJS, Moxon ER. PCR for capsular typing ofHaemophilus iinfluenzae. J. Clin. Microbiol. (1994);32:2382–2386.

18. Van Ham SM, van Alphen L, Mooi FR, van PuttenJP. The fimbrial gene cluster of Haemophilusinfluenzae type b. Mol Microbiol. (1994);13(4):673-84.

19. Meats E, Feil EJ, Stringer S, Cody AJ, Goldstein R,Kroll JS, et al. Characterization of encapsulated andnoncapsulated Haemophilus influenzae anddetermination of phylogenetic relationships bymultilocus sequence typing. J Clin Microbiol.(2003);41(4):1623-36.


A Study of Sputum Culture and Sensitivity in Cases ofCommunity Acquired Pneumonia in Barpeta

A Dutta*, M Kataki**, B Dutta***, B Das Pathak****


AbstractAs community acquired pneumonia can be caused by various microbes and no single antimicrobialagent can cover all possible etiological agents, a study was conducted in Fakharuddin Ali AhmedMedical College and Hospital to find out the most common etiological agents and their antibioticsensitivity in patients from the districts of lower Assam. A total of 134 cases were included initially,but after exclusion and a few cases lost to follow up, 90 cases were included in the study. Of them 66(73%) cases were males and 24 (27%) were females. Their average age was 45.89 years (range 12yrs to 80 yrs). 49 (54%) cases had shown growth of a specific microorganism in culture media and41 (46%) cases had shown no growth. Of those with positive growth on culture media 34 (69%)were males and 15 (31%) were females.Of the 47 cases of sputum culture showing positive growth,26 (53%) cases showed growth of Staphylococcus sp, 15 (31%) cases showed growth of Klebsiellasp,4 (8%) cases showed growth of Pseudomonas sp and 4 (8%) cases showed growth of Streptococcuspneumoniae.The average sensitivity of antibiotics was found to be very positive, indicating that thisregion has been relatively less invaded by resistant microbial flora. Aminoglycosides (Gentamycinand amikacin) and quinolones (Ciprofloxacin, Ofloxacin, Levofloxacin and Gatifloxacin) showed verygood sensitivity results whereas sulphonamides and macrolides showed lesser sensitivity results.

*Registrar of Medicine, ** Assistant Prof. ofMicrobiology, *** Registrar of Pathology,****Research Assistant, Fakharuddin Ali AhmedMedical College and Hospital, Barpeta.

KEYWORDS: Community Acquired Pneumonia,Gram’s stain, Sputum culture, Antibiotic sensitivity,

INTRODUCTIONSir William Osler in 1901, noted that “the most

widespread and fatal of all acute diseases, pneumonia, isnow Captain of the Men of Death”1. This may notbe truein today’s context but even after a century later it is still acause of significant mortality and morbidity.This is moreimportant in developing countries like India. In India themortality for non-hospitalized patients is 1% while it risesto more than 30% in hospitalized cases particularly inpatients admitted to intensive care unit2.

Pneumonia is defined as an inflammation of the alveoli,distal airways and interstitium of the lungs. The alveoli arefilled with inflammatory exudates with white blood cells,red blood cells and fibrin. Pathologically it is characterizedby consolidation. Clinically it is a constellation of symptomsand sings2.Epidemiologically it can be classified as2

1. Community acquired pneumonia (CAP)2. Nosocomial or Hospital Acquired Pneumonia (HAP)3. Ventilator Associated Pneumonia (VAP)4. Aspiration Pneumonia.5. Pneumonia in immune compromised hosts.Community acquired pneumonia (CAP) is pneumonia thathas been acquired in a community in a patient who hasnot been hospitalized within 14 days prior to onset ofsymptoms1 or hospitalized less than 4 days prior to onsetof symptoms3.

The clinical challenges in treating pneumonia are the


large number of microbial agents that can cause thisdisease, that no single antimicrobial regime can cover allthe possible etiological agents and increasing prevalenceof antibiotic resistance among many of the commonpathogens. As a specific etiological diagnosis is often notpossible at the time of diagnosis, the clinician must decidewhat empirical therapy is most appropriate. To aid thisdecision this study was carried out to assess the mostcommon etiological agent and their antibiotic sensitivitywith the help of sputum examination in this region of Assam.As no study of this kind has been carried out in this partof the country, this will be the first of its kind of study inthis district of Barpeta in Lower Assam.

Aim of The StudyTo study the sputum culture of patients with

community acquired pneumonia coming to the outpatientsdepartment of Fakhruddin Ali Ahmed Medical Collegeand Hospital for finding out the etiological agents involved.

To study the culture sensitivity of the abovementioned cases for finding out the most sensitive andresistant antibiotics.Inclusion criteria

a. Adults and Adolescents ( Age> 12years ) comingto the out-patients department of Department of Medicine,in Fakharuddin Ali Ahmed Medical College and Hospital,from March 2011 to April 2012.

b. Clinical history and physical presentationsuggestive of CAP.

c. Radiological evidence to support the diagnosisof CAP.Exclution Criteria

1. Any case diagnosed with acute asthma, upperrespiratory tract infection, heart failure, pulmonaryembolism.

2. Any case whose clinical and microbilogicalexamination could not be completed.

3. History of use of any antibiotic for the symptoms(within 48-72 hours prior to presentation in our outpatientsdepartment) before sending sputum for antibiotic sensitivity.

4. Any case lost to follow up.Materials and methods

Any case that presented to the outpatients departmentof Medicine in Fakharuddin Ali Ahmed Medical Collegeand Hospital from March 2011 to April 2012 with a clinicalhistory and findings of CAP were included in the study.Any evidence of upper respiratory tract infection, chronic,cardiac disease, heart failure, asthma were examined and

if found to be present were excluded from the study. Atotal of 134 cases were included initially, but after exclusionand a few cases lost to follow up, 90 cases were includedin the study. Of them 66 (73%) cases were males and 24(27%) were females. Their average age was 45.89 years(range 12 yrs to 80 yrs). Their fresh sputum (2 ml or more)was sent in commercially available sputum collectionsystem or similar sterile container with screw capfor cultureand sensitivity.Care was taken to ensure that the specimenis sputum and not saliva. Examination of Gram’s stain, withnumber of epithelial cells and PMNs was noted, as it wasan important part of the evaluation process. It also makessure that the sample is sputum and not saliva. The samplewere then grown in Blood agar and MacConkey agar. Grampositive cocci in clusters or in nonspecific arrangements withcoagulase positivity were regarded as Staphylococcal sp4.Gram positive flame shaped lanceolatediplococci wereregarded as Streptococcus pneumonae5. Gram negativenon spore forming bacilli which were lactose fermenting inMacConkey agar were considered Klebsiella sp6. Pigmentpyoverdin (blue/green) producing moist mucoid colonieswith gram negative, non sporing rods were considered tobe Pseudomonas sp7. 49 (54%) cases had shown growthof a specific microorganism in culture media and 41 (46%)cases had shown no growth. After isolation of the pathogenantibiotic sensitivity was done in Mueller-Hinton agar8.Sensitivity to various antibiotics were seen according to thestandard guidelines9. The results were separately studiedfor each pathogen and a standardisation was done tocompare the results.

For comparison of antibiotic sensitivity of variousmicroorganisms to various antibiotics a novel method wasused. Those cases which showed high sensitivity to aparticular antibiotic were given a score of 2 (two). Thosecases which were intermediately sensitive to the sameantibiotic were given a score of 1 (one). And those caseswhich showed resistance toward the same antibiotic weregiven a score of -1 (minus one). The total score of all thecases infected with the same microorganism and testedagainst a specific antibiotic was added and a final scorewas given. Percentiles were calculated for each antibioticused against a specific microorganism and comparedtogether to come to a rough conclusion. Although this isnot an accepted methodology (ideally an equal number ofmicroorganisms should be tested against all the antibiotics)but it gives a good quantitative idea for comparison andmay be helpful in most of the practical situations.


Results and ObservationsA total of 90 cases of pulmonary acquired pneumonia

were included in the study. 66 (73%) cases were malesand 24 (27%) were females. 49 (54%) cases had showngrowth of a specific microorganism in culture media and41 (46%) cases had shown no growth. Of those withpositive growth on culture media 34 (69%) were malesand 15 (31%) were females. 22 (24.4%) cases weresuffering from chronic obstructive airway disease, 17(18.8%) cases were suffering from diabetes mellitus, 14(15.5%) cases were chronic smokers and 4 (4.4%) caseswere chronic alcoholic with signs of chronic liver disease.Also, all 4 cases of CAP showing growth of pseudomonasspp in their sputum culture were diabetic.

Of the 47 cases of sputum culture showing positivegrowth, 26 (53%) cases showed growth of Staphylococcussp, 15 (31%) cases showed growth of Klebsiellasp, 4 (8%)cases showed growth of Pseudomonas sp and 4 (8%) casesshowed growth of Streptococcus pneumoniae. Moreover4 (15%) cases of Staphylococcal growth, 2 (13%) ofKlebsiallasp growth, 3 (75%) of Pseudomonal growthshowed profuse growth of organisms in the culture platewhere else the rest showed moderate growth.

The average age of presentation of cases with

pneumonia due to Staphylococcal sp was found out to be37yrs, with those due to Klebsiellasp was 44yrs, withthose due to Pseudomonas sp was 53yrs and with thosedue to Streptococcus pneumoniae was 55 yrs.

TABLE 1 : ANTIBIOTIC SENSITIVITY OF STAPHYLOCOCCAL SPSENSITIVE INTERMEDIATE RESISTANT SCORE

PENICILLINSPenicillin G 6 5 13 4 (8.3)Ampicillin/Sulbactum 21 2 1 43 (89.5)Amoxicillin 19 3 2 39 (81.2)Amoxicillin plus clavulanic acid 19 3 2 39 (81.2)Piperacillin plus tazobactam 23 1 0 47 (98)CEPHALOSPORINSCephalexinCefiximeCeftriaxone 23 1 0 47 (98)Cefotaxime 24 0 0 48 (100)CeftazidimeCefepimeCARBAPENEMSImipenem 21 3 0 45 (93.7)AMINOGLYCOSIDESGentamicin 24 0 0 48 (100)AmikacinMACROLIDESAzithromycin 22 1 1 44 (91.6)Erythromycin 17 3 4 33 (68.7)


TABLE 2 : ANTIBIOTIC SENSITIVITY OF KLEBSIELLA SPSENSITIVE INTERMEDIATE RESISTANT SCORE

PENICILLINSPenicillin GAmpicillin/SulbactumAmoxicillin 8 4 3 17 (56.6)Amoxicillin plus clavulanic acid 9 3 3 18 (60)Piperacillin plus tazobactam 14 1 0 29 (96.6)CEPHALOSPORINSCephalexinCefixime 5 7 3 14 (46.6)Ceftriaxone 12 3 0 27 (90)Cefotaxime 9 4 2 20 (66.6)Ceftazidime 8 5 2 19 (63.3)Cefepime 10 3 2 21 (70)CARBAPENEMSImipenem 13 2 0 28 (93.3)AMINOGLYCOSIDESGentamicin 15 0 0 30 (100)Amikacin 15 0 0 30 (100)MACROLIDESAzithromycin 10 3 2 21 (70)ErythromycinLINCOSAMIDESTobramycin 14 1 0 29 (96.6)LincomycinLINEZOLIDLinezolidTETRACYCLINSDoxycycline 14 1 0 29 (96.6)SULFHONAMIDESSulfamethoxazole and Trimethoprim 5 8 2 16 (53.3)QUINOLONESCiprofloxacin 14 1 0 29 (96.6)Ofloxacian 14 1 0 29 (96.6)Levofloxacin 15 0 0 30 (100)Gatifloxacin 14 1 0 29 (96.6)

SENSITIVE INTERMEDIATE RESISTANT SCORELINCOSAMIDESClindamycin 12 6 6 24 (50)Lincomycin 13 6 5 27 (56.2)LINEZOLIDLinezolid 19 3 2 39 (81.2)TETRACYCLINSDoxycycline 22 2 0 46 (95.8)SULFHONAMIDESSulfamethoxazole and Trimethoprim 5 15 4 21 (43.7)QUINOLONESCiprofloxacin 23 0 1 45 (93.7)Ofloxacian 23 0 1 45 (93.7)Levofloxacin 24 0 0 48 (100)Gatifloxacin 24 0 0 48 (100)


TABLE 3 : ANTIBIOTIC SECNSITIVITY OF STEPTOCOCCUS PNEUMONIAESENSITIVE INTERMEDIATE RESISTANT SCORE

PENICILLINSPenicillin G 2 0 2 2 (25)Ampicillin/SulbactumAmoxicillin 2 2 0 6 (75)Amoxicillin plus clavulanic acid 2 2 0 6 (75)Piperacillin plus tazobactam 4 0 0 8 (100)CEPHALOSPORINSCephalexin 0 2 2 0CefiximeCeftriaxoneCefotaxime 2 2 0 6 (75)CeftazidimeCefepime 3 1 0 7 (87.5)CARBAPENEMSImipenem 4 0 0 8 (100)AMINOGLYCOSIDESGentamicin 4 0 0 8 (100)Amikacin 2 2 0 6 (75)MACROLIDESAzithromycinErythromycin 2 0 2 2 (25)LINCOSAMIDESTobramycinLincomycinLINEZOLIDLinezolidTETRACYCLINSDoxycycline 2 2 0 6 (75)SULFHONAMIDESSulfamethoxazole and Trimethoprim 2 0 2 2 (25)QUINOLONESCiprofloxacin 4 0 0 8 (100)Levofloxacin 4 0 0 8 (100)Norfloxacin 1 2 1 3 (37.5)

TABLE 4 : ANTIBIOTIC SENSITIVITY OF PSEUDOMONAS SPSENSITIVE INTERMEDIATE RESISTANT SCORE

PENICILLINSPenicillin GAmpicillin/SulbactumAmoxicillin 1 1 2 1 (12.5)Amoxicillin plus clavulanic acid 1 2 1 3 (37.5)Piperacillin plus tazobactam 2 2 0 6 (75)CEPHALOSPORINSCephalexin 1 0 3 -1 (-12.5)Cefixime 2 1 1 4 (50)Ceftriaxone 2 2 0 6 (75)Cefotaxime 2 2 0 6 (75)Ceftazidime 2 2 0 6 (75)Cefepime 1 3 0 5 (62.5)CARBAPENEMSImipenem 3 1 0 7 (87.5)


AMINOGLYCOSIDESGentamicin 4 0 0 8 (100)Amikacin 3 1 0 7 (87.5)MACROLIDESAzithromycin 1 3 0 5 (62.5)ErythromycinLINCOSAMIDESTobramycin 2 2 0 6(75)LincomycinLINEZOLIDLinezolidTETRACYCLINSDoxycycline 1 1 2 1(12.5)SULFHONAMIDESSulfamethoxazole and Trimethoprim 0 2 2 0QUINOLONESCiprofloxacin 3 1 0 7(87.5)Ofloxacian 2 2 0 6(75)Levofloxacin 4 0 0 8 (100)Gatifloxacin 3 1 0 7 (87.5)

The average sensitivity of antibiotics was found tobe very positive, indicating that this region has beenrelatively less invaded by resistant microbial flora. Thesensitivity of Staphylococcal and Klebsiallasp has beenmore positive than Pseudomonas sp. Staphylococcus spwas most sensitive to cephalosporins (99), carbapenems(93.7), aminoglycosides (100), tetracyclins (95.8) andquinolones (96.85), whereas Klebsialla sp was mostsensitive to carbapenems (93.3), aminoglycosides (100),lincosamines (96.6), tetracyclins (96.6) and quinolones(97.45). Streptococcus pneumonia was most sensitive tocarbapenems (100), aminoglycosides (87), quinolones(79) and penicillins (67.75). Pseudomonas was moreresponsive to carbapenems (87.5),aminoglycosides(93.75) and quinolones (87.5).Pseudomonas was found to be resistant to penicillins(41.6), tetracyclins (12.5) and sulphonamides (0).Sulphonamides as a whole showed very less sensitivity(43.7 for Staphylococcus, 53.3 for Klebsialla and 0 forPseudomonas). Aminoglycosides (Gentamycin andamikacin) showed very good sensitivity (100 forStaphylococcus, 100 for Klebsiella 93.75 forpseudomonas and 87 for streptococcus pneumoniae) andso did the quinolones (Ciprofloxacin, Ofloxacin,Levofloxacin and Gatifloxacin) with 96.85forStaphylococcus, 97.45 forKlebsialla, 87.5 forPseudomonas and 79 for staphylococcus pneumoniae.Especially, Levofloxacin and Gentamicin was seen to besensitive in 100 persent of the cases of community

acquired pneumonia. In Staphylococcal infectionCeftriaxone and Gatifloxacin also showed 100 persentsensitivity and in klebsiellaspamikacin also showed 100persentsensitivity.

CHART 3 :AVERAGE SENSITIVITY OFANTIBIOTICS

DiscussionTrue incidence of community acquired pneumonia

(CAP) is exactly not known. Overall estimates of annualincidence of community-acquired pneumonia varybetween 2 and 12 cases per 1000, being highest in infantsand in the elderly. Relatively few pathogens cause mostcases. They are bacterial organisms like Streptococcuspneumoniae, Haemophilus influenzae, Staphylococcusaureus, Klebsiella pneumoniae and Pseudomonasaeruginosa. Atypical organisms like Mycoplasmapneumoniae, Legionella pneumoniae, Chlamydia,respiratory viruses (e.g., influenza viruses). Anaerobes play


a significant role in CAP only when aspiration occurs daysto weeks before presentation10.

In a study in Sher-i-Kashmir Institute of MedicalSciences Soura, Srinagar from December 1998 toDecember 2000, pseudomonas aeuroginosa was thecommonest pathogen (10/29) to cause CAP followed bystaphylococcus aureus (7/29), Escherichia coli (6/29),Klebsiellaspp (3/29), streptococcus pyogenes (1/29),streptococcus pneumonia (1/29) and Acinobacterspp (1/29) respectively11.

In another study in Shimla, Himachal Pradesh, 70cases of CAP were studied where 53(75%) showedsputum positivity and Streptococcus pneumonia was themost common microorganism with 19 (35.8%) casesfollowed by Klebsiellaspp 12 (22%), Staphylococcusaureus 9 (17%), Mycoplasma pneumonia 8 (15%),Escherichia coli 6 (11%), Beta-haemolytic streptococci4 (7.5%) and Gram negative bacilli 5 (9%)12.

Another study of 233 consecutive patients withpneumonia was done in Ludhiana. Most commonmicroorganisms involved were Pseudomonasaeruginosa,Streptococcus pneumoniae, Staphylococcusaureus, Klebsiella, pneumoniae, other gramnegativeorganisms, fungi like candida albicans andAspergillusfumigatus respectively. No etiological diagnosiscould be made in 52.3% cases. Best antibiotic sensitivityresults for organisms isolated from sputum culture werefrom third generationcephalosporins followed byflouroquinolones and aminoglycosides13.

ConclusionThe study conducted over a period of one year

showed preponderance of four main bacterial agentes asthe main etiological microbes behind community acquiredpneumonia in areas in and around Fakharuddin Ali AhmedMedical College and Hospital in the district of Barpeta ofLower Assam. They are Staphylococcus sp (53%),Klebsiella sp (31%), Streptococcus pneumonia (8%) andPseudomonas sp (8%). The average age of presentation ofcases with pneumonia due to Staphylococcal sp was foundout to be 37 yrs, with those due to Klebsiella sp was 44yrs, with those due to Pseudomonas sp was 53 yrs andwith those due to Streptococcus pneumoniae was 55 yrs.The average sensitivity of antibiotics was found to be verypositive, indicating that this region has been relatively lessinvaded by resistant microbial flora. Aminoglycosides(Gentamycin and amikacin) and quinolones (Ciprofloxacin,Ofloxacin, Levofloxacin and Gatifloxacin) showed very good

sensitivity results whereas sulphonamides and macrolidesshowed lesser sensitivity results.References :1. G.L.Mandell, J.E.Bennett, R.Dolin. Principles and

practice of infectious diseases, seventh edition, AcutePneumonia Chapter 64, page 891.

2. AlakaDeshpande,Epidemiology of CommunityAcquired Pneumonia, Journal of Association ofPhysicians of India, special edition on communityacquired pneumonia, volume 60, January 2012.

3. SubhakarKandi,Diagnosis of Community AcquiredPneumonia,Journal of Association of Physicians ofIndia, special edition on community acquiredpneumonia, volume 60, January 2012.

4. D.Baid. Mackie & McCartney Practical MedicalMicrobiology, Chapter 11, page 245

5. P.W.Ross. Mackie & McCartney Practical MedicalMicrobiology, Chapter 12, page 263

6. Pamela B. Crichton. Mackie & McCartney PracticalMedical Microbiology, Chapter 20, page 368

7. J.R.W.Govan. Mackie & McCartney PracticalMedical Microbiology, Chapter 23, page 413

8. J.G.Collee, W. Marr, Specimen collection, culturecontainers and media, Mackie & McCartney PracticalMedical Microbiology, Chapter 5, page 107.

9. WHO Expert Committee on Biological Standardisation1983 Requirements for antimicrobic susceptibility testsI. Agar diffusion tests using antimicrobic susceptibilitydiscs. Technical Report Serise, 687, Annex 5, pp 175-178. WHO, Geneva.

10. Rajendra Prasad, Community Acquired Pneumonia:Clinical Manifestations, Journal of Association ofPhysicians of India, special edition on communityacquired pneumonia, volume 60, January 2012.

11. Shah BA, Singh G, Naik MA, Dhobi GN,Bacteriological and clinical profile of Communityacquired pneumonia in hospitalized patients, Lung India,Year 2010, Volume 27, Issue : 2, Page : 54-57

12. Bansal S, Kashyap S, Pal LS, Goyal A, Clinical andBacteriological profile of community acquiredpneumonia in Shimla, Himachal Pradesh, Indian JChest Dis Allied Sci, 2004 Jan-Mar, 46 (1) : 17-22.

13. Oberoi A, Aggarwal A, Bacteriological Profile,Serology and AntibioticSensitivity Pattern of Micro-organisms from Community Acquired Pneumonia, JKScience April-June 2006, Vol 8, No 2, page 79-82.


Hypertension the “Iceberg Phenomenon”Accidental Detection of Hypertension among the

OPD Attendance in AMCHS M Baruah*, B S Sangma**


AbstractObjective: To study the incidence of hypertension among the OPD attendance of AMCH.Methods: A total of 3115 ( Male: 1673 Female:1442) aged > 12 years were randomly selected fromthe patients attending the Medicine OPD irrespective of the disease. Blood pressure measured as perguideline by JNC VII.Results: The incidence of newly detected hypertension showed an upward trend with age, the percent-age of hypertension in males (73.99 %) compared to females (59.22%); prehypertension (31.13%)compared to stage I and stage II hypertension.Conclusion: The incidence of hypertension and prehypertension in the study population are alarminglyhigh and remained unnoticed. So routine check up of blood pressure and mass awareness towards thispandemic is the need of the hour.

*Assistant Prfessor Department of Medicine, **PGT,Department of Medicine, Assam Medical College,Dibrugarh. Email : [email protected]

KEYWORDS: Hypertension, prehypertension, JNCVII.

INTRODUCTIONHypertension is a chronic condition of concern due

to its role in the causation of coronary heart diseases, strokeand other vascular complications. It is the commonestcardiovascular disorder posing a major public challengeto the population in socioeconomic and epidemiologicaltransition. It is one of the major risk factors forcardiovascular mortality, which accounts for 20-50% ofall deaths1.

The technological and economical development inthe nation have reduced the physical activity of the peopleto a very large extent and increased the alcohol andtobacco use. The prevalence of hypertension among adultsin developed countries is 25%2. Similar prevalence hasalso been observed in developing countries ranging from10% to 20%3.

Chronic Non-Communicable diseases are assuminggreater importance among adult population in developedas well as developing countries. The prevalence of chronicdiseases such as hypertension, diabetes mellitus etc, isshowing an upward trend in most countries. The mainfactors responsible for this rising trend are changing lifestyles, obesity, and behavior pattern of people etc4.

Chronic non communicable diseases (NCDs)contributed to 35 of the 58 million deaths (60.3%) in theworld in 2005. 80 per cent of these deaths occurred inlow and middle income countries. Based on availabletrends, by 2020 NCDs are predicted to account for 73%of deaths and 60% of disease burden. In India, NCDswere responsible for 53 per cent of deaths and 44 percent of disability adjusted life years lost5.

Hypertension is the commonest cardiovasculardisorder, posing a major public health challenge topopulation in socioeconomic and epidemiologicaltransition. It is one of the major risk factor forcardiovascular mortality, which accounts for 20-50% ofall deaths. Developed countries are considering it as aleading cause of death but even developing countries do


not lag behind in being affected by it6.In a meta-analysis of 34 epidemiological studies from

rural and urban populations of India, it was observed thathypertension is emerging as a major public health problemin India and is more prevalent among urban peoplecompared to those of rural area7.

The Joint National Committee reports on prevention,detection, evaluation and treatment of high blood pressure(JNC – VI & VII) emphasized the necessity of clinicians’appropriate judgment of their patients in diagnosis andtreatment.

Hypertension was defined as systolic BP>140 anddiastolic BP>90 mmHg (Seventh Joint National Committeeon prevention, detection, evaluation and treatment ofhypertension, JNC –VII)8

Material and methodObjective: To study the accidental detection ofhypertension among OPD attendance of AMCH.Place of study: Assam Medical College and HospitalStudy population: Patients coming to Medicine OPD.Sample size: Total of 3115 cases were studied.Duration: One year from March 2011- March 2012.Inclusion criteria: All the patients coming to MedicineOPD irrespective of their diseases.Exclusion criteria: Known hypertensive on medication.Data collection:

The data was recorded in a structured and pre-testedschedule. Blood pressure was measured as per standardguidelines by JNC VII. Hypertension defined as per the– Joint National Committee VII Criteria 9.

Results and ObservationsAge and sex wise prevalence of hypertension ( Table 1)

Age Male Female Total( yrs) No. HT % No. HT % No. HTN %13-20 50 14 28% 81 16 19.75% 131 30 22.90%21-30 292 177 60.61% 255 109 42.74% 547 286 52.28%31-40 323 213 65.94% 325 197 60.61% 648 410 63.27%41-50 337 253 75.07% 306 217 70.91% 643 470 73.09%51-60 250 199 79.6% 148 126 85.13% 398 325 81.65%>60 232 193 83.18% 154 116 75.32% 386 309 80.05%Total 1484 1049 70.68% 1269 781 61.54% 2753 1830 66.47%

Distribution of subjects according to JNC VII Criteria ( table 2)

JNC VII Category Male Female Total

Normal 435 488 923

Pre hypertension 533 437 970

Stage I hypertension 279 135 414

Stage II hypertension 147 130 277

Isolated systolic hypertension 279 252 531

Total 1673 1442 3115


Drug history- Chronic use of NSAID, steroid, OCPetc not found.

Out of 3115 adults included in the study, 2,092individuals (67.15%) were found to be suffering fromhypertension. Among 1673 males 1238 (73.99%) andamong 1442 females 854 (59.22%) were found to besuffering from hypertension. The majority of hypertensives67.15% had both systolic and diastolic hypertensionfollowed by 531 (37%) had isolated systolic hypertension.

Among 1673 males studies, 533(31%) wereprehypertensive ( systolic 120-139 mm Hg and diastolic80-89 mmHg) followed by 279 (16%) were Stage Ihypertension ( Systolic 140-159 and diastolic 90-99mmHg) and 147(8%) were Stage II hypertension(Systolic>160 and diastolic>100) and 279 (16.67%) hadisolated hypertension.

Of 1442 females studied, 437 (30%) wereprehypertensive ( systolic 120-139 mm Hg and diastolic80-89 mmHg) followed by 135 (9.36%) were Stage Ihypertension ( Systolic 140-159 and diastolic 90-99mmHg) and 130(9.01%) were Stage II hypertension(Systolic>160 and diastolic>100) and 252 (17.47%) hadisolated hypertension. Diabetes mellitus was found in10.27% of the study population.

DiscussionsIt has been observed from table 1 that the prevalence

rate of hypertension shows an upward trend as the ageadvances in males as well as in females. This differencewas found to be statistically significant (p<0.39), whichindicates that age and sex have some influence in theassociation of hypertension. This proportionate increasehas also been observed in many other studies. Joshi et al4

observed in a study in Mumbai that there was as increasingtrend of hypertension as the age advances and even in thepost menopausal women, similar finding was alsocontributed by Shakuntala Choklingam10 among bothsexes.

Prevalence of hypertension was significantly higherin males than females. Similar findings reported by GuptaR et al11 and Guang Hui Dong 12. All the studies agreewith the fact that prevalence of hypertension increaseswith age. Age probably represents accumulation ofenvironmental influences and the effect of geneticallyprogrammed senescence in the body systems13.

Prevalence of pre hypertension was more comparedto stage 1 and stage II upto the age of 51-60 years.Mohan V et al14 reported similar trends. So there inincreased chances of those having pre hypertension todevelop stage I and stage II hypertension. Henceidentification of pre hypertension at 30-40 years is crucialto prevent development of hypertension.

Isolated systolic hypertension was found to be higherin females (17.47%) compared to males (16.67%) . Postmenopausal changes may be contributory for the aboveobservations.

In our study we have got less number of diabeticpatient as co morbidity probably due to the fact thatmajority of diabetic patient attend diabetic clinic insteadof medicine clinic and moreover and many diabetic patientsare known hypertensive which were excluded.

ConclusionPrehypertension and hypertension is common in

patients attending Medicine OPD for other reasons. Thosepatients seeking medical attention for only hypertension

Co- morbidities:

Known Diabetic Mellitus 320

Known Renal Disease Nil

Known IHD Nil


are just the tip of the ice berg, majority of the patientsremains undiagnosed unless routine checkup is done toall..

Prehypertension has been identified as an importantprecursor of hypertension as most of them developedhypertension by 60 years of age. Hence identification ofsubjects with pre hypertension around 30 years of ageusing high risk strategy of prevention of hypertensionamong them is important to prevent the emerging pandemicof hypertension. So routine check up of blood pressureand mass awareness towards this alarming situation is theneed of the hour.

Reference :1. Park K, Park’s Textbook of Preventive and Social

Medicine 18th Edition, M/S Banarasidas BhanotPublishers, 2005; Jabalpur-482001; p 293.

2. World health Organization : Community Preventionand Control of Cardiovascular Diseases: WHO TechRep series 1986;732.

3. World health Organization : Primary Prevention ofEssential Hypertension: WHO Tech Rep Series1983;685.

4. Joshi S V, Patel J C, Dhar H C- The study ofprevalence of hypertension in Mumbai, The Indianmedical Journal 2000-Jan-380-83.

5. Reddy K S, Shah B, Varghese C- Responding tothe threat of chronic diseases in India. Lancet 2005;366:1744-9.

6. Kulkarni A T. Hypertension- a silent killer, IndianMedical Gazzette 1998; 32(3):73-77.

7. Gupta R. Meta-analysis of prevalence ofhypertension in India. Indian Heart Journal 1997;49:43-48.

8. Park K, Park’s Textbook of Preventive and SocialMedicine 18th Edition, M/S Banarasidas BhanotPublishers, 2005; Jabalpur-482001; p 293.

9. Chobinian AV, Bakris GL, Black HR- The Seventhreport of the Joint national Committee on Prevention,Detection, Evaluation and Treatment of High BloodPressure: The JNC 7 Report, JAMA 2003;289:2560-2572.

10. Singh RB, Ghosh S, Niaz MA. Validation of physicalactivity and socio economic status questionnaire inrelation to food intakes for the five city and proposedclassification for Indians. J Assoc Physicians India1997; 45: 603-606.

11. Shakuntala Choklingam, Jayalakshmi R, ArunChokalingam WHL News Letter- 69/2000-Scientific News- Prevalence of hypertension in ruraltown of Tamil Nadu.

12. Gupta R et al. Prevalence and determinants ofcoronary heart disease in rural population of India. JClin Epidemiol 1997; 50(2):203-209.

13. Guang Hui Dong, Zhao Qing Sun, Xin Zhong Zhang,Jia Jin li ,Qiang heng , Jeu Li et al Prevalence,awareness,treatment and control of hypertension inrural Liaoning Province, China, Indian J Med Res2008;128;122-127.

14. Yadav S, Boddula R, Genitta G , Bhatia V, BansalB, Kongara S, et al. Prevalence and risk factor ofpre hypertension in affluent north Indian Population.Indian J Med Res 2008;128:712-20.


Multivessel Angioplasty Versus CABG Surgery inCAD – An Evidence Based Perspective


rapid advances have made it impossible to comparecontemporary strategies in randomized control trialsbecause by the time the results are published the strategiesare no longer contemporary.CURRENT EVIDENCE

There have been seven randomized, controlled trialscomparing CABG with balloon angioplasty (6-12), fourcomparing CABG with PCI and placement of bare metalStents (13-16), and one comparing CABG with PCI andplacement of drug-eluting stents (17). Most of these trialsshowed CABG and PCI to be equivalent strategies as faras Major Adverse Cardiovascular Events (MACE) i.e.cardiovascular death, and non-fatal myocardial infarctionare considered. There was a higher incidence of strokeswith CABG but a significantly higher rate ofrevascularization with PCI. A survival advantage withCABG was seen in the Stent or Surgery trial (SoS) (14)

and in the subgroup with treated diabetes in the BypassAngioplasty Revascularization Intervention trial (18).A meta-analysis of these trials, which included 7812patients, showed a trend toward a survival advantage withCABG (19). In a subgroup analysis according to thepresence or absence of diabetes, there was a survivaladvantage with CABG among patients who had diabetes,whereas there was no significant advantage among patientswho did not have diabetes. Among patients younger than55 years of age, there was a trend toward a benefit withPCI as compared with CABG, whereas among patientsolder than 65 years of age, mortality was significantlyhigher with PCI. This meta-analysis did not include theSYNTAX Trial (17) a landmark trial in which contemporarymethods of revascularization were used. This trial lead todevelopment of an angiographic scoring system knownas SYNTAX SCORE which divide patients into threegroups based on their score a high score of >/= 33; anintermediate score of 23-32 and a low score of <22. TheSYNTAX SCORE can be calculated online or from adownloadable version available at www.syntaxscore.com.This important trial was basically designed to prove non-inferiority of PCI compared to CABG in about 1800patients with three-vessel or left main disease. At one yearthe PCI failed to reach the non-inferiority mark and theauthors of the trial concluded, “CABG remains thestandard of care for patients with three-vessel or leftmain coronary artery disease, since the use of CABG,as compared with PCI, resulted in lower rates of the

combined end point of major adverse cardiac orcerebrovascular events at 1 year.” This trial generateda heated debate in the cardiology community with eachgroup using it to make his point. While as at it’s face valuethe trial appeared to be a clear verdict in favour of CABGthe interventional cardiology community was quick to pointthat this failure to reach non-inferiority was largely due tohigher repeat revascularization rate in the PCI arm. As faras so-called “hard end-points” of cardiovascular deathand MI was concerned there was no difference betweenPCI and CABG and strokes were clearly more in patientswith CABG. This enthusiasm on part of interventionalcardiologists has been however dampened by the 3 and4 year results of the trial which show a continuingdivergence between the CABG and PCI graphs and aclearly emerging mortality benefit for CABG even in thegroup with intermediate score for which both strategiesare considered possible on the basis of completeness ofrevascularization provided. This emerging mortality benefitfor CABG has been substantiate by recently publishedASCERT Trial (20) which showed a clear-cut mortalitybenefit of CABG in elderly patients with multi-vessel CAD.This therefore is the current evidence on which decisionabout the suitable revascularization strategy has to be madein a CAD patient with multivessel CAD.PRACTICE POINTS BASED ON CURRENTEVIDENCE:• Importance of ischemic burden: The adverseimpact of demonstrable ischaemia on clinical outcome[death, myocardial infarction (MI), ACS, occurrence ofangina] has been well recognized for over two decades.While symptomatic patients with no or little evidence ofischaemia have no prognostic benefit fromrevascularization, asymptomatic patients with a significantmass of ischaemic myocardium do. Most recently, in asmall nuclear substudy of the COURAGE trial (whichreported no overall survival benefit of PCI over OMT),involving just over 300 patients, 100 patients with >10%ischaemic myocardium had a lower risk of death or MIwith revascularization (21). Thus when selecting arevascularization strategy one has to be clear whetherthe revascularization is being done for improvingoutcomes (prognostic revascularization), or forimproving symptoms (symptomaticrevascularization). The amount of ischemic burden isan important parameter to help answer this important


question.• Prognostic Revascularization.According to the current ESC revascularization guidelinesthere are five situations where revascularization improvesprognosis which are:-1) Left main disease with >50% stenosis2) Any Proximal LAD with >50% stenosis3) 2 or 3 vessel disease with LV dysfunction4) Proven large area of ischemia (at least 10% of LV)5) Single remaining patent vessel with > 50% stenosis.It is important to know that for any stenosis between 50and 90% it is important to either have evidence of definiteischemia or the significance of the lesion should bedocumented in the lab by a physiological study duringangiography (current gold standard is a Fractional FlowReserve (FFR) of < 0.8).• Patient PreferenceThere is currently much emphasis laid on patient preferenceand involving patient in the ultimate decision makingprocess. Patient is provided with evidence and facts whichhelp him to make informed decision.• Current Recommendations.As per the current recommendations in multivesseldisease:-1) Patient with 2 VD with involvement of proximal LADshould preferably go for CABG (IA) but PCI is anacceptable alternative (IIaB)2) Patient with 3 VD who has simple lesions and fullvascularization is possible with PCI with a SYNTAX score<22 should also preferably receive CABG (IA) but PCIis again an acceptable alternative (IIaB).3) Patients with 3VD with complex lesions, completerevascularization with PCI not possible and SYNTAXSCORE > 22 should clearly receive CABG (IA); PCI inthese patients is an inappropriate revascularization strategy(IIIA).Optimal Medical Therapy (OMT)

This includes use of (1) aspirin (2) statin at sufficientdosage to maintain a LDL target of < 70 mg (3) ACEinhibitor (4) achieve a BP goal <130/80 mm HG (5)achieve a HBA1C target of <7% in diabetes mellitus (6)dietary modifications (7) physical exercise of 30 to 45minutes on most days of the week (8) smoking cessation. Besides angioplasty or CABG surgery these essentialmeasures forms an integral part of the prescription of allCAD patients irrespective of the revascularization strategychosen .

REFERENCES:1) Guidelines on myocardial revascularization: The Task

Force on Myocardial Revascularization of the Eu-ropean Society of Cardiology (ESC) and the Euro-pean Association for Cardio-Thoracic Surgery(EACTS); European Heart Journal (2010) 31,2501–2555.

2) James H. O’Keefe, MD, Maia D. Carter, MD,MPH, and Carl J. Lavie, MD: Primary and Sec-ondary Prevention of Cardiovascular Diseases: APractical Evidence-Based Approach; Mayo ClinProc. 2009 August; 84(8): 741–757.

3) The Heart Outcomes Prevention Evaluation StudyInvestigators: Effects of an Angiotensin ConvertingEnzyme Inhibitor, Ramipril on Cardiovascular Eventsin High-Risk Patients: N Engl J Med 2000; 342:145-153 January 20, 2000.

4) Dee, R (2003). “Who Assisted Whom?”. Tex HeartInst J (Houston: Texas Heart Institute) 30 (1): 90

5) Gruntzig A. Transluminal dilatation of coronary-ar-tery stenosis. Lancet 1978;1:263.

6) King SB III, Lembo NJ, Weintraub WS, et al. Arandomized trial comparing coronary angioplastywith coronary bypass surgery. N Engl J Med1994;331:1044-50.

7) Hamm CW, Reimers J, Ischinger T, Rupprecht HJ,Berger J, Bleifeld W. A randomized study of coro-nary angioplasty compared with bypass surgery inpatients with symptomatic multivessel coronary dis-ease. N Engl J Med 1994;331:1037-43.

8) First-year results of CABRI (Coronary Angioplastyversus Bypass Revascularisation Investigation). Lan-cet 1995;346:1179-84.

9) Coronary angioplasty versus coronary artery bypasssurgery: the Randomized Intervention Treatment ofAngina (RITA) trial. Lancet 1993;341:573-80.

10) Rodriguez A, Boullon F, Perez-Baliño N, PaviottiC, Liprandi MI, Palacios IF. Argentine randomizedtrial of percutaneous transluminal coronaryangioplasty versus coronary artery bypass surgeryin multivessel disease (ERACI): in-hospital resultsand 1-year follow-up. J Am Coll Cardiol1993;22:1060-7.

11) The Bypass Angioplasty Revascularization Investi-gation (BARI) Investigators. Comparison of coro-nary bypass surgery with angioplasty in patients withmultivessel disease. N Engl J Med 1996; 335:217-


25. [Erratum, N Engl J Med 1997; 336:147.]12) Carrié D, Elbaz M, Puel J, et al. Five year outcome

after coronary angioplasty versus bypass surgery inmultivessel coronary artery disease: results from theFrench Monocentric Study. Circulation 1997;96:Suppl:II-1–II-6.

13) Serruys PW, Unger F, Sousa JE, et al. Comparisonof coronary-artery bypass surgery and stenting forthe treatment of multivessel disease. N Engl J Med2001; 344:1117-24.

14) SoS Investigators. Coronary artery bypass surgeryversus percutaneous coronary intervention with stentimplantation in patients with multivessel coronaryartery disease (the Stent or Surgery trial): arandomised controlled trial. Lancet 2002; 360:965-70.

15) Rodriguez A, Bernardi V, Navia J, et al. Argentinerandomized study: coronary angioplasty with stentingversus coronary bypass surgery in patients withmultiplevessel disease (ERACI II): 30-day andoneyear follow-up results. J Am Coll Cardiol2001;37:51-8. [Erratum, J Am Coll Cardiol2001;37:973-4.]

16) Hueb W, Lopes NH, Gersh BJ, et al. Five-yearfollow-up of the Medicine, Angioplasty, or SurgeryStudy (MASS II): a randomized controlled clinicaltrial of 3 therapeutic strategies for multivesselcoronary artery disease. Circulation 2007;

115:1082-9.17) Serruys PW, Morice MC, Kappetein AP, et al. Per-

cutaneous coronary intervention versus coronary-artery bypass grafting for severe coronary artery dis-ease. N Engl J Med 2009;360:961-72.

18) Seven-year outcome in the Bypass AngioplastyRevascularization Investigation (BARI) by treatmentand diabetic status. J Am Coll Cardiol2000;35:1122-9.

19) Hlatky MA, Boothroyd DB, Bravata DM, et al.Coronary artery bypass surgery compared withpercutaneous coronary interventions for multivesseldisease: a collaborative analysis of individual patientdata from ten randomised trials. Lancet2009;373:1190-7.

20) William S. Weintraub, M.D., Maria V. Grau-Sepulveda, M.D., M.P.H., Jocelyn M. Weiss,Ph.D.et.al: Comparative Effectiveness ofRevascularization Strategies: N Engl J Med2012;366:1467-76.

21) Shaw LJ, Berman DS, Maron DJ, Mancini GB, etal. : Optimal medical therapy with or without percu-taneous coronary intervention to reduce ischemic bur-den: results from the Clinical Outcomes UtilizingRevascularization and Aggressive Drug Evaluation(COURAGE) trial nuclear substudy. Circulation2008;117:1283–1291.


C a s e R e p o r t

An Unusual Case of Pyoderma GangrenosumFollowing Surgery for Appendicitis

K Chakravarty*, S O’Rourke, S Parnell**

Case ReportA 59- year old, previously fit, male presented to

Accident and Emergency with an 18 hour history of sharp,stabbing right iliac fossa pain. Acute appendicitis wassuspected clinically and an open appendectomy wasperformed although at laparotomy the appendix lookednormal. The patient was prescribed Augmentin postoperatively and discharged home 4- days post-surgery.

Three days later the patient presented again ataccident and emergency with a painful, angry lookingerythematous dehiscing, wound which was dischargingpurulent material. There was also a rapid spread of thelesion which was looking like a necrotic ulcer. The patientwas readmitted and, a computed tomography scan of theabdomen and pelvis was performed and no intra pelvic

*Dame Carol Black Professor of Rheumatology andConsultant, BHRT University Hospital, Post GraduateMedical School, University of Bedfordshire, London,UK.. **Medical Student Rheumatology, St.Bartholomew and the Royal London School ofMedicine and Dentistry, London , UK.

abnormalities were noted including collections.Additionally the histology of the appendix was reportedto be normal. At this time the patient wassuspected tohave ‘necrotising fasciitis’ possibly due to a streptococcalinfection and was given a course of Flucoxacillin 2g,Clindamycin 600mg and Ceftriaxole 2g.

The following day a wound exploration anddebridement of the right iliac fossa was performed. Twofurther operations were performed to further debride thewound. The wound covered 10-15% of the body surfaceand appeared tobe oedematouswith diffusecellulitis andpaud’orange,with gangrenearound thewound edge.(figure 1)

Six daysafter admissionthe patient had

Fig 1: CT scan of Abdomen showing arounded high density shadow in the para-colic fat but no evidence of peritonitis.

ABSTRACT :We describe a case of rapidly growing necrotic ulcer at the site of a surgical Incision at the right inguinal

region, which was initially considered to be ‘necrotising fasciitis’ requiring prolonged antibiotic therapy with nosuccess. After exhaustive treatment and failed therapies with conventional drugs rheumatology opinion wassought. It was clear that although the ulcer looked like a ‘flesh eating ulcer’ the aetiology was unlikely to beinfection. The biopsy confirmed the clinical suspicion of pyoderma gangrenosum (PG). The ulcer was consideredto be the result of an immune mediated aetiology and immune suppression with cyclical methyl prednisoloneand cyclophosphamide produced near complete healing. However as the ultimate closure of the wound wastaking longer than expected, an attempt was made to try anti TNF therapy. Unfortunately despite treatmentwith etanercept there was no sign of any significant progress. It is curious that despite initial improvement withcyclical cyclophosphamide and methyl prednisolone the patient failed to produce any response to etanercept.The exact diagnosis of this persistent non healing ulcer remains obscure and a tentative diagnosis of PyodermaGangrenosum has been entertained as suggested on histology. Some cases of PG have shown response to antiTNF therapy but our case is unusual as it failed to show any sustained beneficial effect.


scrotal swelling, and appearance of cellulitic changes inthe left and right ante-cubital fossae and upper forearms.A further operation was performed to debride left andright antecubital fossa in an attempt to stop the spread ofthe necrotising fasciitis (figure 2) and he was transferredto the intensive therapy unit.

T h epatient didnot haveany historyo fdiabetes,arthritis orinflammatoryb o w e ld i s e a s e .But it wasrevea ledthat aprevious

laparotomy for duodenal ulcer 10 years prior resulted ina post operative wound with MRSA sepsis and severescarring. In addition to this it was discovered that hismotherhad experienced two similar episodes of poorwound healing which were treated with hyperbaric oxygentherapy more than two decades ago at a different hospital.Wound swabs did not culture any microorganisms and thepatient remained apyrexial throughout the illness.Investigations including full blood count on repeatedoccasion were essentially normal except the persistentlyelevated white cell count50 x 109 /l (NR < 11),despite theaggressive antibiotic therapy. His urea, electrolytes,liverfunctions including alkaline phosphatase were all normal onrepeated occasions besides thorough immunological screenincluding anti neutrophil cytoplasmic(ANCA) antibodies.

Inflammatory markers such as erythrocytesedimentation rate and C-reactive protein were elevated

at 110mm/1st hour(NR 0-10) and341 mg/l (NR 0-5mg/l)respectively. At this point the case was discussed with therheumatology department who suggested the diagnosisof possible immune mediated disease and PG. The surgicalteam was advised to give a therapeutic trial of one gramof intravenous methyl prednisolone pulse.

The effect of the pulse was dramatic with a rapidclinical response and a week later the patient was observedto be slowly responding to the steroid treatment. The rapidresponse to systemic steroid suggested an immune aetiologyand the clinical presentation seemed to be of an acutepanniculitis. The methylprednisolone was increased to 1gon alternate days for three days and the patient wasdischarged from the intensive therapy unit with advise totake oral prednisolone.

His case was reviewed by the rheumatologists andthe antibiotics were stopped and a two month course oforal prednisolone 20mg was prescribed.The patient slowlyimproved whilst on the steroid therapy, with a decrease inthe size of the ulcerative lesions. After a year of alterationsin steroid dosing Cyclophosphamide 100mg was addedto manage the remaining superficial ulcers(Fig 4&5).

Fig 2: Showing the abdominal and arm wounds

Fig3: Showing progressive improvement in theabdominal and arm wound after steroid infusionand cyclophosphamide after 1year.

Fig 4: The Histology of debrided tissue showing acute andchronic inflammatory infiltrate in dermis and subcutaneous fat


(Figure 4: Healed ulcer in Antecubital Fossa (Fig- 5) Whenthe patient was seen in clinic 2 months later the ulcersappeared somewhat larger and intermittent cyclical infusionwith cyclophosphamide and methylprednisolone wasorganised for the first three months to reinduce remissionof the active tissue damage . However the ulcer respondedpoorly when he was switched on to Anti TNF therapywith moderate response after 7- subcutaneous injections.

However when seen in clinic 3- months later theulcers were getting progressively worse despite etanerceptand methotrexate treatment. The decision to discontinueanti TNF was made at this juncture and reintroduction ofcyclophosphamide and methylprednisolone pulse wasmade with good response.

The ulcer has now almost healed completely on thiscyclical pulse but we have found no report of any suchcase in the literature.Discussion :

Our case describes a rare diagnostic problem ofrapidly progressive painful aggressive skin ulcer, almostlike a ‘flesh eating ulcer’arising from the site of incisionalinjury, following surgery for suspected organ involvement,hitherto unreported in the literature. A number of differentconditions can imitate the appearance of such a skin ulcersuch as venous or arterial insufficiency (including anti-phospholipid antibody associated occlusive disease),vasculitis, malignancy, insect bites; infectious diseases anddrug reactions1. However none of the reported causeswere found in our case and the diagnosis of PG was madeas a method of exclusion with support from histology,which was nonspecific.

PG was first coined by Brunsting in 1939(2). Thisrare non-infectious condition is classed as a primary sterileinflammatory neutrophilicdermatosis which leads to painfululceration of the skin. The condition most commonlyaffects adults between the ages of 25 and 54 years3.

The condition had been linked to a number ofdifferent disorders such as, inflammatory bowel disease,rheumatological conditions, visceral carcinomata,haematological diseases and in cases of abnormal immunefunction, such as human immunodeficency virus (HIV),HTLV infection, sarcoidosis, hereditaryhypogammaglobulinemia as well as iatorgenic immunesuppression 4.In approximately 50% of cases of PG thespontaneous appearance of pustules can relate to anunderlying systemic disease. Conversely the presentation

of the ulcerative lesions may arise as a pathergic responseto trauma in normal appearing skin, in a phenomenonknown as Pathergic PG3.

This condition can be broken down into four differenthistological and clinical subtypes, namely; ulcerative (seenin lower extremities and trunk); pustular (strong link toinflammatory bowel disease); bullous (link to underlyingmyeloproliferative disorders) and vegetative (commonlywith no associated disease)5.6. Diagnosis of the conditionis clinical and based on exclusion of other conditions. It isnot dependant on histopathological findings, which in manycases are non specific and can show similarity to otherconditions7.

The pathogenesis of PG is not clear and a number offactors have been implicated, many of which relate tounderlying systemic diseases. Ineffective cell mediatedimmunity has been implicated in some patients, as well asthe possibility of perivascular deposits of immunoreactants,such as IgM, C3 and firbin, leading to the propogation oflesions in some patients4. In our case we had no evidenceof any chronic or acute systemic disease.

In this case report, we discuss a man with thedevelopment of PG post operatively with suspectedacute appendicitis although there was no such findingat the time of laparatomy.10. As a diagnostic approachthe consideration of necrotising fasciitis was notunexpected although there was no evidence of any infectionanywhere.

PG is often poorly treated as the pathology of thecondition is unclear. At present there is no gold standardfor the treatment of this condition. Initially it is importantthat all differential diagnoses are excluded and underlyingcauses treated before other treatment including activeimmunosuppression is commenced.

Wound management is an important component tothe treatment of a patient with PG. Close observation andregular measurements with clinical photography of thelesions are necessary. Appropriate dressing to create abarrier to infection is particularly important as the treatmentof PG may include drug therapy that reduces the patient’sability to respond appropriately to bacterial invasion ofthe wound.

Topical treatments can be used for small superficiallesions or as an adjuvant to systemic therapies in severePG for example tacrolimus, cyclosporine and intralesionalcorticosteroids injections.


Systemic treatment with immune modulators is the mainstay of treatment for established PG.12 High dose oralsteroids are usually needed to induce remission and cangive a rapid response but due to the long term side effectsof steroids they should be reduced and removed as soonas possible. It has also been shown that intravenousmethylprednisolone pulse therapy can be useful in casesthat do not respond to oral steroids13. In steroid resistantPG, Cyclosporine is the most common alternative and is aneffective steroid sparing therapy but other possibilitiesinclude methotrexate, cyclophosphamide, thalidomide andazothiaprin.12, 14 Due to the risks involved with long termimmunosuppressants intravenous immunoglobulin hasproven to be useful as an adjuvant therapy. Skin graftinghas been used for repair of ulcers and hyperbaric oxygentherapy has been used with some benefit.

The recent advances of biologic treatment haveshown that tumour necrosis factora antagonists areeffective in the treatment of PG. These TNF-α antagonistsare widely recognised and employed for the treatment ofmany autoimmune conditions. Infliximab and etanerceptare the most common biologics employed in the treatmentof PG15. Etanercept is a fusion protein made of theextracellular ligand-binding part of the human TNFαreceptor and the Fc part of human IgG, it competes withTNFα for cellular receptors and interferes with the TNFαmediated inflammatory pathway. There are reported casesof the successful use of etanercept in PG ,16-18 and a briefseries which describes the use of etanercept in refractorypyoderma gangrenosum reports 73% of ulcers completelyhealing19. Infliximab is a chimeric monoclonal antibodymade of a human IgG constant region and a variable murinebinding site for TNFα . A randomised placebo controlledtrial for the use of Infliximab in pyoderma gangrenosumshowed a 69% response and a 21% remission rate.14

However the use of TNFα antagonists has beenassociated with endothelial dysfunction and accelerationof atherosclerosis increasing the risk of myocardialinfarction and stroke.

Our case highlights the refractory nature of PG insome patients who may sometime fail with evenimmunotherapy. The initial favourable response tointravenous steroids and cyclophosphamide raises thequestion as to why anti-TNF therapy did not work.Therefore the diagnosis of PG alone seems less likelyalthough further skin biopsies are being considered forreassessment of histological outcome.

References :1. Wollina, U. Pyoderma gangrenosum—a review.

Orphanet J Rare Dis 2, 19 (2007).2. Brunsting, L., Goeckerman, W. & O’Leary, P. Pyo-

derma [ecthyma] gangrenosum: CLinical and experi-mental observations in five cases occuring in adults.Arch Dermatol Syph 22, 655-680 (1930).

3. Powell, F.C., Su, W.P. & Perry, H.O. Pyodermagangrenosum: classification and management. J AmAcad Dermatol 34, 395-409; quiz 410-2 (1996).

4. Crowson, A.N., Mihm, M.C. & Magro, C. Pyo-derma gangrenosum: a review. J Cutan Pathol 30,97-107 (2003).

5. Ahmadi, S. & Powell, F.C. Pyoderma gangrenosum:uncommon presentations. Clin Dermatol 23, 612-20 (2005).

6. Su, W.P., Schroeter, A.L., Perry, H.O. & Powell,F.C. Histopathologic and immunopathologic studyof pyoderma gangrenosum. J Cutan Pathol 13,323-30 (1986).

7. Wines, N., Wines, M. & Ryman, W. Understandingpyoderma gangrenosum: a review. MedGenMed 3,6 (2001).

8. Brooklyn, T., Dunnill, G. & Probert, C. Diagnosisand treatment of pyoderma gangrenosum. BMJ 333,181-4 (2006).

9. Callen, J.P. Pyoderma gangrenosum. Lancet 351,581-5 (1998).

10. Baldea, A. & Gamelli, R.L. Postoperative pyodermagangrenosum after elective abdominoplasty: a casereport and review of the literature. J Burn Care Res31, 959-63 (2010).

11. Hasham, S., Matteucci, P., Stanley, P.R. & Hart,N.B. in BMJ 830-3 (England, 2005).

12. Miller, J., Yentzer, B.A., Clark, A., Jorizzo, J.L. &Feldman, S.R. in J Am Acad Dermatol 646-54 (2009American Academy of Dermatology, Inc. Publishedby Mosby, Inc, United States, 2010).

13. Chow, R.K. & Ho, V.C. in J Am Acad Dermatol1047-60 (United States, 1996).

14. Brooklyn, T.N. et al. in Gut 505-9 (England, 2006).15. Karampetsou, M.P., Liossis, S.N. & Sfikakis, P.P.

in QJM 917-28 (England, 2010).16. Pastor, N. et al. in Clin Exp Dermatol 152-3 (En-

gland, 2006).17. Rogge, F.J., Pacifico, M. & Kang, N. in J Plast

Reconstr Aesthet Surg 431-3 (Netherlands, 2008).18. Roy, D.B., Conte, E.T. & Cohen, D.J. in J Am Acad

Dermatol S128-34 (United States, 2006).19. Charles, C.A., Leon, A., Banta, M.R. & Kirsner,

R.S. in Int J Dermatol 1095-9 (United States, 2007).


ABSTRACT :Device closure for Secundum ASD’s percutaneously in the Cardiac Cath Lab is the therapy of choice inselected cases with suitable anatomy. In this case report, we have successfully closed a Secundum ASDin a middle aged lady without any minor or major complication by transcatheter device closure.

C a s e R e p o r t

Percutaneous Transcatheter Technique using SeptalOccluder Device, an Accepted Alternative toSurgery for Treatment of Ostium Secundum

ASD’s, a case report from our Initial ExperienceP J Bhattacharyya*, A K Bhattacharyya**

KEY WORDS : Ostium Secundum ASD, Adult ,Percutaneous transcatheter device closure.

Atrial septal defect accounts for about one third ofthe cases of congenital heart disease detected in adults. Itis two to three times more common in women comparedto men. (1) The most common type is the secundum ASD,which occurs in the region of the fossa ovalis andrepresents approximately 75% of all cases.(2) PrimumASDs, sinus venosus and coronary sinus defects are lesscommon. Transcatheter closure is possible only for thesecundum type. This is mainly because of the lack ofsufficient rims surrounding the defect to anchor the deviceor due to associated defects such as cleft atrioventricularvalves or anomalous drainage of pulmonary veins requiringopen surgical repair in the other defects.An unrepairedASD can lead to left-to-right shunt, secondary rightventricular volume overload, and pulmonaryovercirculation. This leads to right-sided heart failure andoccasionally pulmonary arterial hypertension due toirreversible pulmonary vascular disease. Patients’symptoms may include dyspnoea, fatigue, or palpitations.Atrial fibrillation and atrial flutter are commonconsequences of long-standing untreated ASD.(3)

*MD, DM, Assistant Professor, GMC, Ph: 94355-55572/94357-46654, E-mail : [email protected],**MD, DM, Professor; Department of Cardiology,Gauhati Medical College.

Symptoms commonly get worse with increasing age, evenwith smaller defects, due to an increase in left-to-rightshunt caused by changes in ventricular compliance withage.(4)Though early mortality of secundum ASD due tothe defect is not considerable, nearly 90% of these patientsdie by the time they reach age of 60 years.

Transcatheter or surgical closure of an ASD isindicated if there is evidence of right-sided volumeoverload on echocardiography .(5) Other indications forASD closure include the presence of significant left-to-right shunt, defined as a pulmonary-to-systemic flow (Qp/Qs) ratio of > 1.5 : 1, and the occurrence of paradoxicalembolism or documented orthodeoxia-platypnoeasyndrome. Surgical closure is preferred for non-secundumASDs or if surgical repair for associated defects is needed.Important prerequisites for ASD closure are pulmonaryarterial pressures less than two-third systemic and apulmonary vascular resistance <7 Woods units. Atrialseptal defect closure in patients with severe irreversiblepulmonary arterial hypertension is contraindicated, as itmay shorten their life-expectancy compared to unrepaireddefects.(6)

Conventional atreatment with surgery through amedian sternotomy using cardiopulmonary bypass isconsidered the gold standard for ASD for more than 45years. With recent advances in interventional cardiology,device closure through the transcatheter technique is now


made possible and has become an accepted alternativeto open heart surgery, especially in isolated OstiumSecundum ASD’s. The advantages of device closurecompared with open surgery are shorter hospital stay,earlier return to normal activities, better cosmetic resultsand fewer complications.Case Report :

This 50 years old non hypertensive, non diabetic ladyfrom Sarbhog, Barpeta District, was referred from aprivate hospital as a case of Secundum ASD for furtherevaluation and treatment. Her chief complaints were easyfatiguability for last 4 years and progressive shortness ofbreath on exertion for last 1 year.

ECG showed incomplete RBBB, sinus rhythm andCrochetage sign (notch near the apex of the R wave ininferior leads ) (Fig. 1). CXR revealed cardiomegaly,

dilated MPA and pulmonary plethora (Fig.2). 2D Echodone outside revealed RA / RV enlargement, Mild TR,PASP = 46 mmHg, Mean PAP = 12 mmHg, 15 mmOstium Secundum ASD with left to right shunt.

On examination in the OPD, Pulse rate of 80/min,BP 130/80 mmHg, Lungs – clear, CVS – Ejection systolicmurmur with wide and fixed split of 2nd heart sound. She

was admitted for review TTE (Transthoracicechocardiography), TEE (TransesophagealEchocardiography), detailed Cath study and Coronaryangiography.

Review 2D Echocardiography showed RA / RVdilated, mild TR; RVSP = RAP + 28 mmHg, 18 mmOstium Secundum ASD with left to right shunt,normal LV systolic function and no additional defects(Figure 3-A & Figure 3-B).

Relevant pre catheterization physical and biochemicaldata were Hemoglobin of 12.3 g/dl, weight 52 Kgs, Height156 cm and heart rate of 80 /min. Cath study showed Qp/ Qs = 1.60, PVR of 2.1 Wood units, significant step upin blood oxygen saturation at mid RA level (13 % step upfrom SVC to RA level) and SVC to PA (> 10 % stepup). Coronary angiography showed normal epicardialcoronary arteries (Figure 4-(a) & Figure 4-(b). A decision

Figure 1 : ECG showing incomplete RBBB, sinus rhythm, crochetage sign

Figure 2 : CXR - showing cardiomegaly, dilated MPA, pulmonary plethora

Fig.3(A) : ECHO showing OS ASD, dilated RA / RV

Figure 3 (B) : Mild TR; RVSP = RAP + 28 mmHg


was taken to take up the patient for ASD device closure.Pre procedure TEE (Transesophageal echocardiography)was done which revealed 18 mm ostium secundum ASDwith left to right shunt and adequate margins and normalpulmonary venous drainage.

After obtaining written informed consent,transcatheter closure of ASD was planned using CocoonSeptal Occluder (Vascular Innovations Co. Ltd, Thailand)(Fig.5). The patient received pre procedure intravenousCeftriaxone injection. During the procedure intravenousunfractionated heparin (5000 IU) was used to achieve

Figure 4 (a) : Coronary Angiography showingnormal left coronary system

Figure 4 (b) : Normal Right coronary artery

Figure 5 : ASD Device (Cocoon Septal Occluder)

Figure 6 : showing ASD device in situ after releasefrom delivery cable which were delivered via 12 Fdelivery sheath; TTE probe also seen in the picture.

ACT (Activated clotting time) of > 250 secs. Device sizingwas done using the formula 1.05 X echocardiographicdiameter + 5.49 mm and accordingly a size 24 mm devicewas selected.

Vascular access was obtained via the right femoralvein and a size 24 mm device using 12 French deliverysystem was successfully deployed across the ostiumsecundum ASD under fluoroscopic and transthoracic echoguidance without any residual shunt (Fig. 6). The


procedure was done under local anesthesia without anysedatives and without using TEE. No peri proceduralcomplications were noted.

Patient was discharged on day 3 with dual antiplatelettherapy (Aspirin 325 mg for 6 months and Clopidogrel75 mg for first 3 months) and advised IE prophylaxis asindicated for at least next 6 months. She was asked tocome for check up after 1 month.

On follow up at 1 month and 4 months she is doingwell with marked improvement of her initial symptoms.Review echocardiography showed no residual shunt.Discussion :

Device closure for Ostium Secundum ASD’spercutaneously in the Cardiac Cath Lab under fluoroscopyand TEE / TTE is the therapy of choice in selected caseswith suitable anatomy. The maximum size of deviceavailable is 40 mm (Cocoon Septal Occluder).

Balloon sizing of the defect has been regarded as anintegral part of transcatheter closure of ASD. The selecteddevice is usually identical to or 2 mm larger than thestretched balloon diameter (SBD).(7) (8) However, ASDdevice closure is being increasingly done without balloonsizing using various imaging modalities ( TEE, TTE, Intracardiac echo).(9) (10)Possible disadvantages of balloonsizing include causing enlargement of the defect by tearingof the flap valve of the septum primum, bradycardia andhypotension during prolonged balloon inflation due toobstruction in diastolic filling, damage to the inter atrialseptum and inaccurate measurements secondary toinadequate profiling of the defect and the measuringballoon catheter.(10) (11) (12) Trans thoracic echo (TTE)can be used to predict the stretched balloon diameter(SBD). Rao and Langhough proposed an equation of SBD= 1.05 X echocardiographic diameter + 5.49 mm toadequately determine device size without using balloonsizing during the procedure.(12)

In this case report from our initial experience, wehave successfully closed an Ostium Secundum ASD in amiddle aged women without any minor or majorcomplication by transcatheter device closure. Particularlynoteworthy is that we used TTE instead of TEE forpositioning of the device during implantation and to checkwhether there is any residual shunt present or not andensured better comfort for the patient.

After device closure, patients require 6 months ofantiplatelet therapy and IE prophylaxis until the device

endothelizes. After that period if there is no residual shunt,patients do not require IE prophylaxis. (5)

Major complications (Device embolization, atrialperforation, thrombus formation (13)) occur in < 1% ofpatients and clinical closure achieved in > 90% of patients.Device closure of an ASD improves functional status insymptomatic patients and exercise capacity inasymptomatic patients. Intermediate follow up data haveproved ASD device closure to be safe and effective (14),result in better preservation of RV function (15) and lowercomplications rate compared to surgery (16).Conclusion :

In view of the high rates of complete closure andbecause it can be performed without general anesthesia,without cardiopulmonary bypass and without an incision,this technique is now considered to be an effective andsafe alternative to conventional surgical closure in selectedcases of ostium secundum ASD’s . The cost of deviceclosure is comparable to open surgical repair. Also, whencompared to surgery, percutaneous device closure ofostium secundum ASD’s result in shorter hospital stay,earlier return to normal activities, better cosmetic resultsand fewer complications.

References :1. Brickner ME, Hillis LD, Lange RA, et al. Congenital

Heart Disease in Adults). N Engl J Med 2000;342:256-263.

2. Fuster V, Brandenburg RO, McGoon DC, GiulianiER. Clinical approach and management of congenitalheart disease in the adolescent and adult. CardiovascClin 1980;10:161–197.

3. Craig RJ, Selzer A. Natural history and prognosis ofatrial septal defect. Circulation 1968;37:805–815.

4. Booth DC, Wisenbaugh T, Smith M, DeMaria AN.Left ventricular distensibility and passive elasticstiffness in atrial septal defect. J Am Coll Cardiol1988;12:1231–1236.

5. Warnes CA, Williams RG, Bashore TM, Child JS,Connolly HM, Dearani JA, del Nido P, Fasules JW,Graham TP Jr, Hijazi ZM, Hunt SA, King ME,Landzberg MJ, Miner PD, Radford MJ, Walsh EP,Webb GD. ACC/AHA 2008 Guidelines for theManagement of Adults with Congenital HeartDisease. Circulation 2008;118: e714–e833.

6. Steele PM, Fuster V, Cohen M, Ritter DG, McGoon


DC. Isolated atrial septal defect with pulmonaryvascular obstructive disease—long-term follow-upand prediction of outcome after surgical correction.Circulation 1987;76:1037–1042.

7. Du ZD, Cao Q, Rhodes J, Heitschmidt M, HijaziZM. Choice of size and results of transcatheterclosure of atrial septal defect using the Amplatzerseptal occlude. J Interv Cardiol;15:287-92.

8. Harper RW, Mottram PM, Mc Gaw DJ. Closure ofsecundum atrial septal defect using the Amplatzerseptal occlude device : Techniques and problems.Catheter Cardiovasc Interv 2002; 57 : 508-24.

9. Amin Z, Daufors DA. Balloon sizing is not necessaryfor closure of secundum atrial septal defects. J AmColl Cardiol 2005; 45 : 317

10. Gupta SK, Sivasankaran S, Harikrishnan S, et al.Transcatheter closure of atrial septal defect : Balloonsizing or no balloon sizing – a single centreexperience. Annals of Pediatric Cardiol 2011 Vol 4Issue 1; 28-33.

11. Harikrishnan S, Narayanan NK, SivasabramonianS. Sizing balloon induced tear of the atrial septum. JInvasive Cardiol 2005; 17 : 546-7.

12. Rao PS, Langhough R. Relationship ofechocardiographic, shunt flow, and angiographic sizeto the stretched diameter of the atrial septal defect.Am Heart J 1991; 122 : 505-8.

13. Krumsdorf U, Ostermayer S, Billinger K, et al:Incidence and clinical course of thrombus formationon atrial septal defect and patent foramen ovaleclosure devices in 1,000 consecutive patients. J AmColl Cardiol 43:302, 2004.

14. Masura J, Gavora P, Podnar T : Long-term outcomeof transcatheter secundum type atrial septal defectclosure using Amplatzer septal occluders. J Am CollCardiol 45:505,2005.

15. Cheung YF, Lun KS, Chau AK : Doppler tissueimaging analysis of ventricular function after surgicaland transcatheter closure of atrial septal defect. AmJ Cardiol 93:375; 2004.

16. Butera G, Carminiti M, Chessa M, et al :Percutaneous vs surgical closure of secundum atrialseptal defect : comparison of early results andcomplications. Am Heart J 151 :228, 2006.

Organizing committee of 22nd APICON, Assam cordially invites all Physicians, PGstudents and general practitioners of NE Region to Jorhat on 22nd and 23 December, 2012.

The Theme of the conference will be to disseminate current knowledge and devel-opments of Clinical medicine as relevant to the needs of the practicing physicians and PGstudents.

Highlight of the scientific sessions: A host of Guest speakers of National andInternational repute in Diabetology,cardiology,endocrinology,gestroenterology,respiratorymedicine, Neurology and basic science.

· Workshop on ECG and Artificial ventilation.

· Interactive sessions and debate in common clinical problems.

· A medicine update will be published.

· Post Graduates papers.

ANNOUNCEMENT

Conference Secretariat :Dr. P. K. BaruahOrganising SecretaryNEIST, Jorhat-6Mobile 9435353226E-mail : [email protected]


C a s e R e p o r t

Pulmonary Endometriosis : A Case Report

N B Boruah*, A M Boruah**, J N Sarmabordoloi***

KEY WOEDS: Endometriosis, Haemoptysis

INTRODUCTION:Endometriosis is an enigmatic disease affecting 10%

of women of reproductive years. It is typically defined asthe presence of ectopic endometrium [endometrial glandsand stroma] in areas other than the inner surface of theuterus. The incidence of this disorder is graduallyincreasing among the adolescent group with increasingawareness and improved diagnostic amenities. However,atypical presentations continue to elude medical fraternityeven today. The importance of this entity needs to bestressed across different disciplines as initial presentationcan be varied and misleading. The classical triad ofendometriosis is “dysmenorrhea, dyspareunia &menorrhagia” combined with infertility in reproductiveyears, though the disease exhibits a broad spectrum ofclinical signs and symptoms. The pathogenesis and naturalhistory of endometriosis remain poorly understood. Thereis no specific treatment for endometriosis even today andit is mostly symptomatic, i.e. .treatment for associatedpain& infertility and other symptoms. Here, we arereporting a case of “Pulmonary Endometriosis”presented with cyclical haemoptysis.CASE REPORT:

Mrs. Bina B, aged 36yrs and mother of two children,

*MD; ** MD, Ph D, FICOG; ***MD,MNAS,Sampreeti Hospital, A.T Road, Kanak Nagar,Sivasagar, Assam, 785640, [email protected];Ph.9435057483.

both delivered normally presented with cyclicalhaemoptysis and menorrhagia for last 4yrs, lasting for 5to 7 days with spontaneous remissions in between. Therewas no history of chronic cough, fever, weight loss, lossof appetite, difficulty in breathing, awareness of heart beat,gastro-intestinal symptoms, or bleeding diathesis. She wasnot addicted to alcohol, tobacco or any other drugs. Sheattended local health unit and was referred for DOTtherapy. She was subsequently referred to level III carefor her persistent haemoptysis which was graduallyincreasing in volume since the onset of the disease. Differenttherapies including ATT failed to curtail the disease process.

Her general health condition was below average withhaemoglobin of 9 gm%. She had mild hypertension andother systemic examination did not reveal any abnormality.However, pelvic examination revealed retroverted uteruswith reduced mobility and indurations in the pouch ofdouglas suggesting either PID or Pelvic Endometriosis orsecondary deposits. She had undergone three MTP’sbefore and Laparoscopic Ligation was done in 2003, atcamp setting. After Initial investigations for HeavyMenstrual Bleeding she was referred for an ENTconsultation keeping haemoptysis in mind. Her bloodbiochemistry [CBC, RFT, LFT, TSH, PLATELETCOUNT, APTT, INR,] were within range, except lowhaemoglobin, low ferritin and ESR of 40 AEFH. P-A viewof the chest X-ray did not reveal any abnormality. Aftercompletion of her initial work- up a diagnosis of IronDeficiency Anemia with? Pulmonary endometriosis wasmade. She was asked to come back during her next cyclewith anthelmintics,haematinics and protein supplementation

ABSTRACT :Endometriosis continues to amaze medical fraternity during reproductive years with bizarre

presentation and accordingly multidisciplinary approach is recommended. Haemoptysis whichis not so alarming, cyclical in nature with spontaneous remission should arouse suspicion for anextra-pulmonary origin.


as a co-prescription. We carried out examination of thesmears of sputum under gram stain, haematoxylein andeosin &Papanocolaou’s stain.To our expectation we coulddemonstrate endometrial cells in the smear. Subsequently,CT Thorax revealed a small right apical cavity and ourinitial clinical diagnosis of Pulmonary Endometriosis gainedstrength.

A decision to get the apical portion of the right lungexcised and confirm the diagnosis of PulmonaryEndometriosis by histopathological examination wasplanned in consultation with Cardio-thoracic surgeon, butcould not be executed due to various reasons. She wasput on Inj Depo-Provera to attain amenorrhoea andcalcium supplentation as an add-on therapy. She was freefrom her symptoms of haemoptysis and menorrhagia fornext two years. We repeated the regimen to establish apseudomenopausal state and keep her free from hersymptoms.

DISCUSSION:Repeated haemoptysis concurrent with menstrual

flow (“catamenial haemoptysis”) is a rare presentation ofthoracic endometriosis, [1,2] with fewer than 20 cases havingbeen reported in English literature[3]. The most of the casesof pulmonary endometriosis involve distal pulmonaryparenchyma rather than large airways [4]. The diagnosisof catamenial haemoptysis is often clinical [4]. Chestradiographs are often normal and CT findings may includeill-defined or well-defined opacities, nodular lesions, thin-walled cavities, or bullous formations [5,6].Elliot et alsuggested that CT scanning is the method of choice inconfirming the diagnosis provided that it is performedduring the period of haemoptysis [4]. Although definitehistological evidence of endometriosis was not obtained

in this case, the cytological features are sufficient to warrantthe diagnosis. Current treatment regimens of pulmonaryendometriosis include danazol and gonadotropin releasinghormone (GnRH) analogues [7,8]. The results obtained withthese regimens suggested an improvement in the courseof the disease, although the incidence of recurrence is high[7]. We preferred Inj Depo-Provera over danazol andGnRH analogues for the simple reason of economy whileobtaining the same success rate with no immediate side-effects.

REFERENCES:1. Rodman MH, Jones CW. Catamenialhaemoptysis

due to bronchial endometriosis. N Engl J Med1962;266: 805-8

2. Bateman ED. Morrison SC.Catamenialhaemoptysisfrom endobronchialendometriosis: a case report and review of previousreported cases. Respir Med 1990;84: 157-61

3. Wood DJ, Krishnan K et al. Catamenialhaemoptysis:a rare cause. Thorax1993;48:1048-9

4. Elliot DL, Barker AF et al. Catamenialhaemoptysis.New methods of diagnosis and therapy. Chest1985;87:687-8

5. Katoh O, Yamada H et al. Utility of angiograms inpatients with catamenialhaemoptysis. Chest 1990;98:1296-7

6. Volkart JR. CT findings in Pulmonary endometriosis.J Comput Assist Tomogr 1995;19:156-9

7. Guidry GG, George RB. Diagnostic studies incatamenialhaemoptysis. Chest 1990;98:260-1

8. Marc A. Fritz and Leon Speroff, 2011, Eighthedition. Clinical GynaecologicEndocrionology andInfertility; 1221-1247


C a s e R e p o r t

A Case of Tuberous Sclerosis Presenting withChildhood Seizures

P Bhattacharjee*, P Das, B K Nath**, A Kalwar***

KEY WORDS: Tuberous sclerosis, Shagreen patch,adenoma sebaceum, ash leaf macules.

Introduction:Tuberous Sclerosis is a complex genetic disorder first

recognised as a specific disease early in the 19th century.Even though Rayer was the first to describe this condition,it was Bournville who classified it as a distinct entity. LaterSherlock coined the word ‘epiloia’ to indicate thediagnostic triad of epilepsy, low intelligence and adenomasebaceum.1 It is an autosomal dominant disorder occurringin approximately 1 in 5000 to 1 in 10,000 live births.2 Itis characterized by multisystem involvement secondary todefects in cellular migration, proliferation anddifferentiation. We present the case of a young boy whopresented with recurrent seizures and characteristic skinlesions.Case report:

Our case was a 14 year old muslim boy, hailing fromBhaga Bazaar in Cacher District who presented to us witha history of abnormal movements of the body since 9months of age with progressive mental retardation. Historyof sudden onset of tonic contractions of the body

*Professor and Head, **Assistant Professor,***Registrar, Department of Medicine, Silchar MedicalCollege. P/O- Ghungoor ; Dist: Cachar, Assam; Pin-788014. Ph no. 9435072176, E-mail:[email protected]

ABSTRACT :Tuberous sclerosis is a neurocutaneous disorder occurring in approximately 1 in 5000 to 10,000 live

births. A 14 year old muslim boy presented with recurrent seizures since childhood with progressivemental retardation and characteristic skin lesions. Non enhanced computerised axial scans of brain show-ing multiple calcified nodules in the subependymal regions. He was diagnosed as a case of tuberoussclerosis, started on anti convulsants and advised follow up ultrasonography at regular intervals.

associated with tongue bite, frothing from mouth, urinaryincontinence and postictal confusion confirmed theabnormal movements to be generalised tonic clonicseizures. The frequency of seizures increased from 1-2episodes per fortnight at the onset to about one episodeevery 3-4 days. The boy’s mother gave a history of hislacking behind in studies as compared to other studentsof his class. There was no significant past history. Theboy was a non vegetarian taking average Indian diet,gaining weight normally, born by spontaneous vaginaldelivery at Silchar Medical College and Hospital with noperi partum complications. There was no history of similarillness in the family.

Onexamination,patient looked ill,with a pulse of82/min, BP-110/70mmHg, RR-1 8 / m i n ,temperature-98.7oF, noicterus, pallor,oedema ordehydra t ion .S h a g r e e n ’ spatch (Fig.1)was seen on hisback and Fig.1: Shagreen Patch


Fig.2: Adenoma sebaceum Fig.3: Ash Leaf MaculesAdenoma sebaceum (Fig.2) over the face. Ash leafmacules (Fig.3) were also seen on his back. Chest,cardiovascular and gastrointestinal examination revealedno abnormalities. His neurologic examination revealedmental retardation Fundoscopic examination was normal.Investigations were as follows:TLC - 18,580/cummHb - 12.3gm/dlESR - 25mmAEFHRBS - 99mg/dlSerum Urea- 27mg/dlSerum Creatinine-0.8mg/dlNa+-131mmol/L, K+-4.2mmol/LUrine Examination: Protein-2+Chest radiographs: Normal Study

Ultrasonography of the abdomen:Normal StudyNECT Brain: Multiple calcifiednodules in subependymal region –bilateral body of lateral ventricles andanother calcified nodule in the lefttrigone(87×67mm)(Fig.4)

He was managed conservativelyand seizures controlled withantiepileptics. He was discharged withadvice to continue antiepileptics andfollow up ultrasonography at regularintervals.Discussion:

Tuberous Sclerosis is a neurocutaneous disorder inheritedas an autosomal dominant trait with a variable penetrance.Two genes responsible for tuberous sclerosis includeTSC1(located at chrosome 9q34) and TSC2(located atchromosome 16p13.3).TSC1 gene is more responsiblefor familial cases of tuberous sclerosis.3 In approximately75 percent cases, attention is first drawn to the diseaseinitially by occurance of focal or generalized seizures orby slowed psychomotor development.4 TuberousSclerosis is not a very common cause of seizures in thispart of the world. Any child or young adult presentingwith seizures should be carefully examined for the presenceof cutaneous lesions that could lead to the diagnosis of aneurocutaneous syndrome, particularly tuberous sclerosis.Once diagnosed, a case of tuberous sclerosis should be

periodically monitored with ultrasonography orCT Scan for renal neoplasms.

Fig.4: Calcified subependymal nodules in NECT Brain

References:1. Morgan JE, Wolfort F, The early

history of tuberous sclerosis. ArchDermatol 1979;115:1317-9.

2. Harrison’s Principles of InternalMedicine, 18th edition;379:3390.

3. Weiner DM,Ewalt DE, Roach ES,Hensle TW. “The tuberous sclerosiscomplex, a comprehensive review”.J Am Coll Surg 1998;187:548-61.

4. Adams and Victor’s Principles ofNeurology, 9th edition;38:978.


C o r r e s p o n d e n c e

Sir,We have read with interest the

article titled “Meliodosis presenting asSepsis Syndrome: A Case Presentation” byDrs B. Lahkar, R. Baruah. In this contextwe would like to point out that a case ofMeliodosis from Assam was previouslyreported by Dr. D. Bortakur in the Medicineupdate Vol - XI, 2008, Editor – DebabrataGoswami under the heading “ Melioidosisnot a known entity in Assam”. This casepresented with intracranial lesions with focalseizure and was subsequently diagnosed asa case of Melioidosis. We had alsomanaged a patient with melioidosis in 2008in Neurology Department, GauhatiMedical college. This patient presentedwith left focal seizures with generalizationwith evidence of osteomyelitis in theoverlying skull bone with splenic abscess .We initially treated him as tuberculosis buthe deteriorated. FNAC and culture fromthe cranial lesion revealed B. Pseudomallei.Patient recovered completely on treatmentwith Ceftazidime, Doxycline and Co-trimoxazole. We are sending here withphotograph (MRI) of the intracranial andsplenic lesions of our patient.Hence though rare, Melioidosis has beenseen previously in our state.

Anirban MahantaMarami Das

Munindra GoswamiA K Kayal

Department of NeurologyGauhati Medical College Hospital

Guwahati-32

Figure:1 Post contrast cranial MRI.

Figure 2: Abdominal MRI showing splenic abscess.

Melioidosis


1. Letter of submission.2. Copyright statement signed by all the authors.3. Three copies of manuscript with copies of illustrations attached to each.4. Title page

Title of manuscriptFull name(s) and affiliations of author (s); institution(s) and city(ies) from which workoriginated.Name, Address, Telephone, Fax numbers and e-mail address of corresponding author.Number of pages, number of figures and number of tables.

5. Structured abstract (objectives, methods, results, conclusion) alongwith title, and keywords

6. Article proper (double spaced on A/4 size paper).7. Acknowledgements (separate sheet).8. References (double spaced, separate sheet, Vancouver style).9. Maximum number of references for Original articles - 20, Short articles - 10, Case

reports - 6, Documentation - 3, Correspondence - 3.10. Each table on separate sheet.11. Figures/diagrams on separate sheet.12. Photographs in envelope appropriately marked.13. Covering letter signed by all authors confirming that they have read and approved the

contents and also confirming that the manuscript is not submitted or published elsewhere.14. Statement regarding Ethics Committee Approval and informed consent from subjects.15. CD's / DVD's are essential.16. Online submission : [email protected]. Mailing Address : Prof. Sanjeeb Kakati, Editor, Assam Journal of Internal Medicine,

Department of Medicine, Assam Medical College, Dibrugarh, Assam, India. PIN-786002.

Manuscript Submission : Check list for Contributors

Article SubmissionASSAM JOURNAL OF INTERNAL MEDICINE

assam journal of internal medic ine june, …assam journal of internal medic ine june, 2012 voi. 2...

Documents