felipe de moura messias - bibliotecatede.uninove.br de... · a parede abdominal anterior foi...
Post on 30-Dec-2018
227 Views
Preview:
TRANSCRIPT
1
UNIVERSIDADE NOVE DE JULHO
PROGRAMA DE PÓS GRADUAÇÃO EM CIÊNCIAS DA REABILITAÇÃO
AÇÃO DA TERAPIA LASER DE BAIXA POTÊNCIA NOS EFEITOS
DELETÉRIOS DA ISQUEMIA EM RINS DESTINADOS A TRANSPLANTE:
UM ESTUDO PRÉ-CLÍNICO.
FELIPE DE MOURA MESSIAS
São Paulo, SP
2012
2
FELIPE DE MOURA MESSIAS
AÇÃO DA TERAPIA LASER DE BAIXA POTÊNCIA NOS EFEITOS
DELETÉRIOS DA ISQUEMIA EM RINS DESTINADOS A TRANSPLANTE:
UM ESTUDO PRÉ-CLÍNICO.
Dissertação apresentada à
Universidade Nove de Julho, para
obtenção do título de Mestre em
Ciências da Reabilitação.
Orientador: Prof. Dr. Rodrigo Álvaro
Brandão Lopes Martins
São Paulo, SP
2012
3
FICHA CATALOGRÁFICA
Messias Felipe de Moura. Ação da terapia laser de baixa potência nos efeitos deletérios da isquemia em rins destinados a transplantes: um estudo pré clínico. / Felipe de Moura Messias. 2012. 93 f. Dissertação (mestrado) – Universidade Nove de Julho - UNINOVE, São Paulo, 2012. Orientador (a): Prof. Dr. Rodrigo Álvaro Brandão Lopes Martins.
1. Laserterapia. 2. Transplante renal. 3. Isquemia-reperfusão. I. Martins, Rodrigo Álvaro Brandão Lopes. II. Titulo
CDU 615.8
4
5
DEDICATÓRIA
Dedico este trabalho à meus pais Sueli e José por todo apoio e incentivo
sempre. Também à minha noiva Alessandra pelo carinho, compreensão e
ajuda nos momentos difíceis.
6
AGRADECIMENTOS
Agradeço primeiramente a Deus que me dá forças e me conduz no caminho
que ele mesmo trilhou pra mim.
Agradeço à meus pais Sueli e José pelo apoio, ajuda e palavras de conforto
nos momentos de cansaço, e palavras de incentivo que sempre valeram à
pena!
Agradeço à minha noiva Alessandra, minha companheira e melhor amiga, sem
o seu apoio nada seria possível.
Agradeço todo o corpo docente do Programa de Mestrado em Ciências da
Reabilitação por me auxiliar na construção do saber.
Agradeço à toda diretoria de Saúde da Uninove, principalmente a prof. Cinthya
Duran que foi a intermediadora e grande incentivadora para a realização deste
Mestrado.
Agradeço à todos os técnicos de laboratório da unidade Vergueiro que me
ajudaram e compreenderam meus momentos de ausência.
Agradeço aos amigos Patricia, Rodney, Tabata, Prof. Rodrigo Labat e Prof.
Ernesto que foram mais que amigos durante todo o trabalho.
Agradeço em especial ao meu orientador Prof. Dr. Rodrigo, que foi mais que
orientador e sim um grande amigo não somente durante o processo do
mestrado, mas para toda vida. Muito obrigado por todo esforço, dedicação e
compreensão.
Agradeço à Universidade Nove de Julho que me acolheu desde a graduação e
tem participação ativa na minha formação de vida.
7
RESUMO
Introdução. A lesão renal aguda (LRA) está associada a um grau elevado de
morbidez e mortalidade. A Isquemia e reperfusão (IR) é uma das principais
causas de LRA. Atualmente, especialmente a citocina inflamatória TNF-α,
parece estar envolvida na lesão e não há agentes farmacológicos que
comprovadamente possam prevenir a LRA após IR. Na última década, foi
demonstrado que a Terapia Laser de Baixa Potência (LLLT) é capaz de inibir
os marcadores inflamatórios incluindo citocinas (TNF-α e IL-1). Objetivos. Nós
investigamos o efeito da LLLT em citocinas inflamatórias em rim de rato após
isquemia prolongada. Métodos. Após a aprovação do Comitê de Ética para
Uso de Animais, ratos Wistar foram anestesiados com cetamina mais xilazina.
A parede abdominal anterior foi incisionada na linha mediana. Ambos os rins
foram retirados e colocados imediatamente em solução nutritiva gelada.
Grupos tratados receberam a terapia a laser com 1,3,6 e 10 Joules de energia
em momentos diferentes. Depois de 2, 12 e 24 horas os rins foram fixados para
análise histológica e bioquímica. No grupo tratado a laser, uma dose de energia
de 3 Joules foi entregue em dois pontos centralmente e, bilateralmente, 5 min
após a reperfusão. Resultados. A análise bioquímica não revelou alterações
significativas para as citocinas inflamatórias após a laserterapia. A avaliação
morfológica demonstrou uma melhor organização tecidual nos grupos tratados
com laser. Conclusões. Os resultados demonstraram que LLLT foi capaz de
preservar o tecido renal de isquemia induzida por lesão.
Palavras-chave: Terapia Laser de Baixa Potência; Transplante Renal;
Isquemia-reperfusão.
8
ABSTRACT
Introduction. Acute Kidney injury (AKI) is associated with a high degree of
morbidity and mortality. Ischaemia-reperfusion injury (IRI) is one of the major
causes of AKI. Currently, inflammatory cytokines specially TNF-α, seems to be
involved in the injury and no pharmacological agents have proven to prevent
AKI after IRI. In the last decade we demonstrated that LLLT is able to inhibit
inflammatory markers including cytokines (TNF-α and IL-1 for example). Aims.
Here we investigate the effect of LLLT on inflammatory cytokines in Rat kidney
after prolonged ischemia. Methods. After approval of the Ethical Committee for
Animal Use, Male Wistar rats were taken to the experiment table and
anaesthetized with ketamine plus xilazyne. The anterior abdominal wall was
incised on the median line. Both kidneys were excised and immediately placed
in cold nutritive solution. Treated groups received laser therapy with 1,3,6 and
10 Joules of energy in different times. After 2, 12 and 24 hours the kidneys were
fixed for histological and biochemical analysis. In the laser treated group, an
energy dose of 3 Joules was delivered in two points centrally and bilaterally, 5
min after reperfusion. Results. Biochemical analysis revealed no significant
alterations for inflammatory cytokines after LLLT. Morphological evaluation
demonstrated a better cell organization in the laser-treated groups.
Conclusion. Our results demonstrated that LLLT was able to preserve the
renal tissue from ischemia-induced lesions.
Keywords: Low Level Laser Therapy, Kidney Transplant, Ischaemia-reperfusion
9
ÍNDICE
1. Contextualização 14
1.1. Transplantes Renais 15
1.2. Terapia Laser de Baixa Potência 19
2. Objetivos 21
2.1. Objetivo Geral 21
2.2. Objetivo Específico 21
3. Método 22
3.1. Aspectos Éticos 22
3.2. Modelo Experimental 22
3.3. Processamento Histológico 23
4. Resultados / Artigo 25
4.1. Resumo 27
4.2. Abstract 28
4.3. Introdução 29
4.4. Material e Métodos 32
4.4.1.Dosagem de Citocinas Inflamatórias 33
4.4.2. Processamento Histológico 33
4.5. Resultados 35
4.5.1. Análise Histopatológica 35
4.5.2. Dosagem de Citocinas Inflamatórias 45
4.6. Discussão 50
4.7. Conclusões 53
4.8. Referências Bibliográficas 54
5. Considerações Finais 59
6. Referências Bibliográficas 7. Apêndices
60
65
10
LISTA DE TABELAS E QUADROS
TABELA 01. Número de Transplantes de órgãos Sólidos durante o 3° trimestre
de 2012.
TABELA 02. Dados do censo de diálise de 2011
QUADRO 01. Resumo das principais características histopatológicas – Grupo 2
Horas
QUADRO 02. Resumo das principais características histopatológicas – Grupo
12 Horas
QUADRO 03. Resumo das principais características histopatológicas – Grupo
24 Horas
11
LISTA DE FIGURAS
Figura 01. Cortes histológicos de rim mostrando as regiões cortical (A-D) e
medular (E-F) coradas pelos métodos do HE (A, C, E) e do picrossírius (B, D,
F), Observar em A-B, um corpúsculo renal em condições de normalidade sem
espessamento de suas membranas (seta) no glomérulo renal (Grupo - 01
Joule). Observar em C-D um corpúsculo renal com glomerulopatia
membranosa leve, evidenciado pelo espessamento das membranas (seta) do
glomérulo (Grupo - Controle). Observar em E-F os túbulos coletores em
condições de normalidade, assim como o tecido intersticial (seta).
Figura 2. Cortes histológicos de rim mostrando a região medular corados pelo
método do HE com diferentes características de necrose tubular aguda.
Observar em A uma congestão vascular (seta) (Grupo - Controle). Em B é
mostrado cortes transversais de túbulos contorcidos proximais e distais com
material granuloso e vacuolização no citosol de células em processo de
degeneração (seta) (Grupo - Controle). Em C é mostrado túbulos com material
hialino descamado no lúmen (seta) (Grupo - 03 Joules). Em D é mostrado
algumas alça de Henle preenchido com material hialino e células degeneradas
(seta) (Grupo - Controle).
Figura 3. Cortes histológicos de rim corados pelo método do HE, onde A –
Controle; B – 01 Joule; C – 03 Joules; D – 06 Joules, E – 10 Joules, referentes
ao protocolo de 2 horas.
Figura 4. Cortes histológicos de rim corados pelo método do HE, onde A –
Controle; B – 01 Joule; C – 03 Joules; D – 06 Joules, E – 10 Joules, referentes
ao protocolo de 12 horas.
Figura 5. Cortes histológicos de rim corados pelo método do HE, onde A –
Controle; B – 01 Joule; C – 03 Joules; D – 06 Joules, E – 10 Joules, referentes
ao protocolo de 24 horas.
12
Figura 06 - Dosagem de interleucina – 1 (IL-1) nos tempos de 2 (Painel A), 12
(Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de 06
rins. * p < 0,05
Figura 07 - Dosagem de interleucina – 6 (IL-6) nos tempos de 2 (Painel A), 12
(Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de 06
rins. * p < 0,05
Figura 08 - Dosagem de interleucina – 10 (IL-10) nos tempos de 2 (Painel A),
12 (Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de
06 rins. * p < 0,05
Figura 09 - Dosagem de TNF-alfa nos tempos de 2 (Painel A), 12 (Painel B) e
24 horas (Painel C). Os valores representam a média + EPM de 06 rins. * p <
0,05
13
LISTA DE ABREVIATURAS
ABTO – Associação Brasileira de Transplantes de Órgãos
AH – Alça de Henle
ATN – Necrose Tubular Aguda
ATP – Trifosfato de adenosina
cm2 – centímetro quadrado
CN – Condições de Normalidade
COX 2 – Ciclooxigenase 2
CP – Corpúsculo Renal
DC – Dutos coletores
DRC – Doença Renal Crônica
HE – Hematoxilina Eosina
IL 1 – Interleucina 1
IL 10 – Interleucina 10
IL 6 – Interleucina 6
IRA – Insuficiência Renal Aguda
IRI – Isquemia Reperfusão Renal
J – Joule
LIR – Lesão de Isquemia e Reperfusão
LLLT – Laser de Baixa Intensidade
LRA – Lesão Renal Aguda
MMPs – Matriz Metalloproteinases
mW – milliwatts
Nm – Nanômetros
14
RBT – Rede Brasileira de Transplantes
TCP – Túbulo Contorcido Proximal
TNF-α – Fator de Necrose Tumoral
UTI – Unidade de Terapia Intensiva
14
1. CONTEXTUALIZAÇÃO
Os rins são órgãos fundamentais para a manutenção da homeostase do
corpo humano. A diminuição progressiva da função renal acarreta o
comprometimento de essencialmente todos os outros órgãos do corpo humano.
A função renal é avaliada pela filtração glomerular (FG) e a sua diminuição é
observada na Doença Renal Crônica (DRC), associada à perda das funções
regulatórias, excretórias e endócrinas do rim. Quando a FG atinge valores
muito baixos, inferiores a 15 mL/min/1,73m2, estabelece-se o que
denominamos falência funcional renal (FFR), ou seja, o estágio mais avançado
do continuum de perda funcional progressiva observado na DRC. A DRC é,
atualmente, considerada um problema de saúde pública mundial. No Brasil, a
incidência e a prevalência de FFR estão aumentando, o prognóstico ainda é
ruim e os custos do tratamento da doença são altíssimos. O número projetado
atualmente para pacientes em tratamento dialítico e com transplante renal no
Brasil está próximo dos 120.000, a um custo de 1,4 bilhão de reais.
Independentemente da doença de base, os principais desfechos em pacientes
com DRC são as suas complicações (anemia, acidose metabólica, alteração do
metabolismo mineral e desnutrição), decorrentes da perda funcional renal, óbito
(principalmente por causas cardiovasculares) e FFR1.
A Lesão Renal Aguda (LRA) se caracteriza por uma redução abrupta da
função renal definida por aumento absoluto da creatinina sérica de pelo menos
0,3mg/dL, elevação de 50% (até 1,5 vez) do valor basal ou redução do fluxo
urinário, documentado como oligúria ou menor de 0,5mL/kg por hora por mais
de seis horas2.
A Insuficiência Renal Aguda (IRA) é caracterizada por uma redução
abrupta da função renal, que se mantém por períodos variáveis, resultando na
inabilidade dos rins em exercer suas funções básicas de excreção e
manutenção da homeostase hidroeletrolítica do organismo. A IRA se apresenta
em diversas formas clínicas, entre elas a IRA isquêmica e a nefrotóxica. Dentre
as etiologias de IRA renal, 62% são decorrentes de necrose tubular aguda
conseqüentes a causas isquêmicas (72%) e tóxicas (28%). No Brasil, em
estudo de Burdmann e cols. (1993), observou-se que as causas de IRA eram
15
predominantemente: sepse (33%), hipovolemia (33%), insuficiência cardíaca
descompensada (32%), nefrotoxicidade de drogas (27%), traumatismo cirúrgico
(13%) e hipotensão (20%), com grande ocorrência de associação de dois ou
mais desses fatores, e, de forma geral, a maior parte incorrendo em
hipoperfusão renal3.
O mecanismo de isquemia-reperfusão é a etiologia mais comumente
relacionada à lesão renal. Na isquemia, um dos eventos mais precoces é a
redução dos níveis intracelulares de ATP, que compromete preferencialmente
porções do néfron que possuem alta taxa de reabsorção tubular com gasto de
energia, como o túbulo proximal e a alça ascendente espessa de Henle. A
depleção de ATP desencadeia uma série de eventos, incluindo desestruturação
do citoesqueleto, perda da polaridade celular e interação célula-célula,
produção de espécies reativas de oxigênio, alterações do pH intracelular,
podendo culminar com morte celular2.
1.1 – Transplantes Renais
No ano de 2010, a Associação Brasileira de Transplantes de Órgãos
(ABTO) iniciou um novo desafio, o de conhecer os resultados dos transplantes
realizados no País, no que se refere às taxas de sobrevidas dos pacientes e
dos enxertos. Foram realizados 6.402 transplantes de órgãos (coração, fígado,
intestino, pâncreas, pulmão e rim) no país, entre estes 4.630 transplantes
renais (próximos da meta de 4.800), aumento de 8% em relação a 2009, sendo
64,6% com doador falecido, a maior taxa já obtida. Houve aumento de 17,2%
na taxa de transplante com doador falecido e queda de 5,7% com doador vivo.
Apesar das restrições aos transplantes com doador vivo não parente, não
cônjuge, a taxa aumentou levemente de 6,3% para 6,6%. A notícia positiva é a
grande remoção de rins de doadores limítrofes (superior a 150), em estados
que não realizam esses transplantes, e a sua disponibilização para alocação
para a Central Nacional, em outros estados, mas ainda inferior ao número
estimado de 600 rins por ano, pois apenas 10% dos doadores tinham idade
superior a 60 anos. São Paulo com 49,6 transplantes renais pmp aproxima-se
da necessidade estimada para o país (70 ppm), seguido a distância por Santa
Catarina (36,9 ppm) e RS (36,6 ppm). Outro dado que se repete é a elevada
16
taxa de transplantes com doador vivo no Paraná (17,9 ppm) e em São Paulo
(21,1 ppm), entre as possíveis explicações estão a realização desses
transplantes em pacientes de outras regiões e um maior esforço na busca
desse tipo de doador pelas equipes desses estados4.
Dados de 2012 revelam que houve um crescimento de 9,4% na taxa de
transplantes renais (28,5 ppm) e de 10,5% na taxa de transplantes hepáticos e
uma queda de 13,1% na de transplante de pâncreas. Deve-se comemorar o
aumento expressivo da taxa de transplantes cardíacos (39%) e pulmonares
(34%), ressaltando, entretanto, que esses números estão muito abaixo do
esperado em relação a taxa de doadores do país e a necessidade estimada de
transplantes. Um aspecto que deve ser mais bem avaliado é o número de
pacientes em lista de espera para transplante de órgãos5.
A diminuição dos pacientes em lista para o transplante de rim, atualmente
de 20.005, não deve ser creditada ao aumento dos transplantes (ainda
insuficiente), mas a talvez um pequeno ingresso em lista (no RS há grande
dificuldade dos pacientes do SUS marcarem consulta de investigação para
ingresso em lista de espera por problemas burocráticos) e por inativação por
vários motivos dos pacientes em lista de espera (soro vencido, recusas de
transplante, etc). O número esperado em lista de espera para o transplante
renal seria em torno de 30.000 a 35.0000. Há também uma diminuição no
número de pacientes em lista de espera para transplante hepático (1.351) e um
persistentemente pequeno número de pacientes em lista de espera para
transplante de coração (192) e de pulmão (152). No transplante renal
destacaram-se RS (50,5 ppm), SP (47,7 ppm) e PR (41 ppm). O RS é o único
estado que realiza mais de 40 transplantes ppm com doador falecido (42,1
ppm), graças ao projeto de receber rins não utilizados em outros estados,
enquanto que PR (15,8 ppm) e SP (14,4 ppm) são ainda os únicos estados que
realizam mais do que 10 transplantes renais com doador vivo ppm. A queda no
número de transplantes com doador vivo persiste, sendo responsável por
apenas 26,7% dos transplantes renais, quando era em torno de 50% há cinco
ou seis anos. A taxa de doador vivo não parente e não cônjuge está caindo
(5,1%)5.
trime
Tabela 1
estre de 20
Tabela 2
1 – Núme
012. (ABTO
– Dados d
ro de Tra
O, 2012)
do censo d
ansplantes
de diálise d
de órgão
de 2011
os Sólidoss durante
17
o 3°
18
O transplante renal é uma abordagem terapêutica aceitável para
pacientes com doença renal terminal. A denominada lesão de isquemia e
reperfusão (LIR) é um problema clínico, que ocorre como uma conseqüência
invariável dos transplantes, especialmente renal4. Existem poucas abordagens
terapêuticas efetivas capazes de minimizar a lesão de isquemia e reperfusão
renal6,7,8. Recentemente, tem se sugerido que o período pós-isquemia, que é
definido como uma rápida interrupção intermitente do fluxo sanguíneo na fase
inicial da reperfusão protege o coração contra as lesões de isquemia e
reperfusão. Esta proteção também foi observada para o rim. Em transplantes
renais, a ocorrência de lesões por isquemia e reperfusão renal pode afetar
consideravelmente as funções do órgão, colocando em risco o sucesso de todo
o processo de transplante9,10. LIR pode ser causada por múltiplos fatores
envolvendo formação de radicais livres de oxigênio, disfunção mitocondrial,
geração de citocinas inflamatórias e infiltração de neutrófilos. Em particular, o
Fator de Necrose Tumoral-α (TNF-α) - citocina central no processo inflamatório
- tem sido estabelecido como um importante mediador de lesão por isquemia e
reperfusão renal10. Dados experimentais em modelos animais de isquemia e
reperfusão renal demonstram intensa reação inflamatória após um período de
isquemia renal de 45 minutos e reperfusão de 2 horas11,12.
O fator de necrose tumoral (TNF-α) é uma citocina pleitrópica
relacionada tanto à sobrevivência e proliferação celular como à morte celular
no processo apoptótico12. O TNF-α tem sido identificado como uma citocina
pró-inflamatória importante sintetizada em hemorragias relacionadas com
lesões de isquemia-reperfusão13,14,15,16. É bem conhecido que o TNF-α é
expresso após hemorragia17,18,19, desempenha um importante papel na
inflamação auto-destrutiva excessiva e, finalmente, é capaz de induzir a
falência múltipla de órgãos através da ativação maciça de neutrófilos15,16. Além
disso, o TNF-α é conhecido por desencadear a liberação de outras citocinas
pró-inflamatórias, como a interleucina (IL)-1b e IL-620,21.
19
1.2- Terapia Laser de Baixa Potência
A terapia com laser de baixa potência (LBP), incide sobre as reações
atérmicas da luz com o tecido, ocasionando efeitos fotoquímicos22, ou seja,
radiações com baixa densidade de potência (DP) 0,01 w/cm2 à 1 w/cm2 e
também baixa densidade de energia (DE), de 1 à 10J/cm2 23. O Laser de baixa
potência parece agir sobre organelas celulares (mitocôndrias e membranas),
gerando aumento da síntese de ATP e modificando o transporte iônico. Dessa
forma o laser, em curto prazo, acelera a glicólise e a oxidação fosforilativa e em
longo prazo a transcrição e a replicação do DNA24.
O uso de lasers na prática clínica objetivando o efeito antiinflamatório em
diferentes doenças baseia-se em um número já razoável de publicações de
caráter científico. Nos últimos anos, inúmeros estudos clínicos aleatorizados,
placebo-controle foram realizados, fazendo com que a terapia laser já seja
considerada como alternativa terapêutica para várias doenças25,26.
Os mecanismos de ação ainda não foram totalmente determinados,
porém existem evidências que o laser pode reduzir a expressão gênica de
alguns mediadores inflamatórios como COX-2, PGE2, ILs, TNF-α e aumentar a
expressão de outros mediadores antiinflamatórios como IL-10. O laser pode
ainda reduzir a expressão de determinadas colagenases (MMPs) e
conseqüentemente reduzir a degeneração do tecido, favorecendo a
proliferação celular.25,26.
Laser de baixa intensidade (LLLT) tem sido utilizado clinicamente desde
1981 no tratamento de pacientes com doenças inflamatórias. As vantagens
terapêuticas do LLLT para doenças inflamatórias tem sido sugeridas por vários
autores e é apontado como uma alternativa para reduzir a dor.
Interessantemente, diversos trabalhos de nosso grupo demonstram a
capacidade desta terapia em inibir os principais mediadores inflamatórios
envolvidos na LIR renal, a saber, TNF-alfa e COX-2 e aumentar a expressão de
outros mediadores antiinflamatórios como IL 27,28,26,29,30,31. O laser pode ainda
reduzir a expressão de determinadas colagenases (MMPs) e
conseqüentemente reduzir a degeneração do tecido, favorecendo a
20
proliferação celular. No entanto, é muito importante ressaltar que muito pouco
se conhece a respeito do mecanismo de ação do laser infravermelho em
órgãos internos e nobres como o Rim, especialmente em condições de
isquemia e transplante32,33,34,35,25,36,37,38.
Tendo em vista a experiência prévia do grupo de pesquisa, no estudo
dos mecanismos de ação do Laser de baixa potência em diferentes doenças ou
situações inflamatórias, visamos investigar os efeitos da laserterapia na lesão
por isquemia e reperfusão em rins destinados ao transplante.
21
2- OBJETIVOS
2.1 – Objetivo Geral
Investigar os efeitos do Laser de Baixa Potência em rins destinados a
transplantes.
2.2 – Objetivo Específico
Investigar os efeitos do Laser de Baixa Potência sobre aspectos
histomorfológicos, bioquímicos e moleculares renais na vigência do processo
inflamatório induzido por isquemia prolongada “in vitro” em rins destinados a
transplantes.
22
3 – MÉTODO
3.1 – Aspectos Éticos
Foram utilizados 45 ratos Wistar machos pesando entre 150 e 200g (+/-
60 dias de vida), com livre acesso a água e ração, provenientes do Biotério da
Universidade Nove de Julho. Os animais foram mantidos em ambiente com
temperatura controlada e ciclo claro/escuro de 12 horas. O presente protocolo
experimental foi submetido e aprovado pelo Comitê de Ética em
Experimentação Animal da Universidade Nove de Julho (AN 0018/2011).
3.2 – Modelo Experimental
Os animais foram anestesiados com uma mistura de ketamina 10% (0,2
ml/100 gramas do animal) e de xylazina 2% (0,1 ml/100 gramas do animal), e
submetidos à cirurgia bilateral para extração dos rins. Os rins extraídos foram
imediatamente acondicionados em solução comercial para manutenção de
órgãos destinados a transplante, conforme especificações da Rede Brasileira
de Transplantes (RBT). Após a cirurgia os animais foram sacrificados por
administração de superdose de anestésico. Este procedimento não produz
qualquer sofrimento ao animal de experimentação.
Após a cirurgia de extração renal, os órgãos mantidos em solução
específica para manutenção de órgãos para transplante foram irradiados com
Laser de baixa potência (810 nm e 100 mW de potência; 0,028 cm2 de área de
feixe; Thera Lase, DMC®) em diferentes tempos (2, 12 e 24 horas) durante 10,
30, 60 e 100s caracterizando as doses de energia/ponto de 1, 3, 6 e 10 Joules.
As irradiações foram realizadas em 2 pontos de cada hemisfério renal,
iniciando-se em diferentes momentos (vide protocolos a seguir).
Protocolo 01 – 2 Horas
Neste protocolo, foi realizada a irradiação durante o ato cirúrgico, e após
01 hora de imersão em líquido de transplante. Após 2 horas os rins foram
fixados ou congelados em nitrogênio líquido para posteriores análises. Foram
23
utilizados 06 órgãos para cada dose de energia (Grupos controle, 1,3, 6 e 10
Joules). Número total de Rins = 30; Número Total de Animais = 15;
Protocolo 02 – 12 Horas
Neste protocolo foram realizadas as irradiações durante o ato cirúrgico, e
após 01, 03, 05, 07 e 09 horas de imersão em líquido de transplante. Após 12
horas os rins foram fixados ou congelados em nitrogênio líquido para
posteriores análises. Foram utilizados 06 órgãos para cada dose de energia
(Grupos controle, 1,3, 6 e 10 Joules). Número total de Rins = 30; Número Total
de Animais = 15;
Protocolo 06 – 24 Horas
Neste protocolo foram realizadas as irradiações durante o ato cirúrgico, e
após 01, 03, 05, 07, 09, 12 e 20 horas de imersão em líquido de transplante.
Após 12 horas os rins foram fixados ou congelados em nitrogênio líquido para
posteriores análises. Foram utilizados 06 órgãos para cada dose de energia
(Grupos controle, 1,3, 6 e 10 Joules). Número total de Rins = 30; Número Total
de Animais = 15;
3.3 – Processamento Histológico
Os espécimes (rins) foram delimitados em metade ventral e dorsal,
inseridos em cassetes plásticos devidamente identificados, lavados por uma
hora em água corrente e submetidos à desidratação. A desidratação foi
realizada em soluções de concentrações crescentes de álcool anidro (Synth,
SP, Brasil), na sequência em álcool 70, 80, 90, 95, 100 (1), 100 (2) e 100 (3),
durante 1 hora em cada passagem. O processo de diafanização ou
clareamento foi realizado em álcool/xilol (1:1), xilol (1, Synth, SP, Brasil), xilol
(2) e xilol (3) durante 1 hora em cada passagem. A impregnação foi realizada
com parafina de baixa temperatura de fusão (56-58C) em estufa com controle
de temperatura microprocessada (Fanem, SP, Brasil) a 56,5C, em três
imersões (parafina 1, parafina 2 e parafina 3) com duração de 1 hora em cada
passagem. Os espécimes foram incluídos em formas de plástico apropriadas,
sob lupa estereoscópica e emblocados em suporte de madeira devidamente
24
identificados, sendo que superfície seccionada de cada rim ficou posicionada
para a face de corte em micrótomo.
Cortes histológicos de cinco micrômetros de espessura foram realizados
em micrótomo rotativo (RM2125 RT, Leica Instruments, USA) acoplado com
navalha descartável. Para a coleta dos cortes histológicos, inicialmente foi
realizada a trimagem do bloco de parafina com o espécime em micrótomo até
que toda a superfície do órgão fosse seccionada; a partir deste ponto foram
selecionados três cortes histológicos em sequência (um para coloração HE,
outro para coloração picrossirius e outro reserva), os quais foram transferidos
para o banho histológico (Easybath, Easypath, SP, Brasil). Estes cortes
histológicos foram coletados em lâminas de vidro revestidas com poli-lisina
(Sigma, USA).
Para a coleta das imagens digitais foi utilizado um microscópio de luz
(DM500, Leica, CA, USA) com objetiva de 4x, acoplado com uma câmera
digital (Sony, CA, USA) com programa para captura de imagens (Qwin, Leica,
USA). As imagens digitais foram gravadas em formato TIFF.
4 – RES
SULTADOS / ARTTIGO
25
26
Ação da Terapia Laser de Baixa Potência nos efeitos deletérios
da isquemia em rins destinados a transplante: um estudo pré-
clínico. Submetido à Physical Therapy in Movement n.° 0004529 em
13/11/2012
Felipe de Moura Messias BSc.1, Patrícia Almeida Silva P.Ed.1, Rodney Capp
Pallota, M.Sc.2, Rodrigo Labat Marcos, PhD.1, Rodrigo Álvaro Brandão Lopes
Martins, PhD1,2
1 – Programa de Pós-graduação em Ciências da Reabilitação, Universidade Nove de Julho – UNINOVE
2 – Departamento de Farmacologia – Instituto de Ciências Biomédicas – Universidade de São Paulo
Short Title – LLLT in Kidney Ischemia
Autor para Correspondência
Felipe de Moura Messias
Rua Vergueiro – 249 – Liberdade
São Paulo – SP
femessias@hotmail.com
Suporte Financeiro: FAPESP – 2011/18330‐1
27
4.1 - RESUMO
Introdução. A lesão renal aguda (LRA) está associada a um grau elevado de
morbidez e mortalidade. A Isquemia e reperfusão (IR) é uma das principais
causas de LRA. Atualmente, especialmente a citocina inflamatória TNF-α,
parece estar envolvida na lesão e não há agentes farmacológicos que
comprovadamente possam prevenir a LRA após IR. Na última década, foi
demonstrado que a Terapia Laser de Baixa Potência (LLLT) é capaz de inibir
os marcadores inflamatórios incluindo citocinas (TNF-α e IL-1). Objetivos. Aqui
nós investigamos o efeito da LLLT em citocinas inflamatórias em rim de rato
após isquemia prolongada. Métodos. Após a aprovação do Comitê de Ética
para Uso de Animais, ratos Wistar foram anestesiados com cetamina mais
xilazina. A parede abdominal anterior foi incisionada na linha mediana. Ambos
os rins foram retirados e colocados imediatamente em solução nutritiva gelada.
Grupos tratados receberam a terapia a laser com 1,3,6 e 10 Joules de energia
em momentos diferentes. Depois de 2, 12 e 24 horas os rins foram fixados para
análise histológica e bioquímica. No grupo tratado a laser, uma dose de energia
de 3 Joules foi entregue em dois pontos centralmente e, bilateralmente, 5 min
após a reperfusão. Resultados. A análise bioquímica não revelou alterações
significativas para as citocinas inflamatórias após a laserterapia. A avaliação
morfológica demonstrou uma melhor organização tecidual nos grupos tratados
com laser. Conclusões. Os resultados demonstraram que LLLT foi capaz de
preservar o tecido renal de isquemia induzida por lesão.
28
4.2 - ABSTRACT
Introduction. Acute Kidney injury (AKI) is associated with a high degree of
morbidity and mortality. Ischaemia-reperfusion injury (IRI) is one of the major
causes of AKI. Currently, inflammatory cytokines specially TNF-α, seems to be
involved in the injury and no pharmacological agents have proven to prevent
AKI after IRI. In the last decade we demonstrated that LLLT is able to inhibit
inflammatory markers including cytokines (TNF-α and IL-1 for example). Aims.
Here we investigate the effect of LLLT on inflammatory cytokines in Rat kidney
after prolonged ischemia. Methods. After approval of the Ethical Committee for
Animal Use, Male Wistar rats were taken to the experiment table and
anaesthetized with ketamine plus xilazyne. The anterior abdominal wall was
incised on the median line. Both kidneys were excised and immediately placed
in cold nutritive solution. Treated groups received laser therapy with 1,3,6 and
10 Joules of energy in different times. After 2, 12 and 24 hours the kidneys were
fixed for histological and biochemical analysis. In the laser treated group, an
energy dose of 3 Joules was delivered in two points centrally and bilaterally, 5
min after reperfusion. Results. Biochemical analysis revealed no significant
alterations for inflammatory cytokines after LLLT. Morphological evaluation
demonstrated a better cell organization in the laser-treated groups.
Conclusion. Our results demonstrated that LLLT was able to preserve the
renal tissue from ischemia-induced lesions.
29
4.3 - INTRODUÇÃO
No ano de 2010, a Associação Brasileira de Transplantes de Órgãos
(ABTO) iniciou um grande levantamento dos transplantes realizados no País,
com especial atenção às taxas de sobrevidas dos pacientes e dos enxertos.
Foram realizados 6.402 transplantes de órgãos, incluindo coração, fígado,
intestino, pâncreas, pulmão e rim, no país. Dentre estes, 4.630 transplantes
renais, representando um aumento de 8% em relação a 2009. Do total
realizado, 64,6% refere-se a doador falecido, a maior taxa já obtida. Houve
aumento de 17,2% na taxa de transplante com doador falecido e queda de
5,7% com doador vivo. Apesar das restrições aos transplantes com doador vivo
não parente, não cônjuge, a taxa aumentou levemente de 6,3% para 6,6% 1.
A Doença Renal Crônica (DRC) é, atualmente, considerada um problema
de saúde pública mundial e os custos do tratamento da doença são altíssimos.
O número projetado atualmente para pacientes em tratamento dialítico e com
transplante renal no Brasil está próximo dos 120.000, a um custo de 1,4 bilhão
de reais2.
A Insuficiência Renal Aguda (IRA) é caracterizada por uma redução
abrupta da função renal, que se mantém por períodos variáveis, resultando na
inabilidade dos rins em exercer suas funções básicas de excreção e
manutenção da homeostase hidroeletrolítica do organismo. A IRA se apresenta
em diversas formas clínicas, entre elas a IRA isquêmica e a nefrotóxica. Dentre
as etiologias de IRA renal, 62% são decorrentes de necrose tubular aguda
conseqüentes a causas isquêmicas (72%) e tóxicas (28%) 2,3. No Brasil, em
estudo de Burdmann e cols. (1993), observou-se que as causas de IRA eram
predominantemente: sepse (33%), hipovolemia (33%), insuficiência cardíaca
descompensada (32%), nefrotoxicidade de drogas (27%), traumatismo cirúrgico
(13%) e hipotensão (20%), com grande ocorrência de associação de dois ou
mais desses fatores, e, de forma geral, a maior parte incorrendo em
hipoperfusão renal3.
O mecanismo de isquemia-reperfusão é a etiologia mais comumente
relacionada à lesão renal. Na isquemia, um dos eventos mais precoces é a
30
redução dos níveis intracelulares de ATP, que compromete preferencialmente
porções do néfron que possuem alta taxa de reabsorção tubular com gasto de
energia, como o túbulo proximal e a alça ascendente espessa de Henle. A
depleção de ATP desencadeia uma série de eventos, incluindo desestruturação
do citoesqueleto, perda da polaridade celular e interação célula-célula,
produção de espécies reativas de oxigênio, alterações do pH intracelular,
podendo culminar com morte celular4.
O transplante renal é uma abordagem terapêutica aceitável para
pacientes com doença renal terminal. A denominada lesão de isquemia e
reperfusão (LIR) é um problema clínico, que ocorre como uma consequência
invariável dos transplantes, especialmente renal4. Existem poucas abordagens
terapêuticas efetivas capazes de minimizar a lesão de isquemia e reperfusão
renal5,6,7. Recentemente, tem se sugerido que o período pós-isquemia, que é
definido como uma rápida interrupção intermitente do fluxo sanguíneo na fase
inicial da reperfusão protege o coração contra as lesões de isquemia e
reperfusão. Esta proteção também foi observada para o rim. Em transplantes
renais, a ocorrência de lesões por isquemia e reperfusão renal pode afetar
consideravelmente as funções do órgão, colocando em risco o sucesso de todo
o processo de transplante8,9. LIR pode ser causada por múltiplos fatores
envolvendo células operatórias tubulares, formação de radicais livres de
oxigênio, disfunção mitocondrial, geração de citocinas inflamatórias e infiltração
de neutrófilos. Em particular, o Fator de Necrose Tumoral-α (TNF-α) - citocina
central no processo inflamatório - tem sido estabelecido como um importante
mediador de lesão por isquemia e reperfusão renal10. Dados experimentais em
modelos animais de isquemia e reperfusão renal demonstram intensa reação
inflamatória após um período de isquemia renal de 45 minutos e reperfusão de
2 horas11,4.
O fator de necrose tumoral (TNF-α) é uma citocina pleitrópica relacionada
tanto à sobrevivência e proliferação celular como à morte celular no processo
apoptótico12. O TNF-α tem sido identificado como uma citocina pró-inflamatória
importante sintetizada em hemorragias relacionadas com lesões de isquemia-
reperfusão13,14,15. É bem conhecido que o TNF- α é expresso após
31
hemorragia16,17,18, desempenha um importante papel na inflamação auto-
destrutiva excessiva e, finalmente, é capaz de induzir a falência múltipla de
órgãos através da ativação maciça de neutrófilos15. Além disso, o TNF- α é
conhecido por desencadear a liberação de outras citocinas pró-inflamatórias,
como a interleucina (IL)-1b e IL-619,20.
Laser de baixa intensidade (LLLT) tem sido utilizado clinicamente desde
1981 no tratamento de pacientes com doenças inflamatórias. As vantagens
terapêuticas do LLLT para doenças inflamatórias tem sido sugeridas por vários
autores e é apontado como uma alternativa para reduzir a dor.
Interessantemente, diversos trabalhos de nosso grupo demonstram a
capacidade desta terapia em inibir os principais mediadores inflamatórios
envolvidos na LIR renal, a saber, TNF-alfa e COX-2 e aumentar a expressão de
outros mediadores antiinflamatórios como IL-1021,22,23,24,25,26. O laser pode
ainda reduzir a expressão de determinadas colagenases (MMPs) e
conseqüentemente reduzir a degeneração do tecido, favorecendo a
proliferação celular. No entanto, é muito importante ressaltar que muito pouco
se conhece a respeito do mecanismo de ação do laser infravermelho em
órgãos internos e nobres como o Rim, especialmente em condições de
isquemia e transplante27,28,29,30,31,32,33,34.
Tendo em vista a experiência prévia do grupo de pesquisa, no estudo dos
mecanismos de ação do Laser de baixa potência em diferentes doenças ou
situações inflamatórias, visamos investigar os efeitos da laserterapia na lesão
por isquemia e reperfusão em rins destinados ao transplante.
32
4.4 - MATERIAL E MÉTODOS
Foram utilizados 45 ratos Wistar machos pesando entre 150 e 200g (+/-
60 dias de vida), com livre acesso a água e ração, provenientes do Biotério da
Universidade Nove de Julho. Os animais foram mantidos em ambiente com
temperatura controlada e ciclo claro/escuro de 12 horas. O presente protocolo
experimental foi submetido e aprovado pelo Comitê de Ética em
Experimentação Animal da Universidade Nove de Julho (AN 0018/2011).
Os animais foram anestesiados com uma mistura de ketamina 10% (0,2
ml/100 gramas do animal) e de xylazina 2% (0,1 ml/100 gramas do animal), e
submetidos à cirurgia bilateral para extração dos rins. Os rins extraídos foram
imediatamente acondicionados em solução comercial para manutenção de
órgãos destinados a transplante, conforme especificações da Rede Brasileira
de Transplantes (RBT). Após a cirurgia os animais foram sacrificados por
administração de superdose de anestésico. Este procedimento não produz
qualquer sofrimento ao animal de experimentação.
Após a cirurgia de extração renal, os órgãos mantidos em solução
específica para manutenção de órgãos para transplante foram irradiados com
Laser de baixa potência (810 nm e 100 mW de potência; 0,028 cm2 de área de
feixe; Thera Lase, DMC®) em diferentes tempos (2, 12 e 24 horas) durante 10,
30, 60 e 100s caracterizando as doses de energia/ponto de 1, 3, 6 e 10 Joules.
As irradiações foram realizadas em 2 pontos de cada hemisfério renal,
iniciando-se em diferentes momentos (vide protocolos a seguir).
Protocolo 01 – 2 Horas
Neste protocolo, foi realizada a irradiação durante o ato cirúrgico, e
após 01 hora de imersão em líquido de transplante. Após 2 horas os rins foram
fixados ou congelados em nitrogênio líquido para posteriores análises. Foram
utilizados 06 órgãos para cada dose de energia (Grupos controle, 1,3, 6 e 10
Joules). Número total de Rins = 30; Número Total de Animais = 15;
33
Protocolo 02 – 12 Horas
Neste protocolo foram realizadas as irradiações durante o ato cirúrgico,
e após 01, 03, 05, 07 e 09 horas de imersão em líquido de transplante. Após 12
horas os rins foram fixados ou congelados em nitrogênio líquido para
posteriores análises. Foram utilizados 06 órgãos para cada dose de energia
(Grupos controle, 1,3, 6 e 10 Joules). Número total de Rins = 30; Número Total
de Animais = 15;
Protocolo 06 – 24 Horas
Neste protocolo foram realizadas as irradiações durante o ato cirúrgico,
e após 01, 03, 05, 07, 09, 12 e 20 horas de imersão em líquido de transplante.
Após 12 horas os rins foram fixados ou congelados em nitrogênio líquido para
posteriores análises. Foram utilizados 06 órgãos para cada dose de energia
(Grupos controle, 1,3, 6 e 10 Joules). Número total de Rins = 30; Número Total
de Animais = 15;
4.4.1 - Dosagem de Citocinas Inflamatórias
Foram realizadas as dosagens de citocinas inflamatórias IL-1, IL-6, IL-10
e TNF-alpha. Foram utilizados KIT´s comerciais da marca Cayman, e a
metodologia realizada conforme as instruções de cada Kit.
4.4.2 - Processamento histológico
Os espécimes (rins) foram delimitados em metade ventral e dorsal,
inseridos em cassetes plásticos devidamente identificados, lavados por uma
hora em água corrente e submetidos à desidratação. A desidratação foi
realizada em soluções de concentrações crescentes de álcool anidro (Synth,
SP, Brasil), na sequência em álcool 70, 80, 90, 95, 100 (1), 100 (2) e 100 (3),
durante 1 hora em cada passagem. O processo de diafanização ou
clareamento foi realizado em álcool/xilol (1:1), xilol (1, Synth, SP, Brasil), xilol
(2) e xilol (3) durante 1 hora em cada passagem. A impregnação foi realizada
com parafina de baixa temperatura de fusão (56-58C) em estufa com controle
de temperatura microprocessada (Fanem, SP, Brasil) a 56,5C, em três
34
imersões (parafina 1, parafina 2 e parafina 3) com duração de 1 hora em cada
passagem. Os espécimes foram incluídos em formas de plástico apropriadas,
sob lupa estereoscópica e emblocados em suporte de madeira devidamente
identificados, sendo que superfície seccionada de cada rim ficou posicionada
para a face de corte em micrótomo.
Cortes histológicos de cinco micrômetros de espessura foram realizados
em micrótomo rotativo (RM2125 RT, Leica Instruments, USA) acoplado com
navalha descartável. Para a coleta dos cortes histológicos, inicialmente foi
realizada a trimagem do bloco de parafina com o espécime em micrótomo até
que toda a superfície do órgão fosse seccionada; a partir deste ponto foram
selecionados três cortes histológicos em sequência (um para coloração HE,
outro para coloração picrossirius e outro reserva), os quais foram transferidos
para o banho histológico (Easybath, Easypath, SP, Brasil). Estes cortes
histológicos foram coletados em lâminas de vidro revestidas com poli-lisina
(Sigma, USA).
Para a coleta das imagens digitais foi utilizado um microscópio de luz
(DM500, Leica, CA, USA) com objetiva de 4x, acoplado com uma câmera
digital (Sony, CA, USA) com programa para captura de imagens (Qwin, Leica,
USA). As imagens digitais foram gravadas em formato TIFF.
35
4.5 - RESULTADOS
4.5.1 - ANÁLISE HISTOPATOLÓGICA
Os espécimes mostraram adequadas condições de preservação tecidual,
sem visíveis artefatos de fixação histológica. Portanto, as principais
características histopatológicas observadas podem ser em decorrência de
patologias renais pré-existentes ou da manipulação experimental dos animais.
A coloração pelo método HE permitiu visualizar as características
estruturais dos néfrons e tubos coletores, em particular, a morfologia celular
(epitélio renal) e detalhes do perfil nuclear (figura 1). Além disso, o tecido
conjuntivo de preenchimento, o sistema vascular renal e possíveis processos
inflamatórios foram evidenciados (figura 1).
A coloração pelo método do picrossírius permitiu visualizar o tecido
conjuntivo de preenchimento, restringindo a análise a um dos componentes
teciduais (matriz extracelular fibrilar) (figura 1). Deste modo, somente sensíveis
alterações puderam ser elucidadas empregando este método de coloração;
corroborando, por exemplo, na observação de espessamento membranoso do
glomérulo renal (figura 1), de base patológica.
A análise histopatológica revelou que os espécimes apresentaram dois
padrões típicos: a) condições de normalidade tecidual ou, ocasionalmente, com
leves alterações celulares que não permitem isoladamente caracterizar uma
patologia renal (figura 1); b) alterações histopatológicas, restritas aos
glomérulos (glomerulopatia membranosa, figura 1), com intensidades leve ou
moderada e/ou associadas à necrose tubular aguda (leve ou moderada) (figura
1). A necrose tubular aguda pode ser decorrente de isquemia (perfusão renal
insuficiente).
A glomerulopatia membranosa observada apresentava principalmente
com grau leve e, ocasionalmente moderado. Estava caracterizada com
espessamento do tecido conjuntivo subjacente ao epitélio dos vasos
36
sanguíneos do glomérulo renal, evidenciando pela exuberância da coloração
eosinófilica (figura 1). Não foi evidenciado processo inflamatório associado.
A necrose tubular aguda estava evidenciada nos túbulos contorcidos
distais ou proximais, alças de Henle e nos tubos coletores. As alterações mais
pronunciadas foram à presença de células vacuolizadas, com granulações
citosólicas difusas e a descamação de células necróticas ou viáveis no lúmen
dos túbulos (figura 2). Em alguns casos, o lúmen estava preenchido por
material hialino, celular ou granular (figura 2). Não foi evidenciado processo
inflamatório associado, indicando que o processo necrótico estava em
processo inicial.
Figu
med
F), O
espe
Joule
Obse
evide
Cont
assim
duto
ura 1. Cor
dular (E-F)
Observar e
essamento
e).
ervar em C
enciado pe
trole). Obs
m como o
os ou túbulo
rtes histoló
coradas p
em A-B, um
o de suas
C-D um co
elo espess
servar em E
o tecido int
os coletore
ógicos de
pelos méto
m corpúsc
membran
orpúsculo
samento d
E-F os túb
tersticial (s
es; TCP, tú
rim most
odos do HE
culo renal e
nas (seta)
renal com
das membr
bulos coleto
seta). Abre
úbulo conto
rando as
E (A, C, E
em condiç
no glomé
glomerulo
ranas (seta
ores em co
eviaturas:
orcido prox
regiões co
) e do picr
ões de no
érulo rena
opatia mem
a) do glom
ondições d
*, corpúsc
ximal.
cortical (A-
rossírius (
ormalidade
al (Grupo
mbranosa
mérulo (Gru
de normalid
culo renal;
37
-D) e
B, D,
sem
- 01
leve,
upo -
dade,
DC,
Figu
méto
Obse
mos
mate
dege
hialin
algu
(seta
ura 2. Corte
odo do H
ervar em
trado corte
erial granu
eneração (
no descam
mas alça d
a) (Grupo -
es histológ
HE com d
A uma co
es transve
uloso e v
(seta) (Gru
mado no l
de Henle p
- Controle)
gicos de ri
diferentes
ongestão v
ersais de t
vacuolizaçã
upo - Contr
úmen (set
preenchido
). Abreviatu
m mostran
caracterís
vascular (s
túbulos co
ão no cito
role). Em C
ta) (Grupo
o com mat
uras: *, cor
ndo a regiã
sticas de
seta) (Gru
ontorcidos
osol de c
C é mostra
o - 03 Jou
terial hialin
rpúsculo re
ão medula
necrose t
upo - Cont
proximais
células em
ado túbulo
ules). Em
no e célula
enal
ar corados
tubular ag
trole). Em
s e distais
m processo
os com ma
D é most
s degener
38
pelo
guda.
B é
com
o de
aterial
trado
radas
Fi
C
re
A
B
D igura 3. Co
ontrole; B
eferentes a
ortes histol
– 01 Jou
ao protocol
lógicos de
ule; C – 03
o de 2 hor
C
Erim corado
3 Joules;
ras.
C
E os pelo mé
D – 06 Jo
étodo do H
oules, E –
HE, onde A
– 10 Joule
39
A –
es,
Figu
Con
ao p
A
B
D
A
ura 4. Cor
ntrole; B –
protocolo d
rtes histoló
01 Joule;
de 12 hora
ógicos de
C – 03 Jo
as.
C
E
rim corad
oules; D –
C
E
dos pelo m
06 Joules,
método do
, E – 10 Jo
o HE, ond
oules, refe
40
de A –
erentes
Fig
Con
refe
B
D
A
D
B
ura 5. Cor
ntrole; B –
erentes ao
rtes histoló
– 01 Joul
protocolo
ógicos de
e; C – 03
de 24 hora
CC
rim corado
3 Joules;
as.
C
E
C
os pelo mé
D – 06 J
étodo do H
Joules, E
HE, onde A
– 10 Jou
41
A –
les,
42
QUADRO 01. RESUMO DAS PRINCIPAIS CARACTERÍSTICAS HISTOPATOLÓGICAS – GRUPO 2 HORAS
Abreviaturas: * alterações histopatológicas; cn, condições de normalidade; CR, corpúsculo renal (glomérulo-cápsula de Bowman); AH, Alça de Henle; DC, dutos coletores; TCD, túbulo contorcido distal; TCP, túbulo contorcido proximal.
Grupo Córtex Medula
Sistema circulatório renal Observações
CR TCP TCD AH DC
CONTROLE * * * * * Baixa perfusão renal
Necrose tubular aguda leve. Presença de células com
granulações e vacuolizações. Glomerulopatia
Membranosa
01 J cn cn cn * cn Baixa perfusão renal
Necrose tubular aguda leve. Presença de
material hialino no lúmen.
03 J cn * * * * Baixa perfusão renal
Necrose tubular aguda leve. Presença de células com
granulações e vacuolizações.
Presença de material hialino
no lúmen.
06 J * cn * cn cn Congestão vascular leve
Necrose tubular aguda leve. Presença de
material hialino no lúmen.
Glomerulopatia Membranosa leve.
10 J cn cn * * cn Baixa perfusão renal
Necrose tubular aguda leve. Presença de células com
granulações e vacuolizações
43
QUADRO 02. RESUMO DAS PRINCIPAIS CARACTERÍSTICAS HISTOPATOLÓGICAS – GRUPO 12 HORAS
Grupo Córtex Medula
Sistema circulatório renal Observações
CR TCP TCD AH DC
CONTROLE cn * * * cn Congestão vascular
Necrose tubular aguda leve. Presença de células com
granulações e vacuolizações.
Presença de material hialino
no lúmen.
01 J cn * * * * Congestão vascular
Necrose tubular aguda. Presença de células com granulações e vacuolizações.
Presença de material hialino
no lúmen.
03 J cn * * * * Baixa perfusão renal
Necrose tubular aguda. Presença de células com granulações e vacuolizações.
Presença de material hialino
no lúmen.
06 J cn * * * * Baixa perfusão renal
Necrose tubular aguda. Presença de células com granulações e vacuolizações.
Presença de material hialino
no lúmen.
10 J cn * * * cn Baixa perfusão renal
Necrose tubular aguda leve. Presença de células com
granulações e vacuolizações.
Abreviaturas: * alterações histopatológicas; cn, condições de normalidade; CR, corpúsculo renal (glomérulo-cápsula de Bowman); AH, Alça de Henle; DC, dutos coletores; TCD, túbulo contorcido distal; TCP, túbulo contorcido proximal.
44
QUADRO 03. RESUMO DAS PRINCIPAIS CARACTERÍSTICAS HISTOPATOLÓGICAS – GRUPO 24 HORAS
Grupo Córtex Medula
Sistema circulatório renal Observações
CR TCP TCD AH DC
CONTROLE * * * * * Congestão vascular
Necrose tubular aguda. Presença de
células com granulações e vacuolizações.
Presença de material hialino no
lúmen.Glomerulopatia Membranosa leve.
01 J cn * * * * Baixa perfusão renal
Necrose tubular aguda. Presença de
células com granulações e vacuolizações.
Presença de material hialino no lúmen.
03 J cn * * * * Baixa perfusão renal
Necrose tubular aguda. Presença de
células com granulações e vacuolizações.
Presença de material hialino no lúmen.
Discreto processo inflamatório crônico
na região do hilo renal
06 J cn * * * * Baixa perfusão renal
Necrose tubular aguda. Presença de
células com granulações e vacuolizações.
Presença de material hialino no lúmen.
10 J * * * * * Baixa perfusão renal
Necrose tubular aguda. Presença de
células com granulações e vacuolizações.
Presença de material hialino no lúmen.
Glomerulopatia Membranosa.
Abreviaturas: * alterações histopatológicas; cn, condições de normalidade; CR, corpúsculo renal (glomérulo-cápsula de Bowman); AH, Alça de Henle; DC, dutos coletores; TCD, túbulo contorcido distal; TCP, túbulo contorcido proximal.
45
4.5.2 - Dosagem de Citocinas Infamatórias
Foram realizadas as dosagens de citocinas inflamatórias.
A Figura 06 mostra os resultados da dosagem de interleucina – 1 (IL-1) nos
tempos de 2 (Painel A), 12 (Painel B) e 24 horas (Painel C). Como podemos
observar, apenas a dose de 10 Joules provocou um aumento significativo de
IL-1 no tempo de 2 horas. Todas as outras doses de Energia não induziram
qualquer alteração nos níveis de IL-1 no tecido renal.
A Figura 07 mostra os resultados da dosagem de interleucina – 6 (IL-6) nos
tempos de 2 (Painel A), 12 (Painel B) e 24 horas (Painel C). Como podemos
observar, todas as doses de Energia utilizadas não induziram qualquer
alteração nos níveis de IL-6 no tecido renal.
A Figura 08 mostra os resultados da dosagem de interleucina – 10 (IL-10) nos
tempos de 2 (Painel A), 12 (Painel B) e 24 horas (Painel C). Como podemos
observar, todas as doses de Energia utilizadas não induziram qualquer
alteração nos níveis de IL-10 no tecido renal.
A Figura 09 mostra os resultados da dosagem de TNF-alfa nos tempos de 2
(Painel A), 12 (Painel B) e 24 horas (Painel C). Como podemos observar, todas
as doses de Energia utilizadas não induziram qualquer alteração nos níveis
desta citocina no tecido renal.
46
IL-1 (2hs)
CONTROLE 1J 3J 6J 10
J0
500
1000
1500
*
pg/m
g de
Tec
ido
IL-1 (12hs)
CONTROLE 1J 3J 6J 10
J0
200
400
600
800
pg/m
g de
Tec
ido
IL-1 (24hs)
CONTROLE 1J 3J 6J 10
J0
100
200
300
400
pg/m
g de
Tec
ido
A
B
C
Figura 06 - Dosagem de interleucina – 1 (IL-1) nos tempos de 2 (Painel A), 12
(Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de 06
rins. * p < 0,05
47
IL-6 (2hs)
CONT
ROLE 1J 3J 6J 10
J0
200
400
600
800
1000
pg/m
g de
Tec
ido
IL-6 (12hs)
CONT
ROLE 1J 3J 6J 10
J0
200
400
600
pg/m
g de
Tec
ido
IL-6 (24hs)
CONT
ROLE 1J 3J 6J 10
J0
100
200
300
400
pg/m
g de
Tec
ido
A
B
C
Figura 07 - Dosagem de interleucina – 6 (IL-6) nos tempos de 2 (Painel A), 12
(Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de 06
rins. * p < 0,05
48
IL-10 (2hs)
CONTROLE 1J 3J 6J 10
J0
2000
4000
6000
8000
10000
pg/m
g de
Tec
ido
IL-10 (12hs)
CONTROLE 1J 3J 6J 10
J0
2000
4000
6000
8000
pg/m
g de
Tec
ido
IL-10 (24hs)
CONTROLE 1J 3J 6J 10
J0
1000
2000
3000
4000
pg/m
g de
Tec
ido
A
B
C
Figura 08 - Dosagem de interleucina – 10 (IL-10) nos tempos de 2 (Painel A), 12
(Painel B) e 24 horas (Painel C). Os valores representam a média + EPM de 06
rins. * p < 0,05
49
TNF-α (2hs)
CONT
ROLE 1J 3J 6J 10J
0
500
1000
1500
2000
pg/m
g de
Tec
ido
TNF-α (12hs)
CONT
ROLE 1J 3J 6J 10J
0
500
1000
1500
2000
pg/m
g de
Tec
ido
TNF-α (24hs)
CONTROLE 1J 3J 6J 10
J0
200
400
600
800
pg/m
g de
Tec
ido
A
B
C
Figura 09 - Dosagem de TNF-alfa nos tempos de 2 (Painel A), 12 (Painel B) e
24 horas (Painel C). Os valores representam a média + EPM de 06 rins. * p < 0,05
50
4.6 - DISCUSSÃO
A lesão renal aguda (LRA), anteriormente conhecida como "insuficiência
renal aguda", tem sido tradicionalmente descrita como uma diminuição rápida
da função renal (variando de horas a semanas, com menos de 3 meses),
medida pelo aumento de creatinina sérica2. A complexa rede de eventos que
ocorrem na lesão aguda do rim foi definida mais precisamente como "uma
abrupta (em 48 horas) redução da função renal", e estabelecidos valores
específicos laboratoriais e clínicos para orientar o diagnóstico. A incidência de
LRA em pacientes hospitalizados tem sido geralmente relatada no intervalo de
2% a 7%, com uma incidência de 5% a 10% maior do que na população em
UTI. O quadro é normalmente encontrado em situações de falência de
múltiplos órgãos e sepse2.
A incidência de LRA tem crescido em muitos grupos demográficos, e
pode inclusive, ser maior do que a de acidentes vasculares encefálicos. Apesar
dos avanços nas estratégias de prevenção e medidas de apoio, LRA continua a
ser associada com alta morbidade e mortalidade, particularmente naqueles
internados na UTI, onde as taxas de mortalidade hospitalar podem exceder
50%2,35.
A chamada Isquemia / reperfusão Renal (IRI) tem sido apontada como
causa comum de LRA, e resulta de uma deficiência generalizada ou localizada
de oxigénio e de nutrientes para entrega, e remoção de produtos do
metabolismo a partir de células do rim. Como resultado do desequilíbrio, as
células epiteliais tubulares podem sofrer lesões graves ou mesmo morte por
apoptose e/ou necrose (necrose tubular aguda [ATN]), com insuficiência de
órgãos funcionais e homeostase de electrólitos e excreção reduzida de
resíduos de produtos de metabolismo. Existem muitos estados fisiopatológicos
e medicamentos que podem contribuir para a isquemia generalizada ou
localizada35.
O objetivo da primeira parte deste trabalho foi verificar um possível efeito
terapêutico do Laser de Baixa Potência sobre as lesões decorrentes do
fenômeno de isquemia renal. Tendo em vista que, respeitando-se as
51
particularidades inerentes ao modelo, trata-se, em última instância, de uma
resposta inflamatória que é gerada pelo período prolongado de isquemia, e que
pode ser até mesmo potencializado no momento da reperfusão. Sabemos que
a radiação laser operando em baixa intensidade apresenta importante atividade
antiinflamatória, visamos investigar tais efeitos no modelo experimental ora
estudado.
De acordo com Gonçalves et al (2010)35, as interleucinas 1 e 18 possuem
papel preponderante na resposta inflamatória da lesão renal aguda. Em nosso
trabalho, avaliamos os níveis de IL-1 no tecido renal. No entanto, não foi
possível observar nenhum tipo de alteração significativa nos órgãos analisados
em qualquer tratamento.
Analisamos também os níveis de interleucina 6 (IL-6) no tecido renal, e
constatamos que a isquemia/reperfusão não foram capazes de induzir um
aumento significativo da citocina. Segundo Nakagiri et al (2012)36, níveis
aumentados de IL-6 parecem estar relacionados a processos de rejeição em
situações de transplante. Estudos adicionais são necessários para melhor
elucidarmos o papel da IL-6 na lesão de isquemia e reperfusão.
Avaliamos os níveis de interleucina-10 classicamente associadas a efeitos
antiinflamatórios. Pudemos observar um aumento dos níveis de IL-10 no tecido
renal após a isquemia e reperfusão nos grupos tratados com Laser, embora a
variabilidade experimental não tenha permitido um nível aceitável de
significância. Podemos sugerir que estes níveis devem estar significativamente
aumentados com o objetivo de modular o processo inflamatório desencadeado
pelo modelo utilizado. Orman et al, (2011)37 estudaram a dinâmica de várias
citocinas e quimiocinas em modelos inflamatórios e infecciosos. Neste trabalho,
observaram que os níveis de IL-10 tendem a decair com a resolução da
inflamação, sugerindo uma modulação da IL-10.
Os níveis de TNF-α analisados neste trabalho, ao menos no tempo de 2
horas, quando foi feito o sacrifício dos animais, não apresentaram diferenças
significativas para nenhum dos grupos.
52
As análises histomorfológicas qualitativas realizadas até o momento
revelaram uma proteção dos grupos tratados com Laser, quando comparado
ao grupo somente isquemia. Os achados histológicos descritos nos quadros 1,
2 e 3 demonstram claramente o efeito protetor do tratamento com Laser sobre
o tecido renal. Podemos observar nos quadros da análise qualitativa, que todas
as doses de energia utilizadas foram capazes de melhorar ou preservar o
tecido analisado. Ao contrário das dosagens de citocinas inflamatórias, a
análise histológica demonstrou-se mais sensível para a detecção de alterações
causadas pela isquemia renal em diferentes tempos.
53
4.7 - CONCLUSÕES
A irradiação com Laser de Baixa potência operando em 810 nm e com
diferentes doses de energia foi capaz de preservar o tecido renal de lesões
induzidas pelos períodos de isquemia de 2, 12 e 24 horas. A análise qualitativa
histomorfológica foi capaz de revelar uma proteção conferida pelo tratamento
com Laser sobre o dano tecidual induzido pela isquemia e reperfusão renal,
demonstrando-se mais sensível do que a dosagem de citocinas inflamatórias.
54
4.8 - REFERÊNCIAS BIBLIOGRÁFICAS
1. Associação Brasileira de Transplante de Órgãos. Registro Brasileiro de
Transplantes. Disponível em:
http://www.abto.org.br/abtov02/portugues/populacao /rbt/anoXVI_n4/index.aspx
Acesso em: 11 de abril. 2011
2. Bastos et al.; Doença Renal Crônica: Frequente e Grave, mas também
prevenível e tratável. Ver. Assoc. Med. Bras. V. 56(2), p. 248-53, 2010.
3. Burdman E, et al. Epidemiologia. In: Schor N, Boim MA, Santos OFP. IRA,
Insuficiência Renal Aguda: Fisiopatologia, Clínica e Tratamento. J. Bras. Nefrol.
v. 24, p. 1-12, 1997.
4. Matsuyama, M.; Yoshimura, R.; Hase, T.; Kawahito, Y.; Sano, H.; Nakatani,
T.; Study of cyclooxygenase-2 in renal ischemia-reperfusion injury. Transplant
Proc. v. 37, p. 370-372, 2005.
5. Kin, H.; Zhao, Z.Q.; Sun, H.Y.; Wang, N.P.; Corvera, J.S.; Halkos, M.E.;
Kerendi, F.; Guyton, R.A.; Vinten-Johansen, J.; Postconditioning attenuates
myocardial ischemia-reperfusion injury by inhibiting events in the early minutes
of reperfusion. Cardiovasc Res. v. 62, p. 74, 2004.
6. Sun, H.Y.; Wang, N.P.; Halkos, M.; et al.; Postconditioning attenuates
cardiomyocyte apoptosis via inhibition of JNK and p38 mitogen-activated
protein kinase signaling pathways. Apoptosis. v. 11, p. 583, 2006.
7. Zhao, Z.Q.; Corvera, J.S.; Halkos, M.E.; Kerendi, F.; Wang, N.P.; Guyton,
R.A.; et al.; Inhibition of myocardial injury by ischemic postconditioning during
reperfusion: comparison with ischemic preconditioning. Am J Physiol Heart Circ
Physiol. v. 285(2), p. 579-88, 2003.
8. Szware, I.; Soullier, S.; Gayard, N.; et al.; Ischemic postconditioning Modified
Renal Oxidative Stress and Lipid Peroxidation caused by Ischemic Reperfusion
Injury in Rats. Transplant Proc v. 39, p. 2554, 2007.
55
9. Liu, X.; Chen, H.; Zhan, B.; Xing, B.; Zhou, J.; Zhu, H.; Chen, Z.; Attenuation
of reperfusion injury by renal ischemic postconditioning: the role of NO.
Biochem Biophys Res Commun. V. 359, p.628, 2007.
10. Choi, D.E.; Jeong, J.Y.; Lim, B.J.; Na, K.R.; Shin, Y.T.; Lee, K.W.;
Pretreatment with the tumor nerosis factor-alpha blocker etanercept attenuated
ischemia-reperfusion renal injury. Transplant Proc v. 41, p. 3590-6, 2009.
11. Yun, Y.; Duan, W.G.; Chen, P.; et al.; Down-regulation of cyclooxygenase-2
is involved in ischemic postconditioning protection against renal ischemia
reperfusion injury in rats. Transplant Proc. v. 41, p. 3585, 2009.
12. Hosaka, Y.; Kirisawa, R.; Ueda, H.; Yamaguchi, M.; Takehana, K.;
Differences in Tumor Necrosis Factor (TNFα) and TNF Receptor-1-Mediated
Intracellular Signaling Factors in Normal, Inflamed and Scar-Formed Horse
Tendons. Journal of Veterinary Medical Science. v. 67, p. 985-991, 2005.
13. Caty M.G., Guice K.S., Oldham K.T.; et al. Evidence for tumor necrosis
factor-induced pulmonary microvascular injury after intestinal ischemia-
reperfusion injury. Ann. Surg. v. 212, p. 694–700, 1990.
14. Takada, M.; Nadeau, K.C.; Shaw, G.D.; Marquette, K.A.; Tilney, N.L.; The
cytokine-adhesion molecule cascade in ischemia/reperfusion injury of the rat
kidney. Inhibition by a soluble P-selectin ligand. J. Clin. Invest. V. 99, p. 2682–
2690, 1997.
15. Donnahoo, K.K.; Meng, X.; Ayala, A.; Cain, M.P.; Harken A.H.; Meldrum;
D.R.; Early kidney TNF-alpha expression mediates neutrophil infiltration and
injury after renal ischemiareperfusion. Am. J. Physiol. v. 277, p. R922–R929.
1999a.
16. Roumen, R.M.; Hendriks, T.; Van Der Ven-Jongekrijg, J.; et al. Cytokine
patterns in patients after major vascular surgery, hemorrhagic shock, and
severe blunt trauma. Relation with subsequent adult respiratory distress
syndrome and multiple organ failure. Ann. Surg. v. 218, p. 769–776, 1993.
56
17. Guo, W.; Ding, J.; Huang, Q.; Jerrells, T.; Deitch, E.A.; Alterations in
intestinal bacterial flora modulate the systemic cytokine response to
hemorrhagic shock. Am. J. Physiol. V. 269, p. 827–832, 1995.
18. Jiang, J.; Tian, K.; Diao, Y.; Chen, H.; Zhu, P.; Wang, Z.; Expression of TNF
alpha, IL-1 beta, IL-6 mRNA, release of TNF alpha in vital organs and their
relationship with endotoxin translocation following hemorrhagic shock. Chin.
Med. Sci. J. v. 12, p. 41-6, 1997.
19. Dinarello, C.A.; Cannon, J.G.; Wolff, S.M.; et al. Tumor necrosis factor
(cachectin) is an endogenous pyrogen and induces production of interleukin 1.
J. Exp. Med. v. 163, p. 1433–1450, 1986.
20. Suitters, A.J.; Foulkes, R.; Opal, S.M.; et al. (1994) Differential effect of
isotype on efficacy of anti-tumor necrosis factor alpha chimeric antibodies in
experimental septic shock. J. Exp. Med. v. 179, p. 849–856, 1994.
21. Pallotta, R.C.; Bjordal, J.M.; Frigo, L.; Leal-Junior, E.C.P.; Teixeira, S.;
Marcos, Rl.; Ramos, L.; Messias, F.D.M.; Lopes-Martins, R.A.B.; Infrared (810-
nm) low-level laser therapy on rat experimental knee inflammation. Lasers in
Medical Science. v. 77. p. 21-8, 2011.
22. Marcos, R.L.; Leal-Junior, E.C.P.; Messias, F.D.M.; Carvalho, M.H.C.;
Pallotta, R.C.; Frigo, L.; Dos Santos, R.A.; Ramos, L.; Teixeira, S.A.; Bjordal,
J.M.; Lopes-Martins, R.A.B.; Infrared (810 nm) low-level laser therapy in rat
Achilles tendinitis: A consistent alternative to drugs. Photochem & Photobiol. v.
87, p. 1447-52, 2011.
23. Lopes-Martins, R.A.B.; Albertini, R.; Leonardo, P.S.L.M.; et al. Steroid-
receptor antagonism inhibits the anti-inflammatory effects of low-level laser
therapy. Photomed. Laser Surg. v. 24, p. 197-201, 2007.
24. Aimbire, F.; Albertini, R.; Pacheco, M.T.; Castro-Faria-Neto, H.C.; Leonardo,
P.S.; Iversen, V.V.; Lopes-Martins, R.A.B.; Bjordal, J.M.; Low level laser therapy
induces dose-dependent reduction of TNF-α levels in acute inflammation.
Photomed. Laser Surg. v. 24(1),p. 33-7. 2006
57
25. Aimbire, F., Bjordal J.M., Iverson V.V.; Low level laser therapy partially
restores trachea muscle relaxation response in rats with tumor necrosis factor
alpha-mediated smooth airway muscle dysfunction. Lasers Surg. Med. v. 38, p.
773–778, 2006.
26. Aimbire, F., Albertine, R., Magalhães, R.G., Et Al. Effect of LLLT Ga-Al-As
(685 nm) on LPS-induced inflammation of the airway and lung in the rat. Lasers
Med. Sci. v. 20, p. 11–20, 2005.
27. Marcos, R.L.; Leal-Junior, E.C.; Arnold, G.; Magnenet, V.; Rahouadj, R.;
Wang, X.; Demeurie, F.; Magdalou, J.; De Carvalho, M.H.; Lopes-Martins,
R.A.B.; Low-level laser therapy in collagenase-induced achilles tendinitis in rats:
Analyses of biochemical and biomechanical aspects. Journal of Orthopaedic
Research. v. 30, p. 1945-51, 2012
28. Joensen, J.; Demmink, J.H.; Johnson, M.I.; Iversen, V.; Lopes-Martins,
R.A.B.; Bjordal, J.M.; The Thermal Effects of Therapeutic Lasers with 810 and
904 nm Wavelengths on Human Skin. Photomedicine and Laser Surgery. v.
29(3), p. 145-153, 2011.
29. Frigo, L.; Fávero, G.M.; Campos-Lima, H.J.; Maria, D.A.; Bjordal, J.M.;
Joensen, J.; Iversen, V.; Labat, M.R.; Parizzoto, N.A.; Lopes-Martins, R.A.B.;
Low-Level Laser Irradiation (InGaAlP-660 nm) Increases Fibroblast Cell
Proliferation and Reduces Cell Death in a Dose-Dependent Manner.
Photomedicine and Laser Surgery. v. 28(S1) p. S-151-S-156, 2010.
30. Frigo, L.; Fávero, G.M.; Lima H.J.; Maria, D.A.; Bjordal, J.M.; Joensen, J.;
Iversen, V.V.; Marcos, R.L.; Parizzoto, N.A.; Lopes-Martins, R.A.B.; Low-Level
Laser Irradiation (InGaAlP-660 nm) Increases Fibroblast Cell Proliferation and
Reduces Cell Death in a Dose-Dependent Manner. Photomedicine and Laser
Surgery. v. 1, p. S1 51-6, 2010.
31. Chow, R.T.; Johnson, M.I.; Lopes-Martins, R.A.B.; Bjordal, J.M.; Efficacy of
low-level laser therapy in the management of neck pain: a systematic review
and meta-analysis of randomized placebo or active-treatment controlled trials.
Lancet v. 374, p.1897–1908, 2009.
58
32. Leal-Junior, E.C.; Lopes-Martins, R.A.; Godoi, V.; Mancalossi, J.L.; Rossi,
R.P.; De Marchi, T.; Parente, M.; Grosselli, D.; Generosi, R.A.; Basso, M.;
Frigo, L.; Bjordal, J.M.; Comparison between cold water immersion therapy
(CWIT) and light emitting diode therapy (LEDT) in short-term skeletal muscle
recovery after high-intensity exercise in athletes—preliminary results. Lasers
Med Sci. v. 26, p. 419–424, 2010.
33. Leal-Junior, E.C.; Lopes-Martins, R.A.; Dalan, F.; Ferrari, M.; Sbabo, F.M.;
Generosi, R.A.; Baroni, B.M.; Penna, S.C.; Iversen, V.V.; Bjordal, J.M.; Effect of
655-nm low level laser therapy on exerciseinduced skeletal muscle fatigue in
humans. Photomed Laser Surg. v. 26, p. 419–424, 2008.
34. Bjordal, J.M.; Lopes-Martins, R.A.B.; Joensen, J.; Couppe, C.; Ljunggren,
A.E.; Stergioulas, A.; Johnson, M.I.; A systematic review with procedural
assessments and meta-analysis of low level laser therapy in lateral elbow
tendinopathy (tennis elbow). BMC Musculoskelet Disord v. 9, p.75, 2008.
35. Gonçalves, G.M.; Zamboni, D.S.; Câmara, N.O.; The role of innate immunity
in septic acute kidney injuries. Shock. 34 Suppl v. 1, p. 22-6, 2010.
36. Nakagiri, T.; Inoue, M.; Minami, M.; Shintani, Y.; Okumura, M.; Immunology
mini-review: the basics of T(H)17 and interleukin-6 in transplantation.
Transplant Proc. v. 44(4), p. 1035-40, 2012.
37. Orman, M.A.; Nguyen, T.T.; Ierapetritou, M.G.; Berthiaume, F.; Androulakis,
I.P.; Comparison of the cytokine and chemokine dynamics of the early
inflammatory response in models of burn injury and infection. Cytokine. v. 55(3),
p. 362-71, 2011.
59
5 – CONSIDERAÇÕES FINAIS
Nosso grupo de pesquisas vem estudando os mecanismos de ação da
Laserterapia em diferentes modelos experimentais e clínicos desde o ano
2000. Vimos acumulando experiência sobre os efeitos do Laser de baixa
potência em doenças como osteoartrite, tendinites, lesões musculares,
pleurisia, peritonite e outras.
Neste trabalho abordamos uma importante situação médica que é a
preservação de órgãos destinados a transplante no Brasil. Conforme
mencionado, o transplante renal apresenta a maior demanda dentre os
transplantes de órgãos, e as lesões que podem ser geradas pelo período de
tempo que o órgão permanece fora do organismo podem levar ao
comprometimento de todo o procedimento e a perda do enxerto.
Desenvolvemos um modelo de retirada e manutenção de rins de ratos em
solução nutritiva, para avaliarmos os efeitos da laserterapia na preservação do
órgão.
A dosagem dos marcadores bioquímicos utilizados neste estudo não foi
sensível para evidenciar os efeitos da laserterapia na preservação dos rins
estudados. No entanto, a análise histomorfológica foi capaz de demonstrar o
efeito protetor da Laserterapia sobre o tecido renal, apontando para uma
possibilidade promissora da referida terapia para órgãos destinados a
transplante.
Consideramos que a coloração escura dos rins pode ter sido um fator
limitante para um melhor efeito da laserterapia, embora não tenha sido possível
avaliar alguns parâmetros como, por exemplo, o possível aumento de
temperatura do órgão durante a irradiação. Estudos adicionais se fazem
necessários para que possamos aperfeiçoar a terapia e o próprio modelo
experimental.
Podemos concluir que abre-se aqui uma nova possibilidade de pesquisa
que poderá levar a inovações tecnológicas e científicas na área de transplante
de órgãos.
60
6 – REFERÊNCIAS BIBLIOGRÁFICAS
1. BASTOS et al.; Doença Renal Crônica: Frequente e Grave, mas também
prevenível e tratável. Ver. Assoc. Med. Bras. V. 56(2), p. 248-53, 2010.
2. BEZERRA, J.S.; TEIXEIRA, W.; VATTIMO, M.F.F.; Efeito Protetor da Vitis
Vinifera na Lesão Renal Aguda Isquêmica em Ratos. J. Bras. Nefrol. v. 30, p.
99-104, 2008.
3. BURDMAN E, et al. Epidemiologia. In: Schor N, Boim MA, Santos OFP. IRA,
Insuficiência Renal Aguda: Fisiopatologia, Clínica e Tratamento. J. Bras. Nefrol. v. 24, p. 1-12, 1997.
4. Associação Brasileira de Transplante de Órgãos. Registro Brasileiro de
Transplantes. Disponível em:
http://www.abto.org.br/abtov02/portugues/populacao/rbt/anoXVI_n4/index.aspx
Acesso em: 11 de abril. 2011
5. Associação Brasileira de Transplante de Órgãos. Registro Brasileiro de
Transplantes. Disponível em:
http://www.abto.org.br/abtov02/portugues/populacao/rbt/mensagemRestrita6.aspx?
idCategoria=2 Acesso em: 01/11/2012
6. KIN, H.; ZHAO, Z.Q.; SUN, H.Y.; WANG, N.P.; CORVERA, J.S.; HALKOS,
M.E.; KERENDI, F.; GUYTON, R.A.; VINTEN‐JOHANSEN, J.; Postconditioning
attenuates myocardial ischemia-reperfusion injury by inhibiting events in the
early minutes of reperfusion. Cardiovasc Res. v. 62, p. 74, 2004.
7. SUN, H.Y.; WANG, N.P.; HALKOS, M.; et al.; Postconditioning attenuates
cardiomyocyte apoptosis via inhibition of JNK and p38 mitogen-activated
protein kinase signaling pathways. Apoptosis. v. 11, p. 583, 2006.
8. ZHAO, Z.Q.; CORVERA, J.S.; HALKOS, M.E.; KERENDI, F.; WANG, N.P.;
GUYTON, R.A.; et al.; Inhibition of myocardial injury by ischemic
postconditioning during reperfusion: comparison with ischemic preconditioning.
Am J Physiol Heart Circ Physiol. v. 285(2), p. 579-88, 2003.
61
9. SZWARE, I.; SOULLIER, S.; GAYARD, N.; et al.; Ischemic postconditioning
Modified Renal Oxidative Stress and Lipid Peroxidation caused by Ischemic
Reperfusion Injury in Rats. Transplant Proc v. 39, p. 2554, 2007.
10. LIU, X.; CHEN, H.; ZHAN, B.; XING, B.; ZHOU, J.; ZHU, H.; CHEN, Z.; Attenuation of
reperfusion injury by renal ischemic postconditioning: the role of NO. Biochem Biophys Res Commun. V. 359, p.628, 2007.
11. YUN, Y.; DUAN, W.G.; CHEN, P.; et al.; Down-regulation of
cyclooxygenase-2 is involved in ischemic postconditioning protection against
renal ischemia reperfusion injury in rats. Transplant Proc. v. 41, p. 3585, 2009.
12. MATSUYAMA, M.; YOSHIMURA, R.; HASE, T.; KAWAHITO, Y.; SANO, H.;
NAKATANI, T.; Study of cyclooxygenase-2 in renal ischemia-reperfusion
injury. Transplant Proc. v. 37, p. 370-372, 2005.
13. CATY M.G., GUICE K.S., OLDHAM K.T.; et al. Evidence for tumor necrosis
factor-induced pulmonary microvascular injury after intestinal ischemia-
reperfusion injury. Ann. Surg. v. 212, p. 694–700, 1990.
14. TAKADA, M.; NADEAU, K.C.; SHAW, G.D.; MARQUETTE, K.A.; TILNEY,
N.L.; The cytokine-adhesion molecule cascade in ischemia/reperfusion injury of
the rat kidney. Inhibition by a soluble P-selectin ligand. J. Clin. Invest. V. 99, p.
2682–2690, 1997.
15. DONNAHOO, K.K.; MENG, X.; AYALA, A.; CAIN, M.P.; HARKEN A.H.;
MELDRUM; D.R.; Early kidney TNF-alpha expression mediates neutrophil
infiltration and injury after renal ischemiareperfusion. Am. J. Physiol. v. 277, p.
R922–R929. 1999a.
16. DONNAHOO, K.K.; SHAMES, B.D.; HARKEN, A.H.; MELDRUM, D.R.;
Review article: the role of tumor necrosis factor in renal ischemia-reperfusion
injury. J. Urol. v. 162, p. 196–203, 1999b.
17. ROUMEN, R.M.; HENDRIKS, T.; VAN DER VEN-JONGEKRIJG, J.; et al.
Cytokine patterns in patients after major vascular surgery, hemorrhagic shock,
62
and severe blunt trauma. Relation with subsequent adult respiratory distress
syndrome and multiple organ failure. Ann. Surg. v. 218, p. 769–776, 1993.
18. GUO, W.; DING, J.; HUANG, Q.; JERRELLS, T.; DEITCH, E.A.; Alterations
in intestinal bacterial flora modulate the systemic cytokine response to
hemorrhagic shock. Am. J. Physiol. V. 269, p. 827–832, 1995.
19. JIANG, J.; TIAN, K.; DIAO, Y.; CHEN, H.; ZHU, P.; WANG, Z.; Expression
of TNF alpha, IL-1 beta, IL-6 mRNA, release of TNF alpha in vital organs and
their relationship with endotoxin translocation following hemorrhagic shock.
Chin. Med. Sci. J. v. 12, p. 41-6, 1997.
20. DINARELLO, C.A.; CANNON, J.G.; WOLFF, S.M.; et al. Tumor necrosis
factor (cachectin) is an endogenous pyrogen and induces production of
interleukin 1. J. Exp. Med. v. 163, p. 1433–1450, 1986.
21. SUITTERS, A.J.; FOULKES, R.; OPAL, S.M.; et al. (1994) Differential effect
of isotype on efficacy of anti-tumor necrosis factor alpha chimeric antibodies in
experimental septic shock. J. Exp. Med. v. 179, p. 849–856, 1994.
22. HONMURA, A.; ISHII, A.; YANASE, M.; OBATA, J.; HARUKI E.; Analgesic
effect of Ga-Al-As diode laser irradiation on hyperalgesia in carrageenin-
induced inflammation. Lasers Surg Med. v. 13(4), p. 463-9, 1993.
23. SCHINDL, A.; SCHINDL, M.; PERNERSTORFER-SCHO, N.H.; SCHINDL,
L. Low-intensity laser therapy: a review. J Invest Med. v. 48(5), p. 312–326,
2000.
24. KARU, T.I.; Photobiological fundamentals of low power laser therapy. IEEE J Quant Electron. v. 23, p. 1703–1717, 1987.
25. CHOW, R.T.; JOHNSON, M.I.; LOPES-MARTINS, R.A.B.; BJORDAL, J.M.;
Efficacy of low-level laser therapy in the management of neck pain: a
systematic review and meta-analysis of randomized placebo or active-treatment
controlled trials. Lancet v. 374, p.1897–1908, 2009.
63
26. LOPES-MARTINS, R.A.B.; ALBERTINI, R.; LEONARDO, P.S.L.M.; et al.
Steroid-receptor antagonism inhibits the anti-inflammatory effects of low-level
laser therapy. Photomed. Laser Surg. v. 24, p. 197-201, 2007.
27. PALLOTTA, R.C.; BJORDAL, J.M.; FRIGO, L.; LEAL-JUNIOR, E.C.P.;
TEIXEIRA, S.; MARCOS, RL.; RAMOS, L.; MESSIAS, F.D.M.; LOPES-
MARTINS, R.A.B.; Infrared (810-nm) low-level laser therapy on rat experimental
knee inflammation. Lasers in Medical Science. v. 77. p. 21-8, 2011.
28. MARCOS, R.L.; LEAL-JUNIOR, E.C.P.; MESSIAS, F.D.M.; CARVALHO,
M.H.C.; PALLOTTA, R.C.; FRIGO, L.; DOS SANTOS, R.A.; RAMOS, L.; TEIXEIRA,
S.A.; BJORDAL, J.M.; LOPES‐MARTINS, R.A.B.; Infrared (810 nm) low-level laser
therapy in rat Achilles tendinitis: A consistent alternative to drugs. Photochem & Photobiol. v. 87, p. 1447-52, 2011.
29. AIMBIRE, F.; ALBERTINI, R.; PACHECO, M.T.; CASTRO‐FARIA‐NETO, H.C.;
LEONARDO, P.S.; IVERSEN, V.V.; LOPES‐MARTINS, R.A.B.; BJORDAL, J.M.; Low level
laser therapy induces dose-dependent reduction of TNF-α levels in acute
inflammation. Photomed. Laser Surg. v. 24(1),p. 33-7. 2006
30. AIMBIRE, F., BJORDAL J.M., IVERSON V.V.; Low level laser therapy
partially restores trachea muscle relaxation response in rats with tumor necrosis
factor alpha-mediated smooth airway muscle dysfunction. Lasers Surg. Med. v.
38, p. 773–778, 2006.
31. AIMBIRE, F., ALBERTINE, R., MAGALHÃES, R.G., et al. Effect of LLLT
Ga-Al-As (685 nm) on LPS-induced inflammation of the airway and lung in the
rat. Lasers Med. Sci. v. 20, p. 11–20, 2005.
32. MARCOS, R.L.; LEAL‐JUNIOR, E.C.; ARNOLD, G.; MAGNENET, V.; RAHOUADJ,
R.; WANG, X.; DEMEURIE, F.; MAGDALOU, J.; DE CARVALHO, M.H.; LOPES‐MARTINS,
R.A.B.; Low-level laser therapy in collagenase-induced achilles tendinitis in rats:
Analyses of biochemical and biomechanical aspects. Journal of Orthopaedic Research. v. 30, p. 1945-51, 2012
64
33. JOENSEN, J.; DEMMINK, J.H.; JOHNSON, M.I.; IVERSEN, V.; LOPES-
MARTINS, R.A.B.; BJORDAL, J.M.; The Thermal Effects of Therapeutic Lasers
with 810 and 904 nm Wavelengths on Human Skin. Photomedicine and Laser Surgery. v. 29(3), p. 145-153, 2011.
34. FRIGO, L.; FÁVERO, G.M.; CAMPOS-LIMA, H.J.; MARIA, D.A.; BJORDAL,
J.M.; JOENSEN, J.; IVERSEN, V.; LABAT, M.R.; PARIZZOTO, N.A.; LOPES-
MARTINS, R.A.B.; Low-Level Laser Irradiation (InGaAlP-660 nm) Increases
Fibroblast Cell Proliferation and Reduces Cell Death in a Dose-Dependent
Manner. Photomedicine and Laser Surgery. v. 28(S1) p. S-151-S-156, 2010.
35. FRIGO, L.; FÁVERO, G.M.; LIMA H.J.; MARIA, D.A.; BJORDAL, J.M.; JOENSEN,
J.; IVERSEN, V.V.; MARCOS, R.L.; PARIZZOTO, N.A.; LOPES‐MARTINS, R.A.B.; Low-
Level Laser Irradiation (InGaAlP-660 nm) Increases Fibroblast Cell Proliferation
and Reduces Cell Death in a Dose-Dependent Manner. Photomedicine and Laser Surgery. v. 1, p. S1 51-6, 2010.
36. LEAL-JUNIOR, E.C.; LOPES-MARTINS, R.A.; GODOI, V.; MANCALOSSI,
J.L.; ROSSI, R.P.; DE MARCHI, T.; PARENTE, M.; GROSSELLI, D.;
GENEROSI, R.A.; BASSO, M.; FRIGO, L.; BJORDAL, J.M.; Comparison
between cold water immersion therapy (CWIT) and light emitting diode therapy
(LEDT) in short-term skeletal muscle recovery after high-intensity exercise in
athletes—preliminary results. Lasers Med Sci. v. 26, p. 419–424, 2010.
37. LEAL-JUNIOR, E.C.; LOPES-MARTINS, R.A.; DALAN, F.; FERRARI, M.;
SBABO, F.M.; GENEROSI, R.A.; BARONI, B.M.; PENNA, S.C.; IVERSEN,
V.V.; BJORDAL, J.M.; Effect of 655-nm low level laser therapy on
exerciseinduced skeletal muscle fatigue in humans. Photomed Laser Surg. v.
26, p. 419–424, 2008.
38. BJORDAL, J.M.; LOPES-MARTINS, R.A.B.; JOENSEN, J.; COUPPE, C.;
LJUNGGREN, A.E.; STERGIOULAS, A.; JOHNSON, M.I.; A systematic review
with procedural assessments and meta-analysis of low level laser therapy in
lateral elbow tendinopathy (tennis elbow). BMC Musculoskelet Disord v. 9,
p.75, 2008.
65
7 – APÊNDICES
Artigo 1
Lasers Med Sci (2012) 27:71–78 DOI 10.1007/s10103-011-0906-1
ORIGINAL ARTICLE
Infrared (810-nm) low-level laser therapy on rat experimental knee inflammation
Rodney Capp Pallotta & Jan Magnus Bjordal & Lúcio Frigo &�Ernesto Cesar Pinto Leal Junior & Simone Teixeira & Rodrigo Labat Marcos & Luciano Ramos & Felipe de Moura Messias & Rodrigo Álvaro Brandão Lopes-Martins
Received: 3 November 2010 / Accepted: 22 February 2011 / Published online: 12 April 2011 # The Author(s) 2011. This article is published with open access at Springerlink.com
Abstract Arthritis of the knee is the most common type of joint inflammatory disorder and it is associated with pain and inflammation of the joint capsule. Few studies address the effects of the 810-nm laser in such conditions. Here we investigated the effects of low-level laser therapy (LLLT; infrared, 810-nm) in experimentally induced rat knee inflammation. Thirty male Wistar rats (230–250 g) were anesthetized and injected with carrageenan by an intra- articular route. After 6 and 12 h, all animals were killed by
Financial support FAPESP Grants 2005/02117-6
R. C. Pallotta : S. Teixeira : R. L. Marcos : L. Ramos :�R. Á. B. Lopes-Martins�Laboratory of Pharmacology and Experimental Therapeutics, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo,
São Paulo, SP, Brazil 05508–900
J. M. Bjordal�Section of Evidence Based Research, Bergen University College, Bergen, Norway
L. Frigo�Biological Sciences and Health Center, Cruzeiro do Sul University,�São Paulo, SP, Brazil 08060–070
E. C. P. Leal Junior : F. de Moura Messias : R. Á. B. Lopes-Martins�Post Graduate Program in Rehabilitation Sciences - Nove de Julho University,
São Paulo, SP, Brazil
R. Á. B. Lopes-Martins (*)�Laboratory of Pharmacology and Phototherapy of Inflammation, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo,�Av. Prof. Lineu Prestes, 1524, Butantan,�São Paulo, SP, Brazil 05508–900�e-mail:
rmart
CO2analyordeinhibwithcounsite. enerby laoperincreinveenzy
Keyw
Arthpopupainand parc
Althagenimpo
72
Laser
Increinflachoninteroxygpros5].
IL-1signiincretype
IL-1
tins@icb.usp
inhalationysis. Articu
er to evaluabit the tota
h 1, 3, and 6nting showVascular e
rgy of 10 J.aser irradiarating at 81eased COXstigate the
ymes induc
words LLL
hritis is conulation, aff, reduced rfinancial cel is marke
hough arthrnts acting oortant role
rs Med Sci (2
easing evidammatory pndrocytes prleukin-1 (Igen speciestaglandins
and TNF-ificant leveeased expre II collagen
and TNF-
p.br
n and the arular tissue ate COX-1 l number o6 J (Joules)ing the redextravasati. Both COXation while10 nm markX-1 and 2 g
possible pced by laser
LT . Laser
nsidered onfecting diarrange of monsequencedly growin
ritis may beon the jointin the prog
2012) 27:71–
dence indicprocess at tproduce a wIL-1), IL-6s (ROS) anand leuko
-α are the mels in osteoessed on on synthesis
-α are also
rticular cavwas carefuand COX-
of leukocyt) of energy
duction of pon was sigX-1 and 2 g PGE2 prodkedly reducgene expresproduction r irradiatio
. Arthritis
ne of the mrthrodial joovement, c
ces of this ing [1–3].
e initiated bt, pro- inflagression of
–78
cates that cthe molecuwide range6, IL-8, IL-nd lipid-der- trienes, in
most extensoar- thritis steoarthritis and suppr
important
vity was waully remov-2 expressites, as welly. This resupolymorphgnificantly gene expreduction waced inflamssion. Furtof antiinfla
on in knee i
. Inflamma
major causesoints. Clinicrepitus, teillness tend
by impact ammatory ef the diseas
cartilage deular level. Ae of cytokin-17, and ILrived medincreases ch
sive studiesynovial flis chondroress proteo
regulators
ashed for cved for realion. LLLT l as the myult was corhonuclear cinhibited a
ession wereas inhibited
mmatory sigher studiesammatory inflammati
ation . Kne
s of chronical sympto
enderness, ad to be high
loading aneicosanoidse [4, 5].
egenerationActivated ines and che
L-18, etc. Iniators produhondrocyte
d metaboliluid and typcyte. It is c
oglycan syn
of metal- l
cellular and-time PCRwas able toeloperoxidroborated b
cells at the at the highee significand. Low-levegns of inflas are necessmediators ion.
ee Introduc
ic disabilityoms are chaand inflamher as this p
nd other meds and cytok
n results froinflammatoemokines, n addition, ucts, such ae catabolic
ites. IL-1 ispe I IL-1 rcapable of nthesis [4,
loproteinas
d biochemiR analysis into significadase activitby cell inflammater dose of ntly enhancel laser the
ammation bsary to by COX
ction
y in the eldaracterized
mmation. Sopopulation
echanical kines play
om ory cells ansuch as reactive as activity [2
s found in receptor is suppressin5].
se (MMP)
66
ical n
antly ty
tory
ced erapy but
derly d by ocial n
an
nd
2, 4,
ng
gene
67
expression and protein synthesis in osteoarthritis [5–7]. Additionally, TNF-α is also found in synovial fluid and its receptor TFR1 is up-regulated in osteoarthritis. The production of prostanoids such as leukotriens and prostaglandins is also specially involved in osteoarthritis-related pain and disability [8].
Arthritis therapies are based on relieving pain, improving the range of motion, and promoting partial tissue regener- ation. Current therapeutic strategies include surgical proce- dures and pharmacological and non-pharmacological management. Surgical procedures are only considered after more conservative therapies have failed, and it includes osteotomy, arthroscopy management, grafting, arthrodesis, and arthroplasty. Besides analgesics (opiate and non-opioid) and chondroitin, glucosamine, sodium hyaluronate com- pounds, the anti-inflammatory drugs (corticosteroids and non-steroidal) are the most widely used drugs, despite that a panel of experts has ranked oral non-steroidal anti- inflammatory drugs (NSAIDs) as the most toxic therapy in knee osteoarthritis, followed by corticosteroid injections, paracetamol, topical NSAIDs, chondroitin, and glucos- amine sulphate [3, 9].
The search for less toxic non-pharmacological alter- natives agents in arthritis management suffers from lack of interest and funding, but low-level laser therapy (LLLT) is about to be taken more seriously by clinicians. We recently demonstrated that LLLT is effective in reducing non-specific neck pain [10, 11] and is beginning to be considered a potential alternative to drugs.
The bulk of new and increasing evidence shows that LLLT is no longer a mythical alternative therapy with diffuse and hypothetical mechanisms of biological action, but a therapy that has distinct biophysical properties and dose-dependent biological mechanisms of action [12].
Several animal and human trials have been performed that show the modulatory effect of laser radiation on
inflammatory markers (PGE2, TNF-α, IL-1β, plasminogen activator) and on the inflammatory process itself (reducing edema, hemorrhagic formation, necrosis, neutrophils in- flux) [12, 13].
In this perspective, the present study was designed to investigate the effect of low-level laser therapy on edema formation, leucocyte influx, myeloperoxidase activity, COX-1 and COX-2 gene expression, residues, IL-1 and PGE2 quantification in rat-induced knee inflammation in rats. In other words, our main hypothesis is that LLLT can act as an effective therapeutic alternative to treat joint inflammatory conditions.
Materials and methods
Animals
All eCom
Maleprocprotostimudiscoat di
Proc
Indu
Animmg/kInitiain stsyrinligam
Expe
Eachfollo
& C
& Dwith
Laser
73
experimentmmittee of t
e Wistar racedure. Fooocol. Rats uli injectioomfort andifferent tim
cedures
uction of ac
mals were kg) and xyally 100 μlerile salinenge (300 μlment, perfo
erimental g
h group waows:
ontrol grou
iclofenac gh sodium di
rs Med Sci (2
&inflamm
&inflamm
&�inflam
&�inflamlevel las
tal proceduthe Univer
ats (250 g) od and watewere anest
on. All pre-d to avoid a
mes.
cute arthrit
anesthetizelazine (0.5l of kaolin e solution (l). The bevorming the
groups
as compose
up – The an
group - Theiclofenac (
2012) 27:71–
& 1.0 J gromation and
& 3.0 J gromation and
& 6.0 J grommation an
& 10.0 J grmmation anser therapy
ures were srsity of São
were houser were prothetized wi-operative pany infectio
is
ed with an mg/kg), an(3%, Sigm
(NaCl, 0.9%vel of the n
puncture t
ed of five a
nimals rece
e animals r1 mg/kg; I
–78
oup – The aafter 1 h re
oup – The aafter 1 h re
oup – The and after 1 h
roup – Thend after 1 hy procedure
submitted ao Paulo.
sed five perovided ad lith inhalatoproce- duron. The an
intraperitoand trichotoma-Aldrich)%) was inj
needle was towards the
animals ran
eived kaoli
received kaIM, 30 min
animals receceived las
animals receceived las
animals rech received l
e animals reh received le �LLLT w
and approv
r cage befolibitum throry halothares were penimals were
oneal injectomized at t) plus carraected into positionede joint surf
ndomly div
in + carrag
aolin + carn prior infla
ceived the ser irradiati
ceived the ser irradiati
ceived the laser irradia
eceived thelaser irradiawas perform
ved by the E
ore the expeoughout th
ane to allowerformed toe killed by
tion of ketathe region oageenan (3the joint us
d medially tface of the
vided into s
geenan.
rageenan aammatory s
induction oion - 1.0 J.
induction oion - �3.0
induction oation - �6.
e inductionation - 10.0med 1 h aft
Ethical
erimental he experimw inflammao prevent CO2 inhala
amine (52 of the left s%) dissolvsing a micrto the patefemur.
six groups
and pre-trestimulus).
of .
of J.
of .0 J.
n of 0 J. �Lowfter carrage
68
mental atory
ation
side. ved ro
ellar
as
ated
-eenan
69
+ kaolin injection using an infrared laser unit (DMC, São Carlos, Brazil). The laser unit emitted a continuous optical output of 100 mW with a wavelength of 810 nm and a spot size area of 0.028 cm2, which gave a power density of 5 W/cm2. The optical output of the laser unit was measured before, halfway through, and after the experiment. Laser irradiation was performed in skin contact at the site of injection with doses of 1, 3, 6, and 10 J with corresponding irradiation times of 10, 30, 60, and 100 s, and energy densities of 50, 150, 300, and 500 J/cm2, respectively. �Cellular, biochemical, and molecular analysis �All analyses were performed by an observer who was blinded to group allocation. Initial analysis was performed at Section of Pharmacology, ICB at University of São Paulo, Brazil. To ensure consistency in analyses and reproducibility of results, two other laboratories at Univer- sity of São Paulo, Brazil, duplicated the analyses. �Joint cavity wash �The joint wash was obtained by injection and aspiration of final volume of 300 μl (3 × 100 μl) of solution PBS + EDTA (4 μM) (Ultrafine 29 G, BD). The joint washings were transferred to Eppendorf tubes and stored at −80°C until the time of biochemical test. �The total number of cells counting was performed taking 20 μl from lavage fluid diluted in Turkey liquid (380 μl). A Neubauer chamber was used under an optical microscope (Carl Zeiss) with 40× amplification. The results were expressed as a total number of leucocytes per cavity. For differential leukocyte cell counts (mononuclear and neutro- phil cells), we used the same microscope with a higher (100×) amplification. For the leukocyte differential cell counting, 100-ml aliquots from cells suspension were used
Vascular permeability - Evans Blue dye
An Evans Blue dye (25 mg/ml; Merck) was dissolved in saline solution and then filtered in a sterilized membrane (0.22 m; Millipore) and conserved in at 4°C.
Animals were previously anesthetized with halothane and then injected intra-articularly with the Evans Blue dye, 1 h before euthanasia. The animals were killed by halothane super dose. After the killing, the joint was washed and exudate recovered in a glass tube in formamide solution (Merck article 9684,1000, 4 ml/g) for dye extraction. A 150-μl sample from each tube was used for determination of Evans Blue concentrations (BIOTEK Spectrophotometer 618–620 nm).
Myeloperoxidase activity (MPO)
In order to determine MPO levels, 50 μl of exudate was added to 200 μl of potassium phosphate buffer (pH 6.0), containing 0.164 mg/ml of o-dianisidine dihydrochloride (Sigma Chemical Co., St. Louis, MO, USA) and 0.0005% of hydrogen peroxide (Merck, Darmstadt, Alemanha). The absorbance was measured in an ELISA scanner (Espectra max plus 384, Sunnyvale, CA, USA) at 460 nm for 20 min, with recordings made at 20-s intervals. Graphs showing the
absocalcuabsoor abclosecalcuhomthe dof Hthe atissuwere
RNA
At thnitroacco
DNaintegwas
for c
time
s,
74
Laser
usingdurintranscontampoligoreverAGABetaAAGCGG
The 30 cy
orbance varulated from
orbance varbsorbance)er to 1), obulated and
mogenate codegradation
H2O2 per miactivity of Mue (mg) adde performe
A isolation
he selectedogen, and sording to th
ase I was emgrity of RNused for fi
centrifugati
e = 18
rs Med Sci (2
g SuperScrng this proscribed (i.etaminants. Dlification uonucleotiderse: CCTC
ATCAGAAa-actin wasGATTTGGGTGAGCA
conditionsycles of 95
riation as am these grariation show) as a functbtaining thedivided by
orrespond tn in microminute correMPO was ded to the ad by Stude
and real-ti
d time-poinstored at −8he manufac
mployed toNA was verirst-strand c
ion (2,000
2012) 27:71–
ript II. In acess. Three
e., reverse tDiluted RTusing Platines for COX
CACCAGTAGCGAGGs used as anGCACCACAGCACAG
s for PCR w5°C, 15 s; 6
a function oaphs. The tiwed linearion of timee value Vmy the amouto 0.5 mg omol (μmol)sponds to aexpressed assay (U/ment’s t test,
ime PCR a
nts, the join80°C. Totacturer’s ins
o digest DNrified by agcDNA syn
rpm, T = 4
–78
addition, RNe pooled RtranscriptaT samples (num Sybr QX-1 (forwarTCATTCCCGACCTG;n internal cCACTTTCGGGT).
were as fol60°C, 1 mi
of time werime intervarity was choe in second
max/sec. Thunt of tissueof tissue). T) of H2O2 pa variationin MPO un
mg). Statistusing a sig
analysis
nt tissues wal RNA wastructions.
NA to obtagarose gel nthesis [rev
400 s, rise
NaseOUTRNA aliquose omitted(1:10) werQPCR Sup
ard: CCGTGCTGT) an; reverse: Ccontrol (for
C TACA; re
llows: 50°Cin, and 72°
re obtainedal where thosen from ds (correspohe mean ofe in each pThe MPO aper minute.n of 0.0113nits and coical analysgnificance
were dissects isolated i
ain RNA puelectropho
verse transc
stop time=
was also aots were ro) to ensure
re submittepermix-UDGCGAGTAd COX-2 (
CCATCCTrward: everse:
C, 2 min; 9C, 15 s. Ct
d and the Vhe measurethe graph (onding to tf the dupliclate well (eactivity un. ConsideriAU (absor
orrected by ses of the Mlevel of 0.0
ted, frozenin the Trizo
urification oresis. Totacriptase (RT
=11 s).
added to prutinely sha
e the absencd to real-ti
DG and specACAGTCA(forward: TG GAAAA
95°C, 2 mint values we
Vmax/sec wements of (optical dethe value ocates was each 10 μl
nit is defineing that 1 μrbance uni
y the amounMPO levels05%.
n in liquid ol reagent,
and the al RNA (2 T)]
rotect the Ram reversece of DNAime PCR cific ACAT;
AGTCGAA
n, followedere recorde
70
was
ensity of r2
of ed as μmol its), nt of s
μg)
RNA
A
AG).
d by ed for
71
each gene, the results of genes of interest were normalized to results obtained with the internal control gene. ddCT were calculated and the results are expressed as fold increase. All oligonucleotides and reagents utilized in this protocol were purchased from Invitrogen Co., USA.
PGE2 and cytokines analysis
PGE2 and cytokines generation were analyzed and deter- mined according to the manufacturer’s instructions by ELISA (R & D Systems, Minneapolis, MN, USA).
Outcomes
The following outcomes were analyzed in this study: leukocyte, neutrophils, and mononuclear cells counting; myeloperoxidase activity; vascular permeability; IL-1, IL-6, and PGE2 (ELISA); and gene expression of COX-1 and COX-2 (real-time PCR analysis, from joint tissue and joint fluid).
Statistical analysis
A blinded observer unaware of the allocation to groups performed the statistical analysis. Data are expressed as mean and standard error (±) of the mean (SEM). All data were statistically evaluated by analysis of variance (ANOVA), followed by the Newman-Keuls-Student’s test. Values with p<0.05 were considered to be statistically significant.
Results
Inflammatory cell accumulation
Three hours after induction of inflammation we could observe that both LLLT (1.0 and 3.0 J) as well as diclofenac
significantly reduced the total number of leukocytes (Fig. 1a). After six hours, LLLT at the energy doses of 6.0 and 10.0 J significantly reduced the total number of leukocytes in the knee joint (Fig. 1b).
Regarding the neutrophils, one more time we could observe that both the diclofenac and LLLT groups treated with 3.0, 6.0, and 10.0 J significantly reduced (p < 0.001) the cell accumulation (Fig. 2a).
The number of mononuclear cells was significantly higher in all treated groups when compared to control (Fig. 2b).
Evans Blue dye extravasation
Figure 3a shows the amount of Evans Blue dye extravasa- tion 6 h after induction of inflammation. Only the diclofenac and 10.0 J LLLT groups were effective in reducing Evans Blue extravasation (p < 0.05).
Mye
ThreJ andothe
Fig. 1leukoper grh in tgrouparthriJ); thSEM
Laser
75
eloperoxida
ee hours aftd 10.0 J dor laser
1 Analysis ofocytes in articroup (*p<0.0the control grp treated withitis group tree arthritis gr)
rs Med Sci (2
ase activity
fter the induoses signifi
f articular wacular lavage 05) (**p<0.0roup and afteh diclofenac
eated with 3 Jroup treated w
2012) 27:71–
y (MPO)
uction of incantly inhi
ash 3 and 6 hfluid after 3
001). b Total er LLLT (n=(Diclof); the
J LLLT (AT+with 10 J LL
–78
nflammatioibited the M
h after induc h in the con number of l
=6 animals pee arthritis gro+3 J); the art
LLT (AT + 10
on, the eneMPO activi
ed inflammantrol group anleukocytes iner group arthoup treated wthritis group 0 J). Results
ergy doses oity. Interes
ation. a Totalnd after LLLn articular lavhritis group (Awith 1 J LLL
treated withare expresse
of laser of stingly, the
l number of LT (n=6 animvage fluid afAT); the arth
LT (AT+ 1 J)h 6 J LLLT (Aed as mean (
72
f 6.0
mals fter 6 hritis ; the AT+6 ±
Fig. 2the co6 h afArthr1 J LL
2 a The numbontrol group fter induced ritis group (ALLT (AT+1
ber of neutroand after LLinflammatio
AT); arthritisJ); arthritis g
ophils in the LLT. b The non in the cont group treategroup treated
articular wasnumber of mtrol group aned with diclod with 3 J LL
sh fluid 6 h aononuclear c
nd after LLLTofenac (DicloLLT (AT+3 J
after inducedcells in the arT (n = 6 anim
of); arthritis gJ); arthritis g
d inflammatiorticular washmals per grougroup treated
group treated
73
on in h fluid up). d with with
6 J LLmean
enerof M
On tgrouthe c
COX
Figurespe3.0 aexprjust pdiclo
COX
The fluidhand
a The
Fig. 3inflaminduc(AT)(AT+(AT+mean
obseexpr
Cyto
Interener6a)
Interdiclo10.0
76
LLT (AT+6 n±SEM (**p
rgies as weMPO activit
the other haups were abcontrol gro
X-1 and CO
ure 4a and bectively, inand 10.0 J pression whepresented sofenac grou
X-1 and CO
energy dosd when comd, we could
e protein extr
3�6 h after immation in tced inflamma; arthritis gro
+1 J); arthriti+6 J); arthritin±SEM
erve any diression. Th
okines
rleukin-1 Wrgy doses) p
rleukin-6 Tofenac as w J when co
J); arthritis g< 0.001)
ll as the dity (Fig. 3b)
and, 6 h aftble to produup (Fig. 3c
OX-2 gene
b shows thn joint tissupresented aen comparesignificantups.
OX-2 gene
se of 3.0 J mpared to td not
ravasation as
induced inflathe control anation in contoup treated wis group treatis group treat
fference behese results
We observepresented a
The levels owell as in Lompared to
group treated
clofenac tr).
fter the induuce a signic).
expression
he RNA expue. We obsa significaned to the coincrease in
expression
significantthe control
s an indicator
ammation. b nd treated grrol and treate
with diclofented with 3 J Lted with 10 J
etween all can be vis
ed that dicla significan
of IL-6 in jLLLT group the contro
d with 10 J L
reatment di
uction of inificant inhi
n in joint ti
pression ofserved that nt increaseontrol and n COX-2 e
n in joint fl
tly increaseand other
r of vascular
The activity roups. c Theed groups (*
nac (Diclof); LLLT (AT+3J LLLT (AT+
the tested sualized res
lofenac andnt inhibitio
joint fluid wps (1.0, 3.0
ol group (F
LLLT (AT+1
id not pres
nflamma- tibition of M
issue
f COX-1 anthe groups
e of COX-1diclofenac
expression
fluid
ed the COXexperimen
r permeability
of myeloperactivity of m p<0.05) (**arthritis grou3 J); arthritis+10 J). Resu
groups regspectively
d LLLT groon of IL-1 l
were signi0, and 6.0 J
Fig. 6b).
0 J). Results
ent signific
tion, all expMPO when
nd COX-2 s treated w1 and COXc groups. Tcompared
X-1 expresntal groups
y
roxidase 3 h myeloperoxid**p<0.001). Aup treated wis group treatelts are expres
garding to Cin Fig. 5a
oups (1.0 Jlevels in jo
ficantly redJ of energy
s are express
cant inhibi
perimentaln compared
enzymes, with LLLT wX-2 RNA The 6.0 J gr
to control
ssion in join. On the ot
after inducedase 6 h afterArthritis groith 1 J LLLTed with 6 J Lssed as
COX-2 and b.
J and 6.0 J oint fluid (F
duced in y) but not w
74
ed as
tion
l d do
with
roup and
nt ther
d r up
T LLLT
of Fig.
with
Laser
Fig. 4b Theanima(Dicl(AT+LLLT
rs Med Sci (2
4 a The RNAe RNA expreals per groupof); arthritis
+3 J); arthritiT (AT+10 J)
2012) 27:71–
A expression ession of COp (*p<0.01). group treate
is group treat. Results are
–78
of COX-1 enOX-2 enzyme
Arthritis groed with 1 J LLted with 6 J Lexpressed a
nzyme mease measured boup (AT); artLLT (AT+1 LLLT (AT+6
as mean±SEM
sured by realby real-time Pthritis group J); arthritis g
6 J); arthritisM
- time PCR iPCR in joint treated with
group treateds group treate
in joint cartilcartilage (n=
h diclofenac d with 3 J LLed with 10 J
75
lage. =6
LLT
Fig. 5COXanimaarthriarthriJ). Re
Fig.6meas(**p<with with with
Prospresegrou
Disc
Kneebiochof arthe tcorrochem
Laser
77
In ad(TNF
5 a The COXX-2 RNA exp
als per groupitis group treitis group treesults are exp
6 aIL-1levelsaured by ELI<0.01) (***pdiclofenac (D3 J LLLT (A10 J LLLT (
staglandin Eented a sig
up (Fig. 6c)
cussion
e arthritis ihemical, anrthritis. In ototal numbeoborated bmical mark
rs Med Sci (2
ddition, proF)-α, and p
X-1 RNA exppression measp. Arthritis geated with 1 Jeated with 6 Jpressed as m
atarticularwaSA. c PGE2
p <0.001) (n=Diclof); arthr
AT+3 J); arthAT+10 J). R
E2 The diclgnificant de).
is a complend physicaour study, er of leukoy the inhib
ker of neutr
2012) 27:71–
oinflammaprostagland
pression measured by real
group (AT); aJ LLLT (AT+J LLLT (AT+
mean±SEM
ashfluidmeaslevels at artic=6 animals pritis group tr
hritis group trResults are ex
lofenac andecrease of P
ex problemal causes. Llaser irradi
ocytes as wbition of myrophil infilt
–78
atory mediadins, are al
asured by real- time PCR arthritis grou+1 J); arthrit+ 6 J); arthri
suredbyELIScular wash f
per group). Areated with 1reated with 6xpressed as m
d laser-treaPGE2 level
m with a nuLeukocyte iation was
well as neutyeloperoxitration.
ators, inclul over-prod
al-time PCR at articular w
up treated wittis group treaitis group tre
SA.bIL- 6 levfluid measure
Arthritis group J LLLT (AT
6 J LLLT (ATmean±SEM
ated groupsls when com
umber of uninfiltrationsignificant
trophils in jidase activi
uding IL-1, duced in ch
at articular wwash fluid (*th diclofenacated with 3 J ated with 10
vels at articued by ELISAp (AT); arthrT+1 J); arthriT+6 J); arthr
s (3.0, 6.0, mpared to
nderlying cn to the jointly effectivjoint cavityity that rep
tumor nechondrocyte
wash fluid. b*p < 0.01) (n c (Diclof); J LLLT (AT+0 J LLLT (AT
ular wash fluiA (*p<0.05) ritis group trritis group treritis group tre
and 10.0 Jthe contro
cellular, nt is a hallmve in reducy. This factpresents a
crosis factoes in
76
The = 6
+3 J); T+10
id
eated eated eated
J) l
mark ing t was
or
77
pathological conditions and contribute to amplify the inflammatory process of the joint [13]. Cartilage extracellular matrix degradation and suppression of extracellular matrix biosynthesis are regu- lated by a significant increase in the levels of cytokines in the affected synovial joint [5].
IL-1 was originally detected in OA synovium [14, 15]. Only minimal IL-1 concentrations, particularly in its active form, were found in normal synovial fluid [4]. IL-1 was not detected in plasma even in patients with OA with prominent synovial fluid IL-1 levels, suggesting that IL-1 most likely acts locally and alters cartilage metabolism in OA synovial joints [16]. In our model of acute knee inflammation we could observe that LLLT was able to significantly reduce the concentration of IL-1β in joint wash fluid. These results are important, since IL-1 is implicated in cartilage degradation.
IL-6 was detected in patients with rheumatoid arthritis as well as in patients with osteoarthritis [5]. Some studies showed that IL-6 augmented MMP production while also inhibiting proteoglycan synthesis, increasing cartilage de- struction [17]. From this point of view, LLLT was significantly effective in reducing IL-6 in joint wash fluid in our experimental model of joint inflammation which can indicate an effective reduction of joint cartilage degradation. We agree with the definition given by Brandt et al. [18] that OA as a joint inflammatory disorder is best defined as failed repair of damage that has been caused by excessive stress. In these cases, the innate mechanism of repairing the damage is not able to regenerate the cartilage. In fact, there is equilibrium between cell proliferation and death in healthy tissue. During joint diseases such as osteoarthritis, there will be a higher index of cell death, leading to cartilage and bone destruction and disability. IL-6 is also a key cytokine in this process by the stimulation of metalloproteinases.
Interestingly, COX-1 and COX-2 gene expression presented a tendency of increase in joint fluid after laser irradiation and a significant increase in joint cartilage after laser irradiation (Figs. 4, 5). However, PGE2 levels measured in joint wash fluid were inhibited. COX-2 was originally appointed as a target for anti- inflammatory drugs. Suppression of the activity of this enzyme reduces edema formation and hyperalgesia. However, COX-2 is also a major contributor to the processes that leads to resolution of inflammation (for a review, see [18]). According to the author, injection of carrageenan into the rat paw produced edema formation with greatest increase in paw swelling typically seen 4–6 h after carrageenan administration. However, in wild-type mice, the swelling returned to its normal volume by 24– 48 h and in COX-2-deficient mice, the extent of paw
edema was similar to that in wild-type mice, but the paw swelling failed to resolve even 1 week later. These findings indicate that in fact, COX-2 should play a pivotal role in resolution of inflammation.
Sehan et al. [19] demonstrated that aspirin (ASA) is unique among current pharmacological therapies because it acetylates cyclooxygenase COX-2 enabling
the bmedenhainfiltinhibmodinfla
Ackn2005/
OpenNoncin any
Refe
1. BraAm 3
2. Mapatho
3. TopatienCartil
4. Howith
5. Jikprote
6. Ahmetal39(9)
7. Bainhib
8. BeElsonimmu49(5)
9. Bjoterm meta-
78
Laser
biosynthe- iators. Our
anced by latra- tion, mbited. Thes
dulate inflamammatory m
nowledgment/02117-6 and
n Access Thicommercial Ly medium, p
erences
andt KD, Di34:531–559
artel-Pelletieophysiology
owle CA, Hunts with ostelage 5:293–3
olt I, Cooper disease activ
kko A, Wakisoglycan met
hrens D, Koclloproteinase):1576–1587
aker EA, Stepitors in huma
ensouyad A, n CJ (1990) Cunological an):301–307
ordal JM, Joefficacy of p- analysis of
rs Med Sci (2
sis of R-cor results shaser irradiamyeloperoxse results lemmatory pmediators.
ts The authord CAPES for
s article is diLicense whicprovided the
eppe P, Radi
er J, Alaaeddof osteoarthr
ng HH, Boneoarthritis: a 300
RG, Dentonvity in arthrit
saka T, Iwamtabolism in a
ch AE, Pope e 9 (96-kd ge
phenson TJ, an breast can
Hollander AConcentrationd inflamma
hnson MI, Lphysical interf randomised
2012) 27:71–
ontaining pow that ev
ation, all othxidase activead us to suprocess and
rs would liker the scholar
istributed unch per- mits aoriginal auth
in EL (2008)
ine N, Pelletritis. Front B
assar LJ et apossible auto
n J et al (1992tis. Br J Rheu
moto M et al articular chon
RM, Stein-Pelatinase B) i
Reed MW, Bncer progress
AP, Dularay Bons of glycostory mediato
Lopes-Martinrven- tions inplacebo-con
–78
precursors ven when Cher inflammvity, IL-1, Iuggest thatd possibly s
e to thank FArship to Pallo
nder the termany noncommhor(s) and so
) Etiopathoge
tier JP (1999Biosci 4:D694
al (1997) Detocrine/paracr
2) Cytokine umatol 31:72
(1998) Effecndrocyte cult
Picarella M, Nin human rhe
Brown NJ (2sion and surv
B, Bedwell Asaminoglycanors in rheuma
ns RA, Bogenn osteoarthrintrolled trials
of endogenCOX-1 andmatory maIL-6, and st laser radiastimulating
APESP for thota R.
s of the Creamercial use, urce are cred
enesis of ost
) Cytokines 4–D703
tection of interine role in p
inter- relatio25–733
cts of interleutures. Cell Bi
Niedbala MJeumatoid arth
2002) Expresvival. Mol Pa
AE, Cooper Rns in synoviaatoid arthri-
n B, Chow Rtic knee pains. BMC Mus
nous antiinCOX-2 ex
arkers suchspecially Pation couldg the produ
he research g
ative Commodistribution,
dited.
eoarthritis. R
and their rol
erleukin-1 inpathogenesis.
nships and th
ukin-6 on priol Int 22:61
J (1996) Exprhritis. Arthrit
sion of proteathol 55(5):3
RA, Hutton Cal fluids and tis. Ann Rhe
R, Ljunggren n. A systematcu- loskelet
nflam- matoxpression wh as leukocyPGE2 were d be actinguction of an
grants
ons Attributi, and reprodu
Rheum Dis C
le in the
n the cartilag. Osteoarthri
heir associat
roliferation a5–621
pression of mitis Rheum
einases and 300–304
CW, Dieppe their relation
eum Dis
AE (2007) Satic review anDisord 22(8)
78
ory were yte
g to nti-
on uction
Clin N
ge of itis
tion
and
matrix
PA, n with
Short-nd ):51
10.
11.
12.
13.
14.
degen
Res T
S, Ev1 receOrtho
16. ItmetabRheu
17. Marthri52(3)
18. Winflaminflam
begin
Chow RTtherapy (L
Chow RTlaser therrandomis
Bjordal JPhotoradiclinical e24(2):158
Aimbire FNeto HC,partially ralpha-me
Goupille therapeut
neration: less
Ther 9(6):110
vans CH, Nixeptor antagoop Res 23(1)
to A, Itoh Y, bolism of co
um 35(10):11
Madhok R, Citis: correlati):232–234
Wallace JL (2mmation. Scimmation: the
nning program
T, Barnsley LLLLT) in the
T, Johnson Mrapy in the msed placebo o
M, Johnson iation in acuffects in rand8–168
F, Bjordal JM, Chavantes Mrestores trach
ediated smoo
P, Mullemantic interventi
sons from th
0�15. Haupt
xon AJ (2005nist protein c
):118–126
Sasaguri Y,nnective tiss
197–1201
rilly A, Watsions with clin
2006) COX-2i World J 6:5e
ms the end. N
L (2005) Syse managemen
MI, Lopes-Mamanagement oor active-trea
MI, Iversen te pain: a sysdomized plac
M, Iversen VMC, Labat Rhea muscle rth airway mu
n D, Chevalion in interve
e osteoarthri
t JL, Frisbie
5) Dual transcontrols cart
Morimatsu sue compone
son J, Capellnical and lab
2: a pivotal e577–588 19.
Nat Immuno
stematic revieent of neck pa
artins RAB, of neck pain:atment contro
V, Aimbire Fstematic revicebo-control
VV, AlbertiniRM, Lopes-Mrelaxation resuscle dysfun
ier X (2007) ertebral disc
itic experienc
DD, McIlwr
sduction of intilage degrad
M, Mori Y (ents in rheum
l HA (1993) boratory indic
enzyme in muSerhan CN,
ol 6(12):1191
ew of the liteain. Lasers S
Bjordal JM (: a systematiolled trials. L
F, Lopes-Maiew of possiblled trials. Ph
i R, Frigo L, Martins RA (sponse in rat
nction. Lasers
Is interleuki
ce. Arthritis
raith CW, Ro
nsulin-like grdation in an o
(1992) Effectmatoid synovi
Serum interlces of diseas
ucosal protecSavill J (200
1–1197
erature of lowSurg Med 37(
(2009) Efficac review and
Lancet 374(9
artins RA (20ble mechanishotomed Las
Pacheco MT2006) Low-l
ts with tumors Surg Med 3
n-1 a good ta
obbins PD, G
rowth factor-osteoarthritic
ts of interleuial fibroblast
leukin 6 levee activity. A
ction and res05) Resolutio
w-level laser(1):46–52
acy of low-led meta-analy9705):1897–1
006) sms of actionser Surg
T, Castro-Farlevel laser thr necrosis fac38(8):773–7
arget for
Ghivizzani
r-I and interle culture mod
ukin-6 on thets. Arthritis
els in rheumaAnn Rheum D
solution of on of
79
r
evel ysis of 1908
n and
ria-herapy ctor 78
eukin-del. J
e
atoid Dis
80
Artigo 2
Photochemistry and Photobiology, 2011, 87: 1447–1452
Infrared (810 nm) Low-level Laser Therapy in Rat Achilles Tendinitis: A Consistent Alternative to Drugs
Rodrigo Labat Marcos1, Ernesto Cesar Pinto Leal Junior2, Felipe de Moura Messias2, Maria Helena Catelli de Carvalho3, Rodney Capp Pallotta1, Lúcio Frigo4, Rosângela Aparecida dos Santos3, Luciano Ramos1, Simone Teixeira1, Jan Magnus Bjordal5 and Rodrigo Álvaro Brandão Lopes-Martins*1,2
1Laboratory of Pharmacology and Experimental Therapeutics, Department of Pharmacology, Institute of Biomedical Sciences, University of Sa ̃o Paulo, Sa ̃o Paulo, SP-Brazil
2Post Graduate Program in Rehabilitation Sciences, Nove de Julho University (UNINOVE), São Paulo, SP-Brazil
3Laboratory of Hypertension, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo, São Paulo, SP-Brazil
4Biological Sciences and Health Center, Cruzeiro do Sul University, São Paulo, SP-Brazil 5Section of Evidence Based Practice, Bergen University College, Bergen, Norway
Received 1 August 2011, accepted 1 September 2011, DOI: 10.1111/j.1751-1097.2011.00999.x
ABSTRACT
Nonsteroidal anti-inflammatory drugs (NSAIDs) are widely used and can reduce musculoskeletal pain in spite of the cost of adverse reactions like gastrointestinal ulcers or cardiovascular events. The current study investigates if a safer treatment such as low-level laser therapy (LLLT) could reduce tendinitis inflam- mation, and whether a possible pathway could be through inhibition of either of the two-cyclooxygenase (COX) isoforms in inflammation. Wistar rats (six animals per group) were injected with saline (control) or collagenase in their Achilles tendons. Then, we treated them with three different doses of IR LLLT (810 nm; 100 mW; 10 s, 30 s and 60 s; 3.57 W cm)2; 1 J, 3 J, 6 J) at the sites of the injections, or intramuscular diclofenac, a nonselective COX inhibitor ̊NSAID. We found that LLLT dose of 3 J significantly reduced inflammation through less COX-2-derived gene expression and PGE2 production, and less edema formation compared to nonirradiated controls. Diclofenac controls exhibited significantly lower PGE2 cytokine levels at 6 h than collagenase control, but COX isoform 1-derived gene expression and cytokine PGE2 levels were not affected by treatments. As LLLT seems to act on inflammation through a selective inhibition of the COX-2 isoform in collagenase-induced tendinitis, LLLT may have potential to become a new and safer nondrug alternative to coxibs.
INT
Tenddisorpharmtendiwhile
*Corre
Ó 2011
inclu(6).
For atargebeenand gpharminjurnonpinflam
Loadand cmodeincrecoulddirecprofi
Collahas pstudiinjeccolla
Low-acuteinvoltendipositinflam
1447
1448
obsersame
TRODUC
dinitis and orders in modma- cologicinopathies ae extrinsic r
esponding autho
1 The Authors�P
ude high-fre
acute and sueted at reducn observed fglucocorticoma- ceuticaries (10–14)pharmacologmmatory te
ding of tendconsequentlel of healthyease as a resd in turn be ct ‘‘in vivo’ile after an i
agenase is kpreviously bies found inction (19,20agenase-indu
-level laser e tendinitis lved are notinopathy tretive results (mmatory pr
7
8 Rodrigo L
rved that spe level as a h
CTION
other tendindern societycal agents inare middle orisk factors
or email: rmart
Photochemistry an
equency of w
ubacute tendcing inflammfor pharmacoid injectional agents ma). In this pergical alternaendinitis res
don cells seely the releasy Achilles tsponse to tenblocked by’ evidence cinflamma- t
known to habeen used tonflammatory), but the kiuced tendin
therapy (LLand other tet well undereatments, w(21). One process. In a
Labat Marco
pecific dosehuman equi
opathies arey and they an primary heor older age
ins@icb.usp.br
nd Photobiology Ó
work-related
dinitis theremation and otherapies sns (9). Howay negativelrspective, thatives to exaponse with
ems to increse of prostagtendons, perndon loadin
y a COX-2 iconcerning tory stimulu
ave both proo induce acuy cell migrainetic profil
nitis is not y
LLT) has beendin- opathrstood. In a
we pointed ouossible undprevious st
os et al.
s of LLLT ripotent dose
e among theare commonealth care (
e (3), diabete
r (Rodrigo A ́ lv
Ó 2011 The Ame
d repetitive
e is consensuedema (7).
such as nonwever, experly affect thehere is a neeamine if theless advers
ease the expglandin E2 (ritendinous ng (15). Thiinhibitor (ceCOX-2 gen
us.
oinflammatoute tendinitiation and edle of the infl
yet determin
een used wihies for the previous reut that seve
derlying mectudy, we
reduced acue of the non
e most prevnly treated w1,2). Intrinses (4) and a
varo Branda ̃o L
erican Society of
movement
us that the a Short-term
nsteroidal anrimental stue healing proed for invesey can modue effects tha
pression of c(PGE2). In aPGE2 conce
is activity-inelecoxib) (1ne expressio
ory and degis in animalema during
flammatory ned.
ith mixed relast three d
eview of theeral mechanchanism is a
ute rat paw ensteroidal an
alent muscuwith anti-infsic risk factoantibiotic tre
Lopes-Martins)
Photobiology 003
s in non-neu
aim of theram effects in tnti- inflammudies have foocess after atigating ulate the acuan drugs.
cyclooxygena human expentra- tions nduced relea6). Howeve
on in tendon
generative p models (17the first da
process in t
esults in clinecades, but
e applicationisms could a modula- ti
edema to apnti-inflamm
uloskeletal flammatoryors for eatment (5),
)
31-8655/11
utral positio
apy should btendinitis ha
matory drugfound that thacute tendo
ute
nase-2 (COperimental seemed to ase of PGEer, there is lns and its tim
properties an7,18). Theseays after this model o
nical studie the mechann of LLLT iaccount for
tion of the
pproximatelmatory drug
81
y
,
ons
be ave s (8)
hese n
X-2)
2 little me
nd it e
of
s of nisms in r the
ly the
82
diclofenac (22). This finding has been supported by similar macroscopic and histological findings in other animal models comparing LLLT and tenoxicam (23), meloxicam (24) and celecoxib (25). In a human model of activating Achilles tendinitis by overload, we found that PGE2 was reduced by LLLT, but if and how LLLT act on COX isoforms remains uncertain. In this study, we aim at mapping the short-term time profile of rat collagenase-induced tendinitis and to measure the gene expres- sions of the COX isoforms and their respective prostaglandin PGE2 production in tendons. In addition, we sought to investigate if LLLT could affect the inflammatory process in rat Achilles tendons.
MATERIALS AND METHODS
All of the experimental procedures were submitted and approved by the Ethical Committee of the University of Sao Paulo. One hundred and fifty male Wistar rats weighing about 250 g were randomly divided and housed five per cage before the experimental procedure. Food and water were provided ad libitum throughout the experiment. Rats were anesthetized with inhalatory halothane before collagenase injection. All the necessary preoperative procedures were performed in order to prevent discomfort and to avoid any infection. Skin was surgically prepared and the collagenase (30lL of crude collagenase— 1 mg mL)1; Sigma, St. Louis, MO; Cat# C-6885—using a 30 G needle) was injected percutaneously parallel to the right Achilles tendon ca 2 mm above the osteotendinous junction under anesthesia. Collagenase was dissolved in sterile PBS containing 50 mM NaH2P04, 10 mM NaCl at pH 7.1. The same volume of PBS without collagenase was injected using the same procedure in a control group of six animals. In another control group of six animals, a prefabricated solution of diclofenac 1 mg kg)1 rat bodyweight was injected in the abdomen 30 min prior to the collagenase injection.
Animals were sacrificed with an overdose of halothane at the different outcome timepoints (2, 4, 6, 12, 24, 48 and 72 h, 7 and 14 days). After the removal of skin and connective tissue, Achilles tendons were removed and processed for further analysis.
LLLT procedure. A single LLLT was performed 1 h after collage- nase injection with an IR laser unit (DMC, Sao Carlos, Brazil). The laser unit emitted a continuous optical output of 100 mW with a wavelength of 810 nm to a spot size area of 0.028 cm2, which gave a power density of 3.57 W cm)2. The optical output of the laser unit was measured before, halfway through and after the experiment. Laser irradiation was performed in skin contact at the site of collagenase injection with doses of 1 J (35.71 J cm)2), 3 J (107.14 J cm)2) and 6 J (214.29 J cm)2) and corresponding irradiation times of 10, 30 and 60 s, respectively. The laser energy doses were chosen according to previous studies of our research group (22,25).
Analyses. For all analyses we used a sample of six animals. An observer who was blinded to group allocation performed all analyses. Initial analysis was performed at Section of Pharmacology, ICB at University of Sao Paulo, Brazil. To insure consistency in analyses and reproducibility of results, two other laboratories at University of Sao Paulo (Brazil) duplicated the analyses.
RNA isolation and Real Time PCR analysis: At the selected time- points Achilles tendons were dissected, frozen in liquid nitrogen, and stored at )80°C. Total RNA was isolated in the Trizol reagent, according to the manufacturer’s instruction.
DNase I was employed to digest DNA to obtain RNA purification and the integrity of RNA was verified by agarose gel electrophoresis. Total RNA (2 lg) was used for first-strand cDNA synthesis (reverse transcriptase [RT]) using SuperScript II. In addition, RNaseOUT was also added to protect the RNA during this process. Three pooled RNA aliquots were routinely sham
83
reverse transcribed (i.e. RT omitted) to insure the absence of DNA contaminants. Diluted RT samples (1:10) were submitted to real-time PCR amplification using Platinum Sybr QPCR Supermix-UDG and specific oligonucleotides for COX-1
(forward: CCGTGCGAGTACAGTCACAT; reverse: CCTCACCAG TCATTCCCTGT) and COX-2 (forward: AGATCAGAAGCGAG GACCTG; reverse: CCATCCTGGAAAAGTCGAAG).
Beta-actin was used as an internal control (forward: AAGATTTG GCACCACACTTTCTACA; reverse: CGGTGAGCAGCACAGG GT).
The conditions for PCR were as follows: 50°C—2min; 95°C—2 min, followed by 30 cycles of 95°C—15 s; 60°C—1 min and 72°C—15 s. Ct values were recorded for each gene, and the results of genes of interest were normalized to results obtained with the internal control gene. ddCT were calculated and the results are expressed as fold increase. All oligonucleotides and reagents utilized in this protocol were purchased from Invitrogen Co.
PGE2—production derived from each COX isoform: PGE2 genera- tion was analyzed and determined according to the manufacturer instructions by ELISA (R & D Systems, Minneapolis, MN). In order to separate the two-COX isoforms, we used indomethacin as a nonspecific inhibitor and etoricoxib as a selective COX-2 inhibitor (26). The amount of PGE2 production derived from each isoform was then calculated according to the difference between complete inhibi- tion by indomethacin and partial inhibition by the selective COX-2 inhibitor etoricoxib.
Vascular permeability—Evans Blue: An Evans Blue dye (25 mg mL)1; MERCK) was dissolved in saline solution and then filtered in a sterilized membrane (0.22 m; MILLIPORE) and conserved at 4°C.
The animals were previously anesthetized with halothane and then injected peritendinously with the Evans Blue dye, 1 h before euthana- sia. Animals were sacrificed by halothane super dose. After the sacrifice, the tendon was collected, weighed and conserved for 24 h at
37°C in a glass tube in Formamide solution (MERCK article )1
9684,1000, 4 mL g ) for dye extraction. A 150 lL sample from each tube was used for determination of Evans Blue concentrations (BIOTEK Spectrophotometer 618–620 nm). The results were analyzed by linear regression, correlation and the Tukey–Kramer multiple comparisons tests.
Edema formation—wet–dry weight measurements: After collage- nase injection, the rat Achilles tendons were excised after 24 h, in order to evaluate edema formation. Tendons were dried for 48 h at 60°C and edema was then calculated from the difference between wet and dry weight, measured with a precision analytical balance (0.0001 mg sensitivity). As tendon matrix is a firm structure and the formation of edema is less prevalent than in soft tissue which is of looser structure, an extra control group receiving the nonsteroidal anti-inflammatory drug (NSAID) diclofenac was added for this comparison.
Statistical analysis. A blinded observer unaware of the allocation to groups performed the statistical analysis. Data are expressed as mean and standard error (±) of the mean (SEM). All data were statistically evaluated by analysis of variance (ANOVA), followed by the New- man–Keuls–Student’s test. Values with P < 0.05 were considered to be statistically significant.
RESULTS
Characteristics of acute inflammation in the collagenase-induced tendinitis model
84
COX-1 and COX-2 gene expression by real-time PCR. There was a sharp decrease in mRNA expression for COX-1 after collagenase injection at 2 h, thereafter it stabilized at a low level for the first 24 h. On the other hand, COX-2 mRNA expression increased sharply after collagenase injection and peaked at 2 h. It stayed significantly higher than baseline for the first 24 h. The results suggested that 2 h after collagenase injection would be the most suitable timepoint for measuring effects on COX-1 and COX-2 gene expression from anti- inflammatory therapies. In addition, the results suggest that anti-inflammatory effects should be expressed as an ability to increase COX-1 expression and reduce COX-2 expression at the 2 h timepoint (Fig. 1A).
Effects of low-level laser irradiation on COX-1 gene expression.
All therapeutic groups exhibited highly significant increases in COX-1 mRNA expressions (P < 0.0001) compared to the collagenase control group at 2 h after collagenase injections. There were no significant differences between diclofenac and the LLLT groups (P = 0.18–0.91) (Fig. 1B).
Effects of low-level laser irradiation on COX-2 gene expression.
There were no significant effects on the COX-2 gene expression at 2 h from diclofenac and LLLT with an energy dose of 1 J. LLLT with an energy dose of 6 J significantly reduced COX-2 gene expression (P < 0.05), whereas LLLT with an energy dose of 3 J induced a highly significant reduction of COX-2 gene expression (P < 0.0001) compared to the collagenase control. The LLLT with 3 J also reduced the COX-2 gene expression to a level significantly lower (P < 0.05) than the saline control (Fig. 1C).
Effects of LLLT on tendon COX-1-derived PGE2 production.
Tendon tissue produced higher concentrations of COX-1- derived PGE2 than COX-2-derived PGE2 at 6h after collagenase injections. PGE2 concentration derived from COX-1 isoform exhibited statistical significance versus saline control, while PGE2 concentration derived from COX-2 isoform was significantly different from saline (data not shown).
Neither diclofenac nor energy doses of 3 J and 6 J LLLT significantly affected PGE2 production derived from the COX-1 enzyme compared to collagenase controls. LLLT with an energy dose of 1 J significantly (*P < 0.05) increased the COX-1-derived PGE2 production (Fig. 2A).
LLLT doses of 1 J and 3 J LLLT significantly reduced PGE2 production derived from the COX-2 isoform (P = 0.001 and P = 0.01, respectively), while 6 J of LLLT was not significantly different (P = 0.08) from the collagenase control group (Fig. 2B).
Vascular permeability (Evans Blue Dye). The time course for vascular permeability measured by Evans Blue dye showed significantly increased permeability versus saline control. As expected, the onset for vascular extravasation was slower than for reactions related to gene expression and PGE2 production and no significant differences from saline control were seen up to the 6 h timepoint. However, vascular permeability peaked at 12 h and remained significant at 24 and 48 h (P < 0.05) after collagenase injection (Fig. 3A).
85
There was a significant reduction of vascular permeability and extravasation measured by Evans Blue dye at 12 h from LLLT doses of both 3 and 6 J (P < 0.05). Neither diclofenac, nor LLLT with an energy dose of 1 J, differed significantly from the collagenase control group in vascular permeability (Fig. 3B).
Edema formation in tendon tissue. Diclofenac and LLLT doses of 1 and 6 J were not significantly different from the collagenase control group in wet weight ̊dry weight differ- ences at 12 h after the collagenase injection. However, there was a significant reduction in the wet weight–dry weight difference in the group receiving LLLT with an energy dose of 3 J, and both the collagenase and diclofenac (P < 0.01) groups (Fig. 4).
DISCUSSION
In this experiment we have demonstrated that the collagenase- induced tendinitis model may be suitable for studying the sequence of acute inflammatory responses in tendon tissue. The characterization of the experimental model with
Photochemistry and Photobiology, 2011, 87 1449
FigurCOX(B) Cand cexpreLLLTanimacontrlaser
re 1. (A) TimX-1 values areCOX-1 mRNcollagenase +ession 2 h aftT treatments als per group
rol group. Thgroup (*P <
me course of e related to th
NA expression+ laser treatmter collage- nwith 1, 3 an
p. (**P < 0.0he COX-2 lev 0.05). COX
COX-1 and he right y- axn 2 h after co
ments with 1,nase injectiond 6 J of ener
001) betweenvel was signi
X = cyclooxyg
COX-2 mRNxis, and COXollagenase in, 3 and 6 J ofn in saline, crgy. The valun each treatedificantly lowgenase; LLL
NA expressioX-2 values arnjection in saf energy (*P control (collaues are expred group and n
wer in the 3 J LT = low- lev
on after collare related to
aline, control < 0.05). (C)
agenase) and essed as meannonirradiatedlaser group t
vel laser thera
agenase injecthe left y-ax
l (collagenaseCOX-2 mRNcollagenase
n ± SEM. N d collagenasthan in the 6apy.
86
ction. xis. e) NA + = 6 e J
1450
Figur(collagroupgroup(collaexprecompCOX
0 Rodrigo L
re 2. (A) Levagenase) andp. There werps. (B) Levelagenase) andessed as meaparisons betw
X = cyclo- ox
Labat Marco
vels of COX-d collagenasee no significls of COX-2-
d collage- nasan ± SEM. N ween treated ygenase; LL
os et al.
-1-derived PGe + LLLT treant differenc-derived PGEse + LLLT tr= 6 animals groups and c
LLT = low-le
GE2 6 h aftereatments withces between E2, 6 h after reatments wi per group. Tcollagenase cevel laser the
r collagenaseh 1, 3 and 6 Jthe collagencollagenase ith 1, 3 and 6There are sigcontrol grouprapy.
e injection inJ of energy. Nase control ginjection in
6 J of energynificant diffep (*P < 0.05;
n saline, contN = 6 animagroup and tresaline, contr
y. The values ferences in ; **P < 0.01
87
trol als per eated rol
are
).
Figurextravanimacollagpermreceiv6 J re
Figurforma
re 3. (A) Timvasation afteals per groupgenase group
meability as mving LLLT eeached statist
re 4. Effect oation after co
me course of er collagenasp. There werps at 12, 24 a
measured by Eexhibited lesstical significa
of the NSAIDollagenase in
vascular permse injection. Te significantand 48 h (*P Evans dye bls edema thanance (*P < 0
D diclofenac,njection, mea
meability as The values at differences < 0.05; **Plue at 12 h pn the collage0.05). LLLT
, and LLLT dasured by the
measured by
are expressedbetween the < 0.01). (B)ostinjection.nase control = low-level l
doses of 1 J, e difference b
y Evans blued as mean ± S
saline contro) Showing thAlthough algroup, only
laser therapy
3 J and 6 J obetween wet
e dye SEM. N = 6 rol group andhe vascular ll groups doses of 3 J
y.
on tendon edweight and
88
d
J and
dema dry
89
weight 12 h after the collagenase injection. The graph is representative of six animals per group (*P < 0.05 compared to collagenase group). NSAID = nonsteroidal anti-inflammatory drugs; LLLT = low-level laser therapy.
collagenase-induced inflammation revealed that mRNA expression for COX-1 decreased, while mRNA COX-2 expression increased at 2 h. This finding contradicts the common opinion that anti-inflammatory effects are achieved by reducing activity in both COX isoforms. Consequently, anti-inflammatory effects from therapies on gene expression at this stage should increase COX-1 gene expression, and reduce COX-2 gene expression. At the 6 h timepoint, PGE2 produc- tion was significantly increased for both isoforms. Vascular extravasation and edema peaked at 12 h, but was not measured separately for each COX isoform. This character- ization validates the use of this model to investigate possible anti-inflammatory effects of therapies at the above timepoints for maximal inflammatory expression for the respective outcomes.
In the therapeutic part of the trial, we found that gene expression of COX-1 increased significantly in all LLLT groups and also in the diclofenac control group. This finding is in line with an anti-inflammatory effect of these therapies. However, for the gene expression of COX-2, neither diclofenac
control nor LLLT doses of 1 and 6 J produced anti-inflam- matory effects. However, a dose of 3 J significantly reduced COX-2 gene expression. Diclofenac control and LLLT of 1 and 3 J reduced only COX-2-derived PGE2. For the
macroscopic end result, vascular permeability and edema formation at 12 h were significantly reduced by LLLT with a dose of 3 J. Putting the sequences together, LLLT with a dose of 3 J exhibited the most consistent anti-inflammatory effects throughout the experiment. It was significantly superior to diclofenac for three outcomes, equal in two and inferior in one outcome.
In previous studies, LLLT has been found to be equally effective as NSAIDs in the acute inflammatory stage across several experimental models and types of NSAIDs such as indomethacin (27), diclofenac (22), meloxicam (24), tenoxicam (23) and celecoxib (25).
The least effect from LLLT was found on the tendon weight ̊ dry weight difference, but this may be caused by the tendon tissue structure that is quite solid and allows for less expansion than looser tissue such as in the rat paw model (22). When administered orally, rofecoxib has the undesired sys- temic side-effect that it increases platelet aggregation and thereby increases the risk for myocardial infarct (28). Follow- ing this discovery, caution has been advocated in the systemic use of orally administered COX-2 inhibitors (29). But the enormous increase in prescription rates for COX-2 inhibitors during the first years after introduction (30) shows that there was an urgent need for finding new treatment solutions for musculoskeletal disorders with an inflammatory component. The traditional nonspecific NSAIDs have undesired side- effects on the gastro-intestinal tract (31). In addition, both COX-2 specific and nonspecific NSAIDs seem to have negative effects on the healing process of tendons (12,32). In animal studies, glucocorticoids seem to cause even more deleterious effects on tendon tissue with tendon degeneration (33) and increased apoptosis (34). Contrary to this, a number of authors have found positive effects and accelerated tendon repair after LLLT application in injured Achilles tendons of animals (35– 38). This dual action of both
90
anti-inflammatory action and enhancement of tendon repair seems to be unique to LLLT, and offers potential for refinement of LLLT dosing in clinical studies. LLLT is also well tolerated among patients with no reports of serious adverse events and the occurrence of minor side-effects being no different from placebo (39).
The collagenase-induced tendinitis is an experimental model to study tendon inflammation. However, this model may not represent exactly what happens in human pathologies, and this could be a limitation of the present study. On the other hand, our results strongly suggest a new explanation for why LLLT also seems to work with similar doses in other bodily locations such as neck pain (40,41), knee osteoarthritis (42) and hand rheumatoid arthritis (43).
CONCLUSION
In this study, we have demonstrated that the collagenase- induced tendinitis model is suitable for evaluating effects of anti-inflammatory treatments. We also found that LLLT (k = 810 nm, 100 mW) administered with an energy dose of 3 J significantly increased COX-1 gene expression, reduced COX-2 gene expression and COX-2-derived PGE2 production, vascular permeability and edema formation compared to no treatment. The effects of 3 J of LLLT were significantly better than the NSAID diclofenac in four out of five outcomes of COX-2 gene expression and edema formation, similar for
vascular permeability and significantly less for inhibition of COX-2-derived PGE2.
Ethicalstandards—ThisresearchfollowsthecurrentBrazilianlawsof experiments with animals.
Conflict of interests—All the authors declare no conflict of interests related to this research.
REFERENCES
1. van der Windt, D. A., B. Koes, B. A. de Jong and L. M. Bouter (1995) Shoulder disorders in general practice: Incidence, patient characteristics an management. Ann. Rheum. Dis. 54, 959–964.
2. Smidt, N. and D. A. van der Windt (2006) Tennis elbow in pri- mary care. BMJ 333, 927–928.
3. Fahlstrom, M., R. Lorentzon and H. Alfredson (2002) Painful conditions in the Achilles tendon region: A common problem in middle-aged competitive badminton players. Knee Surg. Sports Traumatol. Arthrosc. 10, 57–60.
4. Miranda, H., E. Viikari-Juntura, S. Heistaro, M. Heliovaara and H. Riihimaki (2005) A population study on differences in the determinants of a specific shoulder disorder versus nonspecific shoulder pain without clinical findings. Am. J. Epidemiol. 161, 847–855.
5. Melhus,A.(2005)Fluoroquinolonesandtendondisorders.Expert Opin. Drug Saf. 4, 299–309.
6. Tanaka, S., M. Petersen and L. Cameron (2001) Prevalence and risk factors of tendinitis and related disorders of the distal upper extremity among U.S. workers: Comparison to carpal tunnel syndrome. Am. J. Ind. Med. 39, 328–335.
7. Johansson, K., L. Adolfsson and M. Foldevi (1999) Attitudes toward management of patients with subacromial pain in Swedish primary care. Fam. Pract. 16, 233–237.
91
8. Green, S., R. Buchbinder, L. Barnsley, S. Hall, M. White, N. Smidt and W. Assendelft (2002) Non-steroidal anti-inflammatory drugs (NSAIDs) for treating lateral elbow pain in adults. Coch- rane Database Syst. Rev. 2, CD003686.
9. Smidt, N., W. J. Assendelft, D. A. van der Windt, E. M. Hay, R. Buchbinder and L. M. Bouter (2002) Corticosteroid injections for lateral epicondylitis: A systematic review. Pain 96, 23–40.
10. Riley, G. P., M. Cox, R. L. Harrall, S. Clements and B. L. Hazleman (2001) Inhibition of tendon cell proliferation and matrix glycosaminoglycan synthesis by non-steroidal anti-inflam- matory drugs in vitro. J. Hand Surg. 26, 224–228.
11. Ferry, S. T., L. E. Dahners, H. M. Afshari and P. S. Weinhold (2007) The effects of common anti-inflammatory drugs on the healing rat patellar tendon. Am. J. Sports Med. 35, 1326–1333.
12. Cohen, D. B., S. Kawamura, J. R. Ehteshami and S. A. Rodeo (2006) Indomethacin and celecoxib impair rotator cuff tendon- to-bone healing. Am. J. Sports Med. 34, 362–369.
13. Akpinar,S.,M.A.Hersekli,H.Demirors,R.N.TandoganandF. Kayaselcuk (2002) Effects of methylprednisolone and betameth- asone injections on the rotator cuff: An experimental study in rats. Adv. Ther. 19, 194–201.
14. Tsai, W. C., F. T. Tang, M. K. Wong and J. H. Pang (2003) Inhibition of tendon cell migration by dexamethasone is correlated with reduced alpha-smooth muscle actin gene expression: A potential mechanism of delayed tendon healing. J. Orthop. Res. 21, 265–271.
15. Langberg, H., D. Skovgaard, M. Karamouzis, J. Bulow and M. Kjaer (1999) Metabolism and inflammatory mediators in the peritendinous space measured by microdialysis during intermittent isometric exercise in humans. J. Physiol. 515, 919–927.
16. Langberg,H.,R.Boushel,D.Skovgaard,N.RisumandM.Kjaer (2003) Cyclo-oxygenase-2 mediated prostaglandin release regu- lates blood flow in connective tissue during mechanical loading in humans. J. Physiol. 551, 683–689.
17. Marsolais, D., C. H. Cote and J. Frenette (2003) Nonsteroidal anti-inflammatory drug reduces neutrophil and macrophage accumulation but does not improve tendon regeneration. Lab. Invest. 83, 991–999.
Photochemistry and Photobiology, 2011, 87 1451
1452 Rodrigo Labat Marcos et al.
Stone, D., C. Green, U. Rao, H. Aizawa, T. Yamaji, C. Niyibizi, G. Carlin and S. L. Woo (1999) Cytokine-induced tendinitis: A preliminary study in rabbits. J. Orthop. Res. 17, 168–177.
Wetzel, B. J., G. Nindl, J. A. Swez and M. T. Johnson (2002) Quantitative characterization of rat tendinitis to evaluate the effi- cacy of therapeutic interventions. Biomed. Sci. Instrum. 38, 157–162.
Marsolais, D., C. H. Cote and J. Frenette (2001) Neutrophils and macrophages accumulate sequentially following Achilles tendon injury. J. Orthop. Res. 19, 1203–1209.
Bjordal, J. M., C. Couppe ́ and A. E. Ljunggreen (2001) Low level laser therapy for tendinopathy. Evidence of a dose-response pat- tern. Phys. Ther. Rev. 6, 91–99.
92
Reduced risk of upper gastrointestinal ulcer complications with celecoxib, a novel COX-2 inhibitor. Am. J. Gastroenterol. 95, 1681–1690.
32. Dimmen, S., L. Engebretsen, L. Nordsletten and J. E. Madsen (2009) Negative effects of parecoxib and indomethacin on tendon healing: An experimental study in rats. Knee Surg. Sports Trau- matol. Arthrosc. 17, 835–839.
33. Tatari, H., C. Kosay, O. Baran, O. Ozcan and E. Ozer (2001) Deleterious effects of local corticosteroid injections on the Achilles tendon of rats. Arch. Orthop. Trauma Surg. 121, 333–337.
34. Hossain, M. A., J. Park, S. H. Choi and G. Kim (2008) Dexamethasone induces apoptosis in proliferative canine tendon cells and chondrocytes. Vet. Comp. Orthop. Traumatol. 21, 337–
22. Albertini, R., F. S. Aimbire, F. I. Correa, W. Ribeiro, J. C. Cogo,�E. Antunes, S. A. Teixeira, G. De Nucci, H. C. Castro-Faria- 342.
Neto, R. A. Zangaro and R. A. Lopes-Martins (2004) Effects of different protocol doses of low power gallium–aluminum–arsenate (Ga–Al–As) laser radiation (650 nm) on carrageenan induced rat paw ooedema. J. Photochem. Photobiol. B 74, 101–107.
15. Ulugol, A., H. Unalan, I. Dokmeci and S. Kokino (1997) Com- parison of the effects of tenoxicam and mid-laser irradiation on chronic adjuvant arthritis in rats. Clin. Exp. Rheumatol. 15, 83–86.
16. Campana, V. R., M. Moya, A. Gavotto, F. Soriano, H. O. Juri, L. S. Spitale, J. C. Simes and J. A. Palma (1999) The relative effects of HeNe laser and meloxicam on experimentally induced inflam- mation. Laser Ther. 11, 36–41.
17. Aimbire, F., R. A. Lopes-Martins, R. Albertini, M. T. Pacheco, H. C. Castro-Faria-Neto, P. S. Martins and J. M. Bjordal (2007) Effect of low-level laser therapy on hemorrhagic lesions induced by immune complex in rat lungs. Photomed. Laser Surg. 25, 112–117.
18. Ajuebor, M. N., A. Singh and J. L. Wallace (2000) Cyclooxy- genase-2-derived prostaglandin D(2) is an early anti-inflammatory signal in experimental colitis. Am. J. Physiol. Gastrointest. Liver Physiol. 279, G238–G244.
19. Honmura, A., A. Ishii, M. Yanase, J. Obata and E. Haruki (1993) Analgesic effect of Ga–Al–As diode laser irradiation on hyperal- gesia in carrageenin-induced inflammation. Lasers Surg. Med. 13, 463–469.
20. Juni, P., L. Nartey, S. Reichenbach, R. Sterchi, P. A. Dieppe and M. Egger (2004) Risk of cardiovascular events and rofecoxib: Cumulative meta-analysis. Lancet 364, 2021–2029.
21. Zhang, W., R. W. Moskowitz, G. Nuki, S. Abramson, R. D. Altman, N. Arden, S. Bierma-Zeinstra, K. D. Brandt, P. Croft, M. Doherty, M. Dougados, M. Hochberg, D. J. Hunter, K. Kwoh, L. S. Lohmander and P. Tugwell (2008) OARSI recom- mendations for the management of hip and knee osteoarthritis, part II: OARSI evidence-based, expert consensus guidelines. Osteoarthr. Cartil. 16, 137–162.
22. Rawson, N. S., P. Nourjah, S. C. Grosser and D. J. Graham (2005) Factors associated with celecoxib and rofecoxib utilization. Ann. Pharmacother. 39, 597–602.
23. Goldstein, J. L., F. E. Silverstein, N. M. Agrawal, R. C. Hubbard, J. Kaiser, C. J. Maurath, K. M. Verburg and G. S. Geis (2000)
93
35. Elwakil, T. F. (2006) An in-vivo experimental evaluation of He–Ne laser photostimulation in healing Achilles tendons. Lasers Med. Sci. 22, 53–59.
36. Fillipin, L. I., J. L. Mauriz, K. Vedovelli, A. J. Moreira, C. G. Zettler, O. Lech, N. P. Marroni and J. Gonzalez-Gallego (2005) Low-level laser therapy (LLLT) prevents oxidative stress and reduces fibrosis in rat traumatized Achilles tendon. Lasers Surg. Med. 37, 293–300.
37. Reddy, G. K., L. Stehno-Bittel and C. S. Enwemeka (1998) Laser photostimulation of collagen production in healing rabbit Achilles tendons. Lasers Surg. Med. 22, 281–287.
38. Salate, A. C., G. Barbosa, P. Gaspar, P. U. Koeke, N. A. Pariz- otto, B. G. Benze and D. Foschiani (2005) Effect of In–Ga–Al–P diode laser irradiation on angiogenesis in partial ruptures of Achilles tendon in rats. Photomed. Laser Surg. 23, 470–475.
39. Bjordal, J. M., R. A. Lopes-Martins, J. Joensen, A. E. Ljunggren, C. Couppe, A. Stergioulas and M. I. Johnson (2008) A systematic review with procedural assessments and meta-analysis of low level laser therapy in lateral elbow tendinopathy (tennis elbow). BMC Musculoskelet Disord. 9, 75.
40. Gross, A. R., C. Goldsmith, J. L. Hoving, T. Haines, P. Peloso, P. Aker, P. Santaguida and C. Myers (2007) Conservative manage- ment of mechanical neck disorders: A systematic review. J. Rheumatol. 34, 1083–1102.
41. Chow, R. T., M. I. Johnson, R. A. Lopes-Martins and J. M. Bjordal (2009) Efficacy of low-level laser therapy in the manage- ment of neck pain: A systematic review and meta-analysis of randomised placebo or active-treatment controlled trials. Lancet 374, 1897–1908.
42. Bjordal, J. M., M. I. Johnson, R. A. Lopes-Martins, B. Bogen, R. Chow and A. E. Ljunggren (2007) Short-term efficacy of physical interventions in osteoarthritic knee pain. A systematic review and meta-analysis of randomised placebo-controlled trials. BMC Musculoskelet Disord. 8, 51.
43. Brosseau, L., V. Welch, G. Wells, R. deBie, A. Gam, K. Harman, M. Morin, B. Shea and P. Tugwell (2000) Low level laser therapy (classes I, II and III) for the treatment of osteoarthritis. Cochrane Database Syst. Rev. 2, CD002046.
top related